South american white shrimp heat shock protein 60a gene molecular marker and application thereof

Abstract

The application discloses a kind of Penaeus vannamei heat shock protein 60A gene molecular markers, it includes molecular marker A, molecular marker B, molecular marker C, molecular marker D, molecular marker E, molecular marker F, molecular marker G and molecular marker H on the sequence of Penaeus vannamei heat shock protein 60 gene;The molecular marker described in the application is significantly related to the cold tolerance of Penaeus vannamei, and can be used as a functional marker for the cold tolerance of Penaeus vannamei;The genotypes of the molecular marker A, the molecular marker B, the molecular marker C, the molecular marker D, the molecular marker E, the molecular marker F, the molecular marker G and the molecular marker H are determined by extracting the genomic DNA of the muscle tissue of the Penaeus vannamei to be tested, performing PCR amplification and sequencing the obtained product, and then selecting individuals with dominant genotypes for Penaeus vannamei breeding, so as to accurately and efficiently breed Penaeus vannamei with cold tolerance and stress resistance, and provide a feasible scheme for breeding cold-tolerant varieties of Penaeus vannamei.

Description

Technical Field

[0001] This invention belongs to the field of breeding technology for Litopenaeus vannamei, specifically relating to a molecular marker for the heat shock protein 60A gene of Litopenaeus vannamei and its application. Background Technology

[0002] South American white shrimp ( Litopenaeus vannamei The Pacific white shrimp (Litopenaeus vannamei), scientifically known as Litopenaeus vannamei, is one of the world's most important economically important shrimp species due to its large size, rapid growth, and high yield. Because of its high economic value, the artificial cultivation of Pacific white shrimp has been rapidly promoted throughout China, making it the highest-yielding shrimp species in the country. The optimal growth temperature for Pacific white shrimp is 25-35°C, and it has poor tolerance to low temperatures. When the temperature drops below 18°C, Pacific white shrimp will stop feeding, which severely limits the season and region for shrimp farming, affecting its economic benefits. Therefore, the breeding of low-temperature tolerant varieties has become an urgent need for Pacific white shrimp farming industries in both northern and southern my country.

[0003] Heat-shock proteins (HSPs), also known as heat stress proteins, are a family of proteins produced by cells in response to various stress conditions. HSPs were first discovered in fruit flies exposed to severe heat shock. Drosophila melanogaste In the study of heat shock proteins, it was subsequently proven that these are ubiquitous and evolutionarily conserved molecular chaperones present in all organisms. Based on molecular weight and amino acid sequence similarity, heat shock proteins can be broadly classified into five classes: HSP110, HSP90, HSP70, HSP60, and small heat shock proteins (sHsps). Research has shown that the expression of heat shock proteins is closely related to an organism's cold or heat tolerance, therefore, heat shock proteins are highly likely to become biomarkers for studying the cold tolerance of Litopenaeus vannamei.

[0004] With the promotion of artificial cultivation of Litopenaeus vannamei, breeding specific varieties to meet the needs of different regions has become a trend in the development of aquaculture. Traditional breeding methods have relatively low precision and efficiency, especially for traits with low heritability. With the development of molecular marker genotyping methods, particularly single nucleotide polymorphism (SNP) markers, they have shown increasing advantages in shrimp breeding programs. Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by variations in a single nucleotide at the genomic level. Compared with traditional methods, SNPs have advantages such as a large number of samples, wide distribution, strong representativeness, good genetic stability, and ease of high-throughput and highly automated detection and analysis. They are currently widely used in the construction of animal and plant genetic maps, QTL mapping, and functional gene analysis. However, research on applying SNPs to the breeding of cold-resistant varieties of Litopenaeus vannamei is still relatively limited. SUMMARY

[0005] In view of the above, the present application discloses a Penaeus vannamei heat shock protein 60A gene molecular marker, which is screened based on a heat shock protein 60A gene (HSP60) related to the cold tolerance of Penaeus vannamei, and uses the SNP molecular marker as a functional marker for the cold tolerance of Penaeus vannamei, for breeding Penaeus vannamei varieties with cold tolerance.

[0006] The present application is implemented by using the following technical solutions:

[0007] The Penaeus vannamei heat shock protein 60A gene molecular marker comprises a molecular marker A, a molecular marker B, a molecular marker C, a molecular marker D, a molecular marker E, a molecular marker F, a molecular marker G and a molecular marker H.

[0008] The molecular marker A is located at a 4583 bp site of a nucleotide sequence shown in sequence 1 in the sequence list, and is recorded as D.4583 A>G, the base of the site is A or G, and the mutation type is A / A homozygous type and A / G heterozygous type.

[0009] The molecular marker B is located at a 4611 bp site of the nucleotide sequence shown in sequence 1 in the sequence list, and is recorded as D.4611 T>C, the base of the site is C or T, and the mutation type is C / C homozygous type, C / T heterozygous type and T / T homozygous type.

[0010] The molecular marker C is located at a 4623 bp site of the nucleotide sequence shown in sequence 1 in the sequence list, and is recorded as D.4623 T>A, the base of the site is A or T, and the mutation type is A / A homozygous type, A / T heterozygous type and T / T homozygous type.

[0011] The molecular marker D is located at a 4625 bp site of the nucleotide sequence shown in sequence 1 in the sequence list, and is recorded as D.4625 A>T, the base of the site is A or T, and the mutation type is A / A homozygous type, A / T heterozygous type and T / T homozygous type.

[0012] The molecular marker E is located at a 4638 bp site of the nucleotide sequence shown in sequence 1 in the sequence list, and is recorded as D.4638 G>A, the base of the site is A or G, and the mutation type is A / G heterozygous type and G / G homozygous type.

[0013] The molecular marker F is located at a 4641 bp site of the nucleotide sequence shown in sequence 1 in the sequence list, and is recorded as D.4641 A>T, the base of the site is A or T, and the mutation type is A / A homozygous type, A / T heterozygous type and T / T homozygous type.

[0014] The molecular marker G is located at the 4645 bp site of the nucleotide sequence shown in SEQ ID NO. 1 in the sequence listing, recorded as D.4645 C>T, the base of the site is C or T, and the mutation type is C / C homozygote, C / T heterozygote;

[0015] The molecular marker H is located at the 4648 bp site of the nucleotide sequence shown in SEQ ID NO. 1 in the sequence listing, recorded as D.4648 G>T, the base of the site is G or T, and the mutation type is G / G homozygote, G / T heterozygote, T / T homozygote.

[0016] The nucleotide sequence shown in SEQ ID NO. 1 in the sequence listing is the nucleotide sequence of the heat shock protein 60 gene of Penaeus vannamei.

[0017] The application of the above-mentioned molecular marker of the heat shock protein 60A gene of Penaeus vannamei, the molecular marker A, the molecular marker B, the molecular marker C, the molecular marker D, the molecular marker E, the molecular marker F, the molecular marker G and the molecular marker H are used for selective breeding of Penaeus vannamei, specifically, the genomic DNA of the muscle tissue of the Penaeus vannamei to be tested is first extracted, then the genomic DNA is used as template DNA for PCR amplification and purification of the PCR amplification product, and then the product obtained is sequenced to determine the genotypes of the molecular marker A, the molecular marker B, the molecular marker C, the molecular marker D, the molecular marker E, the molecular marker F, the molecular marker G and the molecular marker H.

[0018] When the genotype of the molecular marker A is the dominant genotype AG genotype, the individual is selected as a reserve parent for breeding of the Penaeus vannamei variety; when the genotype of the molecular marker B is the dominant genotype TT genotype, the individual is selected as a reserve parent for breeding of the Penaeus vannamei variety; when the genotype of the molecular marker C is the dominant genotype TT genotype, the individual is selected as a reserve parent for breeding of the Penaeus vannamei variety; when the genotype of the molecular marker D is the inferior genotype AA genotype, the individual is avoided to be selected as a reserve parent for breeding of the Penaeus vannamei variety; when the genotype of the molecular marker E is the dominant genotype AG genotype, the individual is selected as a reserve parent for breeding of the Penaeus vannamei variety; when the genotype of the molecular marker F is the inferior genotype AA genotype, the individual is avoided to be selected as a reserve parent for breeding of the Penaeus vannamei variety; when the genotype of the molecular marker G is the dominant genotype CT genotype, the individual is selected as a reserve parent for breeding of the Penaeus vannamei variety; when the genotype of the molecular marker H is the inferior genotype GG genotype, the individual is avoided to be selected as a reserve parent for breeding of the Penaeus vannamei variety.

[0019] In the above-mentioned PCR amplification and purification of the PCR amplification product, the primer set for detecting the molecular marker related to the cold tolerance trait of the above-mentioned Penaeus vannamei comprises primer F and primer R;

[0020] The sequence of the primer F is GGGATAACCGCAAGAACAC (sequence 2 in the sequence listing);

[0021] The sequence of the primer R is CATCTCCAGACGCTTCCAT (sequence 3 in the sequence listing).

[0022] The PCR amplification system is composed of the following components: 25 μL of 2x Es Taq MasteMix, 1 μL of template DNA with a concentration of 100 ng / μL, 2 μL of primer F with a concentration of 10 μmol / L, 2 μL of primer R with a concentration of 10 μmol / L, and 20 μL of ddH2O.

[0023] The reaction procedure of the PCR amplification comprises the following steps:

[0024] S1, pre-denaturation at 94℃ for 3 min;

[0025] S2, denaturation at 94℃ for 30 s, annealing at 64℃ for 30 s, extension at 72℃ for 45 s, for 35 cycles;

[0026] S3, extension at 72℃ for 10 min.

[0027] Compared with the prior art, the technical solution has the following beneficial effects:

[0028] The present application is based on the analysis and research of heat shock protein 60 (HSP60) genes of Penaeus vannamei, and a SNP molecular marker closely related to the cold tolerance of Penaeus vannamei is obtained. The molecular marker can be applied to the breeding of new cold-tolerant varieties of Penaeus vannamei, and is conducive to promoting the research and application of cold-tolerant and stress-resistant breeding of Penaeus vannamei. Moreover, the use of the method of the present application to breed cold-tolerant Penaeus vannamei has the advantages that the genotypes of the selected individuals are stable and do not undergo genetic differentiation, the efficiency and accuracy of breeding are high, and the present application provides a good foundation for the breeding and improvement research of Penaeus vannamei. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1Figure 1 is a partial sequence of the product amplified from the heat shock protein 60 (HSP60) gene in Example 1, wherein a shows AA, AG peak figures of the 87th-91st positions, i.e. the D.4583 A>G site; b shows CC, CT, TT peak figures of the 115th-119th positions, i.e. the D.4611 T>C site; c shows AA, AT, TT peak figures of the 127th-131st positions, i.e. the D.4623 T>A site; d shows AA, AT, TT peak figures of the 129th-133rd positions, i.e. the D.4625 A>T site; e shows AG, GG peak figures of the 142nd-146th positions, i.e. the D.4638 G>A site; f shows AA, AT, TT peak figures of the 145th-149th positions, i.e. the D.4641 A>T site; g shows CC, CT peak figures of the 149th-153rd positions, i.e. the D.4645 C>T site; h shows GG, GT, TT peak figures of the 152nd-156th positions, i.e. the D.4648 G>T site. DETAILED DESCRIPTION

[0030] The present application is further illustrated by the following examples, which are not intended to be limiting of the present application. The specific experimental conditions and methods not specified in the following examples are generally conventional methods well known to those skilled in the art.

[0031] Example: The screening of the molecular marker related to the cold tolerance trait of Penaeus vannamei according to the present application is carried out as follows:

[0032] (1) 120 Penaeus vannamei with a body weight of about 3 g are selected and subjected to a 2-day acclimation, and then subjected to a cold tolerance experiment at 9.5-10.5°C. The first 40 Penaeus vannamei to die are taken as a low-temperature sensitive group, and the last 40 Penaeus vannamei still alive are taken as a low-temperature tolerant group;

[0033] (2) 5 Penaeus vannamei are randomly selected from the low-temperature sensitive group and the low-temperature tolerant group, respectively, and the muscle tissues are extracted and the genomic DNA is extracted by a conventional phenol chloroform extraction method. The obtained genomic DNA is stored at -20°C for standby use;

[0034] (3) The primers F and R are designed according to the heat shock protein 60 (HSP60) gene sequence of Penaeus vannamei (Gene Accession No. LOC113816031), and then the SNP site located in the heat shock protein 60 (HSP60) gene is amplified and screened;

[0035] The sequence of the primer F is: GGGATAACCGCAAGAACAC;

[0036] The sequence of the primer R is: CATCTCCAGACGCTTCCAT;

[0037] The PCR amplification system is composed of the following components: 25 μL of 2x Es Taq MasteMix, 1 μL of template DNA with a concentration of 100 ng / μL, 2 μL of primer F with a concentration of 10 μmol / L, 2 μL of primer R with a concentration of 10 μmol / L, and 20 μL of ddH2O.

[0038] The reaction procedure of the PCR amplification comprises the following steps:

[0039] S1, pre-denaturation at 94℃ for 3 min;

[0040] S2, denaturation at 94℃ for 30 s, annealing at 62℃ for 30 s, and extension at 72℃ for 45 s, for 35 cycles;

[0041] S3, extension at 72℃ for 10 min;

[0042] (4) After the PCR amplification product is detected by 1% agarose gel electrophoresis, purification and sequencing, the sequencing results are analyzed by using DNAstar software, including nucleotide sequence alignment and peak graph analysis, and relevant SNPs sites are screened out; the sequence of the PCR amplification product of one sample is shown as follows, wherein the 89th site is D.4583 A>G, the 117th site is D.4611 T>C, the 129th site is D.4623 T>A, the 131st site is D.4625 A>T, the 144th site is D.4638 G>A, the 147th site is D.4641 A>T, the 151st site is D.4645 C>T, and the 154th site is D.4648 G>T:

[0043] GGGATAACCGCAAGAACACTCTTCATGACATTGCCATTGCAACTGGTGCTATTGTCTTCAATGATGAAGCAAGCATGGTGAAGATTGAGGATGTTCAGGTAAGAAATGTGTAGGGGTAAATTTTAACATTATTCAGGGTTTTAGACAGGACATGATTTTTTATTGTAAGATAATGTTAAGAAATGTGTTGTATGGAAAAGGTTTATTTATAAAAGGGGGGGAAATGGTCAAGAATAGTAGGGAATGAATTTCCATTAAGGGGTCTGGGTACTTACTTTATATTGTTTACATCTTGATTTCTTTATTTTTAGGTCCATGACCTTGGCCAAGTCGGAGAAGTGCAGATCACAAAGGATGATACACTTCTGCTGAAGGGCAAGGGTAATTCTAGTGATATCCAGCGTCGTGTAGATCAAATCAAGGACCAGATTGCCGATAGTTCCTCCGAGTATGAGAAGGAGAAAATGCAGGAGCGTATGGCTCGCCTGGCCTCGGGTGTGGCAGTGGTGAAGGTTGGAGGTTCTTCGGAGGTTGAGGTGAACGAGAAGAAGGATCGTGTAAATGATGCTTTGTGTGCAACAAGAGCTGCGGTTGAAGAGGGCATAGTTCCAGGTGGAGGAGTTGCCTTGATTCGCTGCCTTCCTGCCTTGGATACTATCACTCCAAGCAATGAAGACCAGAAGGTTGGCATTGAAATTGTCCGCAAGGCTATCCAGACTCCATGCCACACCATTGCCAGCAATGCCGGTGTTAATGCATCAGTTATTGTCAACAAGGTCATGGAAGCGTCTGGAGATG;

[0044] (5) According to the screened SNPs sites, the sensitive group and the resistant group of Penaeus vannamei were detected and genotyped according to the above method, the samples of different SNP sites in the sensitive group and the resistant group were counted, the genotype frequency and the allele frequency were calculated, and the independence test was carried out by chi-square analysis, and the specific results were shown in Table 1.

[0045] According to the analysis of Table 1, the genotype polymorphism of each molecular marker site has a very significant influence on the cold tolerance of Penaeus vannamei: the cold tolerance of AG genotype individuals of molecular marker A is better than that of AA genotype, so AG genotype is the dominant genotype, and site D.4583 A>G is selected as AG individuals; the cold tolerance of TT genotype individuals of molecular marker B is better than that of CC and CT genotypes, so TT genotype is the dominant genotype, and site D.4611 T>C is selected as TT individuals; the cold tolerance of TT genotype individuals of molecular marker C is better than that of AA and AT genotypes, so TT genotype is the dominant genotype, and site D.4623 T>A is selected as TT individuals; the cold tolerance of AT and TT genotype individuals of molecular marker D is better than that of AA genotype, so AA genotype is the inferior genotype, and site D.4583 A>G is avoided to be selected as AA individuals; the cold tolerance of AG genotype individuals of molecular marker E is better than that of GG genotype, so AG genotype is the dominant genotype, and site D.4638 G>A is selected as AG individuals; the cold tolerance of AT and TT genotype individuals of molecular marker F is better than that of AA genotype, so AA genotype is the inferior genotype, and site D.4641 A>T is avoided to be selected as AA individuals; the cold tolerance of CT genotype individuals of molecular marker G is better than that of CC genotype, so CT genotype is the dominant genotype, and site D.4645 C>T is selected as CT individuals; the cold tolerance of GT and TT genotype individuals of molecular marker H is better than that of GG genotype, so GG genotype is the inferior genotype, and site D.4648 G>T is avoided to be selected as GG individuals.

[0046] The present application extracts DNA from the appendage muscle tissue of Penaeus vannamei, which does not have a great impact on the body of the shrimp. Breeding can be carried out by using the method of molecular assisted breeding, such as using the method of gene knockout or gene editing to process the varieties obtained after the molecular markers.

[0047] Table 1: Chi-square analysis results of the sites

[0048]

[0049] In addition, it should be understood that although the present specification is described in terms of embodiments, each embodiment does not necessarily contain only one independent technical solution, and the description of the specification is only for the sake of clarity, and those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can be combined appropriately to form other embodiments that those skilled in the art can understand.

Claims

1. The application of a molecular marker for the heat shock protein 60A gene in Litopenaeus vannamei, characterized in that: The molecular markers for the heat shock protein 60A gene of Litopenaeus vannamei include molecular marker A, molecular marker B, molecular marker C, molecular marker D, molecular marker E, molecular marker F, molecular marker G, and molecular marker H; The molecular marker A is located at the 4583 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.4583A>G. The base at this site is either A or G, and the mutation type is A / A homozygous or A / G heterozygous. The molecular marker B is located at the 4611 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.4611T>C. The base at this site is C or T, and the mutation type is C / C homozygous, C / T heterozygous, or T / T homozygous. The molecular marker C is located at the 4623 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.4623T>A. The base at this site is A or T, and the mutation type is A / A homozygous, A / T heterozygous, or T / T homozygous. The molecular marker D is located at the 4625 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.4625A>T. The base at this site is A or T, and the mutation type is A / A homozygous, A / T heterozygous, or T / T homozygous. The molecular marker E is located at the 4638 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.4638G>A. The base at this site is either A or G, and the mutation type is A / G heterozygous or G / G homozygous. The molecular marker F is located at the 4641 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.4641A>T. The base at this site is A or T, and the mutation type is A / A homozygous, A / T heterozygous, or T / T homozygous. The molecular marker G is located at the 4645 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.4645C>T. The base at this site is C or T, and the mutation type is C / C homozygous or C / T heterozygous. The molecular marker H is located at the 4648 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.4648G>T. The base at this site is G or T, and the mutation type is G / G homozygous, G / T heterozygous, or T / T homozygous. The application involves using molecular markers A, B, C, D, E, F, G, and H for selective breeding of Litopenaeus vannamei with cold-resistant traits. Specifically, genomic DNA is extracted from the muscle tissue of the Litopenaeus vannamei to be tested, and then used as template DNA for PCR amplification and purification of the PCR amplification products. The obtained products are then sequenced to determine the genotypes of molecular markers A, B, C, D, E, F, G, and H. When the genotype of molecular marker A is AG, that individual is selected as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker B is TT, that individual is selected as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker C is TT, that individual is selected as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker D is AA, that individual should not be selected as a backup parent for breeding Litopenaeus vannamei. When the genotype of molecular marker E is AG, select that individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker F is AA, avoid selecting that individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker G is CT, select that individual as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker H is GG, avoid selecting that individual as a backup parent for breeding Litopenaeus vannamei.

2. The application of the molecular marker for the heat shock protein 60A gene of Litopenaeus vannamei according to claim 1, characterized in that: During the PCR amplification and PCR product purification process, the primer set used to detect molecular markers related to the cold resistance trait of the Litopenaeus vannamei includes primer F and primer R. The sequence of primer F is: GGGATAACCGCAAGAACAC; The sequence of primer R is: CATCTCCAGACGCTTCCAT.

3. The application of the molecular marker for the heat shock protein 60A gene of Litopenaeus vannamei according to claim 2, characterized in that: The PCR amplification system consists of the following components: 25 μL of 2×Es Taq MasteMix, 1 μL of template DNA at a concentration of 100 ng / μL, 2 μL of primer F at a concentration of 10 μmol / L, 2 μL of primer R at a concentration of 10 μmol / L, and 20 μL of ddH2O.

4. The application of the molecular marker for the heat shock protein 60A gene of Litopenaeus vannamei according to claim 1, characterized in that: The PCR amplification reaction procedure includes the following steps: S1. Pre-denaturate at 94℃ for 3 min; S2. Perform 35 cycles of denaturation at 94℃ for 30s, annealing at 64℃ for 30s, and extension at 72℃ for 45s. S3. Extend at 72℃ for 10 minutes.

Images