A biomimetic responsive wettability surface and its preparation method and application

Abstract

The present invention discloses a biomimetic responsive wettable surface and a preparation method and application thereof. The biomimetic responsive wettable surface is composed of a hydrogel responsive to heavy metal ions and parallel microchannels with an arched microcavity structure. Under the capillary action and Laplace pressure gradient of the surface, the liquid is spontaneously transported along the direction of the microcavity arch, and the transport distance is negatively correlated with the size of the microcavity. Under the stimulation of heavy metal ions, the present invention folds the aptamer bone chain modified on the hydrogel network, the microcavity size is reduced, resulting in a longer liquid transport distance, and the transport distance is positively correlated with the heavy metal ion concentration. Therefore, based on the liquid transport distance, visual detection of heavy metal ions can be achieved. The detection method of preparing a biomimetic responsive wettable surface for detecting heavy metal ions is suitable for on-site in-situ detection, and does not rely on complex equipment and professional operators, and can achieve visual and low-threshold detection of heavy metal ions.

Description

Technical Field

[0001] The invention belongs to the field of heavy metal ion detection, and in particular relates to a bionic response wettability surface and a preparation method and application thereof. Background Art

[0002] Continuous heavy metal ion pollution seriously affects human health and social development. Due to their toxicity and non-degradability, heavy metal ions accumulate in aquatic organisms and crops, and enter the human body through enrichment in the food chain. Therefore, the detection of heavy metal ions has broad application prospects in environmental monitoring, waste management, developmental biology, clinical toxicology and other fields. The detection methods of heavy metal ions include inductively coupled plasma mass spectrometry, atomic absorption / emission spectrometry, high performance liquid chromatography and atomic fluorescence spectrometry. Although these detection methods have high accuracy, they have problems such as complex sample pretreatment, reliance on expensive equipment, professional operation requirements, and unsuitability for on-site detection. Therefore, the development of a simple-to-operate heavy metal ion detection method is of great significance for lowering the detection threshold and improving the universality of detection.

[0003] Wettability is the interaction between the surface structure of a substance and liquid. As one of the common properties in nature, it has aroused great interest in the fields of oil-water separation, agricultural irrigation, microfluidic operation and biomedical detection. Inspired by the surface structure of plants and animals in nature, functional surfaces with special wettability can be prepared. At present, there are few reports on the detection and application of functional surfaces with special wettability in the field of heavy metal ions. Summary of the invention

[0004] Purpose of the invention: In view of the problems existing in the prior art, the present invention provides a biomimetic responsive wettable surface that can be used for heavy metal ion detection. The biomimetic responsive wettable surface of the present invention has a simple preparation process and a low operating threshold, and solves the problems that the existing heavy metal ion detection equipment is expensive, requires high professionalism in operation, and is not suitable for on-site detection. In addition, the present invention also applies the biomimetic responsive wettable surface to heavy metal ion detection.

[0005] The invention also provides a preparation method and application of the bionic responsive wettability surface.

[0006] Technical solution: In order to achieve the above-mentioned purpose, the present invention discloses a bionic responsive wettable surface, which is composed of a heavy metal ion responsive hydrogel and parallel microchannels with overlapping arched microcavity structures; the responsive hydrogel is obtained by mixing a polymer material with a cross-linking agent and a photoinitiator and modifying an aptamer; the parallel microchannels replicate the arched microcavity structure of the surface around the mouth of a pitcher plant.

[0007] Among them, the responsive hydrogel is obtained by mixing a polymer material and a cross-linking agent and modified by an aptamer, and the hydrogel can shrink under the stimulation of heavy metal ions; the microchannel is obtained by replicating the arched microcavity structure on the surface around the mouth of the pitcher plant, which can realize the directional transport of liquid.

[0008] Among them, the polymer material is selected from any one or more materials containing amide or carboxyl groups such as acrylamide, polyethylene glycol diacrylate or sodium acrylate; the cross-linking agent is selected from one or more of N,N-methylenebisacrylamide, acrylic acid, hydroxypropyl acrylate or methacrylic acid; the aptamer is selected from one of the heavy metal ion nucleic acid aptamers containing four ATCG bases and amino groups.

[0009] Preferably, the aptamer is a lead ion nucleic acid aptamer, a cadmium ion nucleic acid aptamer or a mercury ion nucleic acid aptamer.

[0010] The method for preparing the biomimetic responsive wettability surface of the present invention is characterized by comprising the following steps:

[0011] (1) Preparation of a biomimetic responsive wettability surface mold: constructing a parallel microchannel surface model with a surface structure mimicking the perioral surface of a pitcher plant by 3D modeling, and obtaining a resin material mold of the parallel microchannel surface model by 3D printing technology; mixing a silicone polymer with a curing agent to form a glue solution, pouring the glue solution into a resin mold, heating and curing it, and then demolding to obtain a negative mold of a biomimetic responsive wettability surface;

[0012] (2) Preparation of biomimetic responsive wettable surface: A polymer material, a cross-linking agent and a photoinitiator are mixed to form a polymer solution, which is poured into a negative mold and cured by ultraviolet light. After demolding, the polymer solution is combined with an aptamer to obtain a biomimetic responsive wettable surface.

[0013] The dimensions of the parallel microchannels in the 3D modeling in step (1) are such that the ratio of the microcavity length to the microcavity width is 3-2:1-1.5.

[0014] Preferably, the dimensions of the parallel microchannels in the 3D modeling in step (1) are such that the ratio of microcavity length to microcavity width is 2:1.

[0015] In step (1), the silicone polymer and the curing agent are mixed in a ratio of 10:1, and the gel solution is poured into the template of the resin material at a temperature of 65-85° C. and placed in an oven overnight.

[0016] Wherein, the concentration of the polymer material described in step (2) is 1wt%-30wt%; the concentration of the crosslinking agent is 0.3wt%-5wt%; the concentration of the photoinitiator is 1-2vol%; and the concentration of the aptamer is 0-300mM.

[0017] Wherein, in step (2), the polymer material and the aptamer are combined by EDC / NHS coupling reaction or by directly mixing the aptamer modified with 3',5'-amide group with the polymer material.

[0018] Preferably, the polymer material can be modified with the aptamer by an EDC / NHS coupling reaction, i.e., the polymer material is hydrolyzed in 10 ml of a hydrolysis solution containing 0.1 M NaOH and 10% TEMED for 1 hour, and then activated in 10 ml of an activation solution containing 350 mg EDC and 550 mg NHS for 30 minutes after washing; the polymer material and the aptamer can also be combined by directly mixing the aptamer modified with a 3',5'-amide group with the polymer material.

[0019] Furthermore, the length of the arched microcavity structure is 5 mm and the width is 2.5 mm; the channel shape is a parallel channel; the polymer material is 20% acrylamide and 5% polyethylene glycol diacrylate; the cross-linking agent is N,N-methylenebisacrylamide, wherein the mass ratio of acrylamide:N,N-methylenebisacrylamide is 14:1; the aptamer is 100 mM mercury ion aptamer; and the method for modifying the aptamer with a polymer material is an EDC / NHS coupling reaction.

[0020] Preferably, the aptamer is 5'-NH2-(CH2)6-TTCTTTCTTCCCCTTGTTTGTT-(CH2)6-NH2-3'.

[0021] Application of the biomimetic responsive wettability surface described in the present invention in visual detection of heavy metal ions.

[0022] Among them, the application is: placing the bionic responsive wettable surface into a solution containing heavy metal ions, the heavy metal ions are connected to the aptamer to reduce the volume of the bionic responsive wettable surface and shrink the channel size. The bionic wettable surface is treated with heavy metal ions of different concentrations to different degrees of shrinkage. When liquid is dripped on the channel, the directional transport distance of the liquid is also different, and the visual detection of heavy metal ions is achieved by the length of the liquid transport distance.

[0023] Furthermore, the detection process is as follows: two biomimetic responsive wettable surfaces are placed in a 10mM Tris-HNO3 solution with a pH of 7.0 and a Tris-HNO3 solution with heavy metal ions added, respectively, and reacted at 25°C for 10 minutes, and the channel size of the biomimetic responsive wettable surface changes. When droplets are added to the channel, the droplets will spontaneously be transported along the channel in a directional manner. The higher the concentration of heavy metal ions, the smaller the channel size and the longer the distance of directional liquid transport.

[0024] Among them, the concentration of heavy metal ions is 0-5×10 5 nM.

[0025] The present invention combines the biomimetic responsive wettability surface with heavy metal ion detection, introduces materials such as hydrogels and aptamers, and detects heavy metal ions through heavy metal ion stimulation with an obvious liquid directional transport distance. The biomimetic responsive wettability surface prepared by the present invention has a low operating threshold, which solves the problems of the existing detection method, such as expensive equipment, high operational expertise, and unsuitability for on-site detection.

[0026] In the present invention, by imitating the arched microcavity structure on the surface around the mouth of the pitcher plant, the directional transport of liquid can be achieved, and the directional transport distance of the liquid is related to the size of the microcavity structure. Figure 1 As shown, the present invention uses hydrogel to prepare a biomimetic wettable surface with an arched microcavity structure, and modifies the aptamer on the hydrogel after hydrolysis and activation to obtain a biomimetic responsive wettable surface. Under the stimulation of heavy metal ions, the volume of the hydrogel modified with the aptamer shrinks, which is manifested as a reduction in the size of the biomimetic responsive wettable surface channel, and the transport distance of the liquid in the channel changes accordingly, thereby realizing the visual detection of heavy metal ions.

[0027] The present invention prepares a bionic wettable surface by structurally imitating the structure of the perioral surface of Nepenthes, which can realize directional liquid transport, and adds an aptamer at the same time. The aptamer can specifically bind to heavy metal ions, and can realize the heavy metal ion detection function. The present invention hydrolyzes and activates the bionic wettable surface, and connects it with the aptamer to obtain a bionic responsive wettable surface. When the surface binds to heavy metal ions, the channels on the surface shrink, and the directional liquid transport distance becomes longer, thereby realizing the visual detection of heavy metal ions, and does not require the use of large equipment or analytical instruments, has a low operating threshold, high universality, and can be detected on site.

[0028] The biomimetic responsive wettability surface constructed by the present invention can realize visualized heavy metal ion detection; the arched microcavity structure can realize directional liquid transport; and the directional liquid transport is combined with the aptamer to detect heavy metal ions.

[0029] The present invention uses a specific arched microcavity structure and an aptamer structure. The arched microcavity structure can realize directional liquid transport, and the aptamer can specifically bind to heavy metal ions. When heavy metal ions contact the biomimetic response wettability surface, the surface will shrink and the channel size on the surface will decrease. After the channel size becomes smaller, the liquid transport distance will increase. Therefore, the visual detection of heavy metal ions is realized by the length of the directional liquid transport distance of the biomimetic response wettability surface.

[0030] Beneficial effects: Compared with the prior art, the present invention has the following beneficial effects:

[0031] (1) Compared with the traditional heavy metal ion detection method, the biomimetic responsive wettability surface structure prepared by the present invention is simple and easy to obtain. Based on the different directional transport distances of liquid on surfaces of different sizes, the visual detection of heavy metal ions can be achieved.

[0032] (2) The biomimetic responsive wettable surface prepared by the present invention has a simple manufacturing process, and combined with the aptamer that specifically responds to heavy metal ions, the surface structure size changes significantly under the stimulation of heavy metal ions. The present invention is the first to apply the surface's liquid directional transport capability to the field of heavy metal ion detection.

[0033] (3) The biomimetic responsive wettability surface prepared by the method of the present invention has a low detection threshold and does not require complex instruments and equipment, thereby enabling rapid and convenient detection of heavy metal ions. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Schematic diagram of the biomimetic responsive wettable surface for visual heavy metal ion detection in the present invention, wherein (a) the biomimetic wettable surface simulates the structure of a pitcher plant, (b) the biomimetic wettable surface realizes directional liquid transport, and (c) the biomimetic responsive wettable surface realizes visual detection of heavy metal ions;

[0035] Figure 2 The figure is a flow chart for preparing bionic wettable surfaces; (a) the structural diagram of the surface around the mouth of Nepenthes, and (b) the preparation process of the bionic wettable surface.

[0036] Figure 3 The modeling process of the bionic wettable surface, including (a) reference plane 1 and reference axis, (b) cutting surface of arched microcavity 1, (c) reference plane 2, (d) three-dimensional model of arched microcavity, and (e) bionic wettable surface model of the perioral surface of Nepenthes;

[0037] Figure 4 The liquid transport on the perioral surface of Nepenthes (a) and the bionic surface (b);

[0038] Figure 5 Optimization diagram of biomimetic responsive hydrogel surface, including (a) the relationship between AAm concentration and hydrogel volume shrinkage, (b) the relationship between AAm and BIS ratio and hydrogel volume shrinkage,

[0039] Figure 6 Optimization diagram of biomimetic responsive hydrogel surface, including: (a) relationship between PEGDA concentration and hydrogel volume contraction, (b) relationship between aptamer concentration and responsive hydrogel volume contraction;

[0040] Figure 7The response performance test of the hydrogel, where (a) the relationship between the volume shrinkage of the hydrogel and time, (b) Hg 2+ Plot of the relationship between concentration and volume shrinkage of hydrogel;

[0041] Figure 8 To add aptamer to the hydrogel and Hg 2+ Schematic diagram of the response;

[0042] Fig. 9 The response performance diagram of the biomimetic responsive wettability surface, including (a) the macroscopic shrinkage change of the biomimetic surface after heavy metal ion treatment, (b) the relationship between the semi-major axis length shrinkage on the biomimetic surface and the concentration of heavy metal ions, (c) the relationship between the width shrinkage on the biomimetic surface and the concentration of heavy metal ions;

[0043] Fig.10 Visual detection of heavy metal ions on biomimetic responsive wettable surfaces. DETAILED DESCRIPTION

[0044] The present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0045] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0046] PDMS and curing agent were purchased from Dow Corning, specification 1.1KG, item number 9006-65-9; acrylamide AAm was purchased from Aladdin Biochemical Technology Co., Ltd. (Shanghai), item number A108465-100g; polyethylene glycol diacrylate PEGDA was purchased from Aladdin Biochemical Technology Co., Ltd. (Shanghai), average molecular weight ~600, item number P131592-100ml; N,N-methylenebisacrylamide BIS was purchased from Shanghai McLean Biochemical Technology Co., Ltd., specification 100ml; photoinitiator HMPP was purchased from Sigma-Aldrich, USA, item number 405655-50ML; water-based dye was purchased from Nanjing Haozhuo Materials Technology Co., Ltd., specification 20mL, item number 202 001; Tetramethylethylenediamine TEMED was purchased from Wuhan Boster Biotechnology Co., Ltd., with the item number AR1165; 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide EDC was purchased from Shanghai MacLean Biochemical Technology Co., Ltd., with the specification of 25 g and the item number N807578-25g; N-hydroxysuccinimide NHS was purchased from Shanghai MacLean Biochemical Technology Co., Ltd., with the specification of 25 g and the item number N811124-25g; Tris was purchased from Shanghai Titan Technology Co., Ltd., with the specification of 100 g; aptamer 5'-NH2–(CH2)6–TTCTTTCTTCCCCTTGTTTGTT–(CH2)6–NH2-3' was purchased from General Biosystems (Anhui) Co., Ltd.

[0047] Example 1

[0048] Verification of the directional liquid transport capability of biomimetic wettable surfaces

[0049] Randomly collect Nepenthes in nature. The smallest component unit of the surface around the mouth of Nepenthes is the microcavity. The microcavities are arranged one by one in an overlapping manner to form a channel. Countless channels are arranged in parallel to form the structure of the Nepenthes. Observing the surface structure of the mouth of natural Nepenthes under an electron microscope and a scanning electron microscope, it can be found that its surface is composed of parallel microchannels. The microcavities that are 100μm long and 50μm wide and arranged in an overlapping manner at an angle form a hanging structure at the connection of the microcavities. The microcavities overlap and are arranged in parallel to form a channel. The entire surface structure of the mouth of Nepenthes is as follows: Figure 2 As shown in a, its hanging structure is Figure 2 It can be observed in a i-iv that the arched microcavity is composed of individual cavities, which are higher on the left and lower on the right. After being connected one by one, the low part of the previous microcavity is connected to the high part of the next cavity, forming a suspended structure with a height difference.

[0050] Solidworks drawing software was used to draw a three-dimensional model of the surface structure around the mouth of the pitcher plant. The model structure diagram is as follows Figure 2First, construct a 5×3×2.4mm cuboid, with the width at the upper left (or upper right) as the reference axis, and use this axis to the lower right (or lower left) as the reference plane 1, as shown in Figure 3 Take 2.5mm in the center of the reference axis and cut out an arched microcavity 1 on the reference plane 1 with this edge. The lowest point of the arched microcavity 1 is 0.65mm away from the bottom of the cuboid. Figure 3 b. Take a reference plane 2 parallel to the bottom of the cuboid at a distance of 0.75 mm from the bottom of the cuboid, as shown in Figure 3 As shown in c, 0.76 mm is taken from the center of the left side of the reference plane, and an arched microcavity 2 is cut upward from this edge to obtain an arched microcavity structure, such as Figure 3 As shown in FIG. d, the semi-major axis length of the arched microcavity is 5 mm and the width is 2.5 mm. After arranging the arched microcavity structure, a three-dimensional model of the surface structure around the mouth of the pitcher plant is obtained, as shown in FIG. Figure 3 e. The drawn three-dimensional model was imported into the 3D printer through the USB interface to print a three-dimensional template that simulates the surface structure of the pitcher plant; PDMS and curing agent were mixed in a mass ratio of 10:1, placed in a vacuum drying oven to remove bubbles, and a bubble-free gel PDMS was obtained. The 3D printed biomimetic surface model was placed in a container, PDMS was injected to completely cover it, and then placed in a 65°C oven overnight, and then taken out and peeled off to obtain a PDMS negative mold with the reverse characteristics of the pitcher plant surface; acrylamide and N,N-methylenebisacrylamide (mass ratio 29:1) with a final concentration of 10wt%, 1vol% polyethylene glycol diacrylate, 1vol% photoinitiator HMPP (1173) and deionized water were mixed by a centrifuge and an ultrasonic machine to form a polymer solution, and the prepared polymer solution was poured into the prepared PDMS negative mold, and then UVLED (wavelength 365nm, light intensity 6500mw / cm 2 ) After curing for 10 minutes, the bionic wettable surface and the PDMS negative mold are peeled off, and the preparation of the bionic wettable surface is completed. Figure 2 As shown, the parallel microchannels of the biomimetic wettable surface are composed of overlapping arched microcavities, in which the ratio of the semi-major axis length to the width is the same as that of the arched microcavities on the surface around the mouth of the pitcher plant. During the preparation process, pay attention to the curing time when removing the hydrogel from the PDMS negative mold, otherwise it is easy to be damaged. If it is still difficult to remove, the whole can be placed in ultrapure water and left to stand for a while before taking it out.

[0051] Build a monitoring platform consisting of PC, CCD, LED light source and light box, and a fluid control system consisting of micro-injection pump, PE tube, chip holder and capillary. Connect CCD to PC, fix the injection capillary above the channel of bionic surface with chip holder, use micro-injection pump, PE tube and capillary to contact 4μL and 10μL droplets (water-based dye) with the surface around the mouth of Nepenthes and the channel of bionic surface respectively, and the droplets are transported along the channel in a direction. Figure 4 As shown, when liquid is dripped into the channel on the surface around the mouth of the pitcher plant, the liquid fills the microcavity under the capillary action of the microcavity structure, and the Laplace pressure gradient generated by the hanging structure causes the liquid to flow to the next microcavity without backflow, thereby realizing directional transport of the liquid; then the liquid is brought into contact with the bionic wettable surface, the liquid first diffuses along the axis of the microcavity, and then, under the action of capillary action and Laplace pressure gradient, the liquid is transported along the dome direction of the microcavity without backflow, which is the same as the liquid transport on the surface around the mouth of the pitcher plant.

[0052] The above results confirm that the bionic wettable surface with an arched microcavity structure designed by imitating the surface structure around the mouth of the pitcher plant has the ability of directional liquid transport and can play a great application potential in the visualization of detection.

[0053] Example 2

[0054] Study on the properties of raw materials for preparing biomimetic responsive wettability surfaces

[0055] Acrylamide AAm, N,N-methylenebisacrylamide BIS, polyethylene glycol diacrylate PEGDA, photoinitiator HMPP and deionized water were added to a centrifuge tube and stirred thoroughly to prepare a polymer solution. The AAm concentration in the polymer solution was 20wt%, the mass ratio of AAm to BIS was 14:1, the concentration of PEGDA was 5vol%, and the concentration of HMPP (1173) was 1vol%.

[0056] During the preparation process, hydrogels with different mechanical properties and response properties were obtained by adjusting the concentration of hydrogel materials or crosslinkers and aptamers. The specific verification process is as follows: 10 μL of polymer solution was taken with a pipette and dropped on the hydrophobic tape. UVLED (wavelength 365 nm, light intensity 6500 mw / cm 2 ) UV-cured for 30 seconds to form a hydrogel ball. Placed in 10 ml of a hydrolysis solution containing 0.1 M NaOH and 10 vol% TEMED and hydrolyzed for 1 hour. After being cleaned with water, placed in 10 ml of an activation solution containing 350 mg EDC and 550 mg NHS and activated for 30 minutes. After being rinsed with water, placed in a 100 mM aptamer solution, reacted at room temperature for 30 minutes, and then placed in a 4°C refrigerator overnight.

[0057] like Figure 5 As shown in (a), the hydrogels with different shrinkage degrees obtained by adjusting the AAm concentration in this embodiment are as follows: the AAm concentration is controlled to be 10-30wt%, the gradient is 5wt%, the mass ratio of AAm and BIS is 14:1, the PEGDA concentration is 5vol%, the aptamer concentration is 100mM, the HMPP concentration is 1vol%, and other factors remain unchanged. Two groups of responsive hydrogel blocks are prepared under each gradient, and 10mM Tris-HNO3 solution with a pH of 7.0 and 50μM Hg are added respectively. 2+ The samples were reacted in a Tris-HNO3 (10 mM, pH 7.0) solution at room temperature for 10 min. The volume changes of the two groups of responsive hydrogels were observed, measured and recorded under a microscope. It can be observed that with the increase of AAm concentration, the degree of hydrogel shrinkage decreases. Finally, 20 wt% AAm was selected. At this time, the mechanical properties of the hydrogel were good. When the concentration was high, the shrinkage of the hydrogel was not obvious and the hydrogel was harder. When the concentration was low, the performance of the model was poor and the hydrogel was easy to disperse and break. Figure 5 (b) In this embodiment, the AAm:BIS ratio was adjusted to obtain hydrogels with different contraction degrees. The AAm:BIS ratio was controlled to be 5:1, 6:1, 9:1, 14:1, and 29:1, the AAm concentration was 20 wt %, the PEGDA concentration was 5 vol %, the aptamer concentration was 100 mM, the HMPP concentration was 1 vol %, and other factors remained unchanged. Two groups of responsive hydrogel blocks were prepared under each gradient, and 10 mM Tris-HNO3 solution with a pH of 7.0 and 50 μM Hg were added, respectively. 2+ The samples were reacted in Tris-HNO3 solution at room temperature for 10 min. The volume changes of the two groups of responsive hydrogels were observed, measured and recorded under a microscope. It can be observed that with the increase of the AAm:BIS ratio, the degree of hydrogel shrinkage increases. Finally, AAm and BIS of 14:1 were selected, and the mechanical properties of the hydrogel were good. Figure 6 (a) shows the shrinkage of hydrogels with a PEGDA concentration of 1-20 vol% in this example, with a gradient of 5 vol%. Other factors remain unchanged. Two groups of responsive hydrogel blocks were prepared under each gradient, and 10 mM Tris-HNO3 solution with a pH of 7.0 and 50 μM Hg 2+ The reaction was carried out in a Tris-HNO3 solution at room temperature for 10 minutes. The volume changes of the two groups of responsive hydrogels were observed, measured and recorded under a microscope. It can be observed that with the increase of PEGDA concentration, the degree of hydrogel shrinkage decreased. Finally, 5 vol% PEGDA was selected, and the mechanical properties of the hydrogel were good. Figure 6(b) In this embodiment, the aptamer concentration was controlled to be 0 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 70 mM, 100 mM, 150 mM, 200 mM, 250 mM, and 300 mM, while other factors remained unchanged. Two groups of responsive hydrogel blocks were prepared at each gradient, and 10 mM Tris-HNO3 solution with a pH of 7.0 and 50 μM Hg were added, respectively. 2+ The reaction was carried out in a Tris-HNO3 solution at room temperature for 10 minutes. The volume changes of the two groups of responsive hydrogels were observed, measured and recorded under a microscope. It can be observed that with the increase of aptamer concentration, the shrinkage of the hydrogel increases. When the aptamer concentration reaches 100mM, the volume of the hydrogel shrinks to 60% of the original. When the aptamer concentration exceeds 100mM, the volume of the hydrogel no longer shrinks, and the reaction reaches saturation. Therefore, considering the mechanical properties and responsiveness of the hydrogel, as well as the simplicity of operation and the factors of saving raw materials, 20wt% AAm, 14:1 AAm:BIS, 5vol% PEGDA, 1vol% HMPP and 100mM aptamer were selected as the material ratio for preparing responsive hydrogels.

[0058] Since the mechanical properties and responsiveness of responsive hydrogels are affected by the concentration of raw materials, the responsive hydrogels can be simply and quickly prepared by regulating the concentration of gelling raw materials, cross-linking agents and aptamers during the hydrogel preparation process.

[0059] Example 3

[0060] Responsive hydrogel to Hg 2+ Responsiveness inquiry:

[0061] According to the method of Examples 1 and 2, a polymer solution of 20 wt% AAm, 14:1 AAm:BIS, 5 vol% PEGDA and 1 vol% HMPP was prepared, and a responsive hydrogel was prepared using a pipette gun and hydrophobic tape. The responsive hydrogel was then exposed to UV LED (wavelength 365 nm, light intensity 6500 mw / cm 2 ) UV-cured for 30 seconds to form a hydrogel ball, which was placed in a hydrolysis solution containing 0.1M NaOH and 10vol% TEMED for hydrolysis for 1 hour. After washing with clean water, it was placed in an activation solution containing 3.5% EDC and 5.5% NHS for activation for 30 minutes. After rinsing with clean water, it was placed in a 100mM aptamer (5'-NH2-(CH2)6-TTCTTTCTTCCCCTTGTTTGTT-(CH2)6-NH2-3') solution, reacted at room temperature for 30 minutes, and then placed in a 4°C refrigerator overnight. The responsive hydrogel was placed in a 10mM Tris-HNO3 solution with a pH of 7.0 and a 50μM Hg 2+The Tris-HNO3 solution (10 mM, pH 7.0) was reacted for 0 to 15 min, and the volume shrinkage rate of the responsive hydrogel was recorded at a gradient rate per minute to determine the complete shrinkage time of the responsive hydrogel. Figure 7 As shown in (a), the experimental results show that within a certain range, the shrinkage degree of the responsive hydrogel volume increases with time, and the volume no longer changes significantly after more than 10 minutes.

[0062] Responsive hydrogels were prepared according to the above method and placed in 8 different Hg 2+ The concentration of Tris-HNO3 solution, where the Tris-HNO3 solution is 10mM, pH 7.0, Hg 2+ The concentrations were 0 nM and 5 × 10 -1 nM、5×10 0 nM、5×10 1 nM、5×10 2 nM、5×10 3 nM、5×10 4 nM、5×10 5 nM. After 10 min of reaction, the volume change of the responsive hydrogel was recorded. Figure 7 As shown in (b), it can be seen from the experimental results that as Hg 2+ As the concentration increases, the volume shrinkage of the responsive hydrogel also increases. This example shows that the concentration of mercury ions can be judged by the shrinkage of the hydrogel, and the higher the mercury ion concentration, the greater the shrinkage and the more obvious the shrinkage.

[0063] Example 4

[0064] Bionic responsive wettability preparation and responsiveness research

[0065] According to the methods of Examples 1 and 2, a three-dimensional model of the perioral surface of Nepenthes was constructed, and a resin template with an arched microcavity structure was obtained by 3D printing technology; PDMS and a curing agent were mixed at a mass ratio of 10:1, placed in a vacuum drying oven to remove bubbles, and a bubble-free gel PDMS was obtained; the 3D printed resin template was placed in a suitable container, PDMS was injected to completely cover it, and then placed in an oven at 65°C overnight, and then taken out and peeled off to obtain a PDMS negative mold with the reverse characteristics of the Nepenthes surface; 20wt% AAm, 14:1 AAm:BIS, 5vol% PEGDA and 1vol% HMPP polymer solution were prepared, and the prepared polymer solution was poured into the prepared PDMS negative mold, and then UVLED was used for curing for 10 minutes, and the Nepenthes perioral hydrogel surface and the PDMS negative mold were peeled off to obtain a biomimetic wettable surface. The surface was placed in a hydrolyzate formed by mixing 0.1M NaOH and 10vol% TEMED for 1h. After cleaning with water, place it in an activation solution containing 3.5% EDC and 5.5% NHS for activation for 30 minutes. After rinsing with water, place it in a 100mM mercury ion aptamer (5'-NH2-(CH2)6-TTCTTTCTTCCCCTTGTTTGTT-(CH2)6-NH2-3') solution, react at room temperature for 30 minutes, and then place it in a refrigerator at 4°C overnight to connect the amino groups at both ends of the aptamer chain with the carboxyl groups on the hydrogel to obtain a biomimetic responsive wettability surface.

[0066] Eight identical biomimetic responsive wettability surfaces were prepared and placed in water containing eight different Hg 2+ The reaction was carried out in a Tris-HNO3 solution of 10 mM, pH 7.0, Hg 2+ The concentrations were 0 nM and 5 × 10 -1 nM、5×10 0 nM、5×10 1 nM、5×10 2 nM、5×10 3 nM、5×10 4 nM、5×10 5 Since the backbone of the aptamer is fixed to the backbone of the hydrogel by chemical bonds, when it binds to mercury ions, the backbone of the aptamer folds to form T-Hg 2+ -T, the front and back conformation changes lead to the volume shrinkage of the hydrogel, such as Figure 8 Observe and measure the size changes of surface microcavities, such as Fig. 9 As shown, it can be observed that Hg 2+ After treatment, the microcavity size of the biomimetic responsive wettability surface changed significantly, and with the increase of Hg 2 +As the concentration increases, the semi-major axis length and width of the microcavity decrease accordingly. This further shows that the higher the mercury ion concentration, the more obvious the biomimetic response wettability surface shrinkage, and the smaller the length and width of the microcavity. Since the microcavity size and the liquid directional transport distance are negatively correlated, it can be concluded that the higher the mercury ion concentration, the longer the liquid directional transport distance, and the visual detection of heavy metal ions can be achieved.

[0067] Example 5

[0068] Biomimetic response of wettable surfaces to Hg 2+ Visual detection performance test

[0069] Based on the preparation method of the biomimetic responsive wettability surface in Example 4, 6 groups of the same biomimetic responsive wettability surfaces were obtained, and the 6 groups of surfaces were immersed in 6 different Hg 2+ The concentration of Tris-HNO3 solution was 10mM, pH 7.0, Hg 2+ The concentrations were 5×10 -1 nM、5×10 0 nM、5×10 1 nM、5×10 2 nM、5×10 3 nM、5×10 4 After the reaction, dyed water was added to the biomimetic responsive wettability surface, the liquid transport was observed, and the liquid transport distance was recorded.

[0070] From the experimental results, it can be seen that Fig.10 As shown, when the dyed liquid contacts the channels of the biomimetic responsive wettability surface, spontaneous and directional transport occurs. 2+ As the concentration increases, the surface channel size decreases and the liquid transport distance increases, thus achieving Hg 2+ Visual detection.

Claims

1. A biomimetic responsive wettability surface, characterized in that: The biomimetic responsive wettable surface is composed of a heavy metal ion responsive hydrogel and parallel microchannels with overlapping arched microcavity structures; the heavy metal ion responsive hydrogel is obtained by mixing a polymer material with one or more of N,N-methylenebisacrylamide, acrylic acid, hydroxypropyl acrylate or methacrylic acid, and an initiator and modifying an aptamer; the parallel microchannels replicate the arched microcavity structure of the surface around the mouth of the pitcher plant; the polymer material is selected from any one or more of acrylamide, polyethylene glycol diacrylate or sodium acrylate.

2. The biomimetic responsive wettability surface according to claim 1, characterized in that: The aptamer is selected from one of the heavy metal ion nucleic acid aptamers containing four ATCG bases and an amino group.

3. The biomimetic responsive wettability surface according to claim 1, characterized in that: The aptamer is selected from lead ion nucleic acid aptamer, cadmium ion nucleic acid aptamer or mercury ion nucleic acid aptamer.

4. A method for preparing a biomimetic responsive wettability surface according to claim 1, characterized in that: The steps include: (1) Preparation of biomimetic responsive wettability surface mold: construct a parallel microchannel surface model with a surface structure mimicking the perioral surface of Nepenthes using 3D modeling, and obtain a resin material mold of the parallel microchannel surface model using 3D printing technology; mix and stir a silicone polymer and a curing agent to form a glue solution, pour the glue solution into a resin mold, heat and cure it, and then demold to obtain a negative mold of the biomimetic responsive wettability surface; (2) Preparation of biomimetic responsive wettable surface: A polymer solution is prepared by mixing a polymer material, a cross-linking agent and a photoinitiator. The polymer solution is poured into a negative mold and cured by ultraviolet light. After demolding, the biomimetic responsive wettable surface is obtained by combining with the aptamer.

5. The method for preparing a biomimetic responsive wettability surface according to claim 4, characterized in that: The dimensions of the parallel microchannels in the 3D modeling in step (1) are such that the ratio of the microcavity length to the microcavity width is 3-2:1-1.

5.

6. The method for preparing a biomimetic responsive wettability surface according to claim 4, characterized in that: After the silicone polymer and the curing agent are mixed in step (1), the gel solution is poured into the template of the resin material at a temperature of 65-85°C.

7. The method for preparing a biomimetic responsive wettability surface according to claim 4, characterized in that: The concentration of the polymer material described in step (2) is 1 wt%-30 wt%; the concentration of the cross-linking agent is 0.3 wt%-5 wt%; the concentration of the photoinitiator is 1-2 vol%; and the concentration of the aptamer is 5-300 mM.

8. The method for preparing a biomimetic responsive wettability surface according to claim 4, characterized in that: In step (2), the polymer material and the aptamer are combined by EDC / NHS coupling reaction or by directly mixing the aptamer modified with 3', 5'-amide groups with the polymer material.

9. Use of the biomimetic responsive wettability surface according to claim 1 in visual detection of heavy metal ions.

10. The use according to claim 9, characterized in that: The application is as follows: placing a biomimetic responsive wettable surface into a solution containing heavy metal ions, connecting the heavy metal ions with the aptamer to reduce the volume of the biomimetic responsive wettable surface and shrink the channel size. The biomimetic wettable surface is treated with heavy metal ions of different concentrations to different degrees of shrinkage. When liquid is dripped on the channel, the directional transport distance of the liquid is also different, and the visual detection of heavy metal ions is achieved by the length of the liquid transport distance.

Images