Method for preparing yjgb family proteins and use thereof as tamer immune agonist vaccine adjuvants

By isolating, purifying, and recombinantly expressing YjgB family proteins from Bacillus megaterium, the problem of aluminum adjuvants failing to effectively elicit Th1 immune responses was solved, thereby enhancing the immunogenicity and protective efficacy of vaccines.

CN118373889BActive Publication Date: 2025-11-28JILIN UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410474663.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-04-19
Publication Date
2025-11-28
Estimated Expiration
2044-04-19

AI Technical Summary

Technical Problem

Existing aluminum adjuvants cannot effectively elicit Th1 immune responses in the vaccine field, and their enhanced immune effects on some vaccines, such as influenza vaccines and genetically engineered antigens, are not ideal, thus limiting their application.

Method used

YjgB family proteins were isolated and purified from secondary metabolites of Bacillus megaterium, and prepared by recombinant expression and purification for use as vaccine adjuvants to induce innate and adaptive immune memory.

Benefits of technology

YjgB family proteins can significantly enhance humoral immune responses, promote macrophage phagocytosis and killing, and release NO and TNF-α, thereby enhancing protection against infection. They also have no hemolytic activity or cytotoxicity and exhibit good temperature and acid-base stability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004800103570000011
    Figure HDA0004800103570000011
  • Figure HDA0004800103570000021
    Figure HDA0004800103570000021
  • Figure HDA0004800103570000022
    Figure HDA0004800103570000022
Patent Text Reader

Abstract

The application provides a preparation method of YjgB family protein and application of the YjgB family protein as a domestication immune agonist vaccine adjuvant; the YjgB family protein is isolated from Bacillus megaterium and has domestication immune activity, and shows a strong natural immune memory induction effect; the protein is relatively stable in nature, is not easily affected by temperature and pH, has a low red blood cell hemolysis rate and no cytotoxicity, and lays a theoretical foundation for practical application; OVA combined with the protein can improve the immune response of the body, has the potential to become a new adjuvant, and lays a solid foundation for future development of a new adjuvant and a double memory vaccine with innate immune memory and adaptive immunity.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application discloses a YjgB family protein from Bacillus megaterium for inducing natural immune memory and a preparation method of the YjgB family protein, and also provides use of the YjgB family protein as a vaccine adjuvant, and belongs to the technical field of biological medicines BACKGROUND

[0002] Aluminum adjuvant is the earliest approved and widely used vaccine adjuvant, and is still the main choice in the field of animal vaccines. It can adsorb soluble antigens to its surface to achieve effective concentration of antigens, thereby reducing the amount required for vaccine injection. In addition, aluminum adjuvant has the advantages of low cost, convenient use and safety and non-toxicity. Although aluminum adjuvant has wide applicability, its mechanism of action is limited to mainly inducing Th2 type immune response and humoral immunity, and cannot effectively stimulate Th1 type immune response. In addition, aluminum adjuvant also shows certain antigen specificity in inducing immune response, which limits its application in vaccine design to some extent. Studies have also shown that aluminum adjuvant has no adjuvant effect on influenza vaccine, and performs unsatisfactorily in enhancing the immune effect of most genetic engineering antigens except virus-like particles (VLP). Therefore, it is still necessary to develop new vaccine adjuvants. SUMMARY

[0003] The application separates and purifies an active substance, YjgB family protein, for inducing natural immune memory from secondary metabolites of Bacillus megaterium, which has excellent vaccine adjuvant activity and can be developed and applied as a vaccine adjuvant, and provides raw materials for developing a double-memory vaccine capable of simultaneously inducing natural immune memory and adaptive immune memory.

[0004] The application provides a YjgB family protein from Bacillus megaterium for inducing natural immune memory, and establishes a recombinant expression method, which has a good adjuvant effect and medical use, the amino acid sequence is shown as SEQ ID NO. 1, and the coding gene is shown as SEQ ID NO. 2.

[0005] The application provides a purification and preparation method of the YjgB family protein for inducing natural immune memory, which comprises the following steps:

[0006] (1) Fermentation supernatant preparation: Bacillus megaterium stored at -80℃ in a laboratory is streaked on a TSB plate according to its growth characteristics, and is cultured in a 37℃ incubator until single colonies appear. Single colonies are picked and cultured in corresponding liquid medium at 37℃ and 180 xg for overnight. The OD600 is adjusted to 1, and the liquid medium is transferred to new culture medium at a proportion of 1%, and is cultured at 37℃ and 180 xg on a shaking table until the platform period. The culture medium is centrifuged at 4℃ and 10000 xg for 10 min, and is filtered through a 0.22 μm sterile filter to obtain fermentation supernatant;

[0007] (2) Preparation of crude extract: the prepared fermentation supernatant is precipitated by saturated ammonium sulfate at low temperature overnight, and is statically placed at 4 DEG C overnight. 10000xg, 4 DEG C centrifugation is performed for 20 min, the precipitate is collected and combined, is loaded into a dialysis bag with a pore size of 10 kDa, is dialyzed at 4 DEG C for 48 h, the dialysis liquid is replaced at intervals during the dialysis, until the ammonium sulfate is completely removed, 1% barium chloride is used to detect whether the ammonium sulfate is completely removed, and finally freeze-drying is performed to obtain the crude extract;

[0008] (3) Purification: the crude extract is dissolved, is subjected to anion exchange chromatography, gradient elution is performed with eluent containing different concentrations of sodium chloride, the eluent is collected, and freeze-drying is sequentially performed on the eluent to obtain moderately purified extracts Fr1, Fr2, Fr3, Fr4, Fr5, Fr6 and Fr7; the purified product Fr1 is further purified by preparative high performance liquid chromatography to obtain a purified product Fr1-1, and the amino acid sequence of the purified product Fr1-1 is shown as SEQ ID NO. 1.

[0009] The preparation method of the YjgB family protein with induced natural immune memory according to the application comprises the following steps:

[0010] According to the YjgB family protein amino acid sequence shown as SEQ ID NO. 1, and comparative analysis, a corresponding coding gene is obtained, and primers are designed as follows:

[0011] The upstream primer F is CTGGAATTCATGAAAATGAAACAAC;

[0012] The downstream primer R is CTGGTCGACTTAAGGTTTTTTAACT;

[0013] The YjgB family protein target gene is amplified by PCR using the Bacillus megaterium genome as a template;

[0014] After the target gene fragment and the expression vector pET-28a plasmid are subjected to enzyme cutting, linking and transformation, the recombinant plasmid of the positive clone with correct sequencing is transformed into an expression strain (Escherichia coli BL21 (DE3)), and the positive clone expression strain is obtained by applying bacterial liquid PCR screening. IPTG is used for induction expression, and then Ni column affinity chromatography is used for purification.

[0015] The YjgB family protein according to the application has a significant induced domestication immune effect, has no hemolytic activity on mouse red blood cells, and has no toxic effect on mouse peritoneal macrophages and RAW 264.7 cells.

[0016] The YjgB family protein from Bacillus megaterium according to the application is used for preparing an induced domestication immune vaccine adjuvant.

[0017] The adjuvant effect application analysis of the YjgB family protein described in the application comprises the following steps:

[0018] In order to explore the YjgB family protein as an adjuvant to enhance the immune response of mice to the model antigen (OVA), we studied OVA combined with the commonly used aluminum adjuvant and YjgB family protein. In the low-dose experimental group, each mouse was injected subcutaneously with 100 μg OVA + 5 mg / kg YjgB family protein on the back. In the high-dose experimental group, each mouse was injected subcutaneously with 100 μg OVA + 20 mg / kg YjgB family protein on the back. The same volume of normal saline was injected subcutaneously on the back of the mice as a blank control group, 100 μg OVA was injected as a negative control group, and 100 μg OVA + veterinary aluminum salt adjuvant was injected as a positive control group. The primary immunization was performed at 0 week, the booster immunization was performed at 2 weeks, the body weight was measured every week, and the serum was collected at 4-7 weeks for ELISA analysis of IgG antibody levels, and the spleen tissue was collected at the end of the experiment for subsequent analysis. The results showed that the combination of OVA and YjgB family protein had a stronger humoral immune response than the traditional aluminum adjuvant, producing higher levels of specific antibody IgG. Further detection by CCK8 method showed that the proliferation ability of spleen lymphocytes was significantly improved. The above results indicate that YjgB family protein has great potential to become a new adjuvant.

[0019] The positive effects of the application are:

[0020] A new substance for inducing domestication immunity is provided, which is a protein substance YjgB family protein produced by Bacillus megaterium; the YjgB family protein can enhance the phagocytosis and killing of macrophages induced by heat-inactivated Candida albicans, promote the release of NO and TNF-α of macrophages, and enhance the protection effect on the infection of white Candida albicans in the larvae of Galleria mellonella. The YjgB family protein has no hemolytic activity and cytotoxicity, and has good temperature, acid and alkali stability. Further, the role of YjgB family protein as a vaccine adjuvant is determined, which lays a solid foundation for the future development of a new adjuvant and a double memory vaccine with innate immune memory and adaptive immunity. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 . Crude purification and activity tracking of YjgB family protein;

[0022] Figure 2 . Fine purification and activity tracking of YjgB family protein;

[0023] Figure 3 . Recombinant expression and activity verification of YjgB family protein;

[0024] Figure 4 Safety evaluation of YjgB family proteins;

[0025] Figure 5 Adjuvant activity analysis of YjgB family proteins. DETAILED DESCRIPTION

[0026] The application will be further described below by some specific examples. It should be made clear that the examples described below are part of the examples of the application, but not all the examples, and therefore the application is not limited in the scope of the described examples. If not specifically indicated, the technical means used in the examples are the conventional means known to those skilled in the art, and the raw materials used are commercially available. The experimental methods not specifically indicated in the following examples are carried out according to the conventional methods or according to the instructions of the commercial products. All the raw and auxiliary materials selected in the application, as well as the selected bacterial culture methods, are well known in the art. The % involved in the application is the mass percentage.

[0027] Example 1

[0028] Purification and activity tracking of YjgB family proteins

[0029] 1. The laboratory-80℃ frozen Bacillus megaterium was streaked on TSB plates according to its growth characteristics and cultured in a 37℃ incubator until single colonies appeared. Single colonies were picked and cultured in corresponding liquid medium at 37℃ and 180 xg for overnight. The OD600 was adjusted to 1, and the culture was transferred to new medium at a ratio of 1% and cultured at 37℃ and 180 xg on a shaker until the platform phase. The culture was centrifuged at 10000 xg for 10 min at 4℃, and the fermentation supernatant was obtained after filtration with a 0.22 μm sterile filter;

[0030] 2. The supernatant was treated with trypsin and proteinase K, and then the activity of the supernatant was verified by the immunization model of the larger wax moth, as shown in Figure 1 A. The active substance secreted by Bacillus megaterium T-5 lost immunosuppression activity after treatment with proteinase K and trypsin, and it was a protein substance. Then the fermentation supernatant was precipitated with different concentrations of saturated ammonium sulfate at 4℃ for overnight, centrifuged at 10000 xg and 4℃ for 20 min, and the precipitate was collected and combined, and then loaded into a dialysis bag with a pore size of 10 kDa, and dialyzed at 4℃ for 48h, and the dialysis solution was replaced at intervals during the dialysis until the ammonium sulfate was completely removed. 1% barium chloride was used to detect whether the ammonium sulfate was completely removed, and finally freeze-dried to obtain the crude extract. The activity verification results are shown in Figure 1 B-E. The crude extract of the fermentation supernatant precipitated with 80% ammonium sulfate had the maximum activity;

[0031] 3. The crude extract was dissolved with sterile distilled water, and low-pressure chromatography was performed on the crude extract using a Q Tanrose 6FF anion exchange chromatography column. The column was washed with 0, 0.1, 0.2, 0.3, 0.5, 0.7, and 1 M sodium chloride in Tris-HCl (50 mM) buffer solution, respectively, for 6 column volumes. The eluate was collected and dialyzed to remove salt, and then freeze-dried. As shown in FIG. 1, the moderately purified extract Fr1 (0 M elution component), Fr2 (0.1 M elution component), Fr3 (0.2 M elution component), Fr4 (0.3 M elution component), Fr5 (0.5 M elution component), Fr6 (0.7 M elution component), and Fr7 (1 M elution component) were obtained. Figure 1 F. Each component was verified by macrophage activity, and the Fr1 component had the ability to induce domestication immunity (FIG. 2). Figure 1 G-H).

[0032] Example 2

[0033] Fine purification and activity tracking of YjgB family proteins

[0034] The active component Fr1 was further purified by preparative high-performance liquid chromatography to obtain purified products Fr1-1, Fr1-2, Fr1-3, and Fr1-4. Purification was performed using an Ultimate XB-C18 liquid chromatography column by HPLC, with mobile phase A being distilled water and B being acetonitrile, linear gradient elution from 0 to 30 min, as shown in FIG. 3. Figure 2 A. Four elution components were obtained. As shown in FIG. 4, Figure 2 B-C, the Fr1-1 component had the ability to induce domestication immunity. The purified Fr1-1 component was detected for purity by analytical high-performance liquid chromatography, and the results are shown in FIG. 5. Figure 2 D. A single peak was present at 3.798 min. The purified product Fr1-1 sample was then subjected to SDS-PAGE electrophoresis under the following conditions: stacking gel 80 V, 20 min, separation gel 120 V, 80 min. The results are shown in FIG. 6. Figure 2 E. A single band with a molecular weight close to 17 kDa was present on the SDS-PAGE.

[0035] Example 3

[0036] Recombinant expression and activity verification of YjgB family proteins

[0037] According to the YjgB family protein amino acid sequence shown in SEQ ID NO. 1, and comparative analysis to obtain the corresponding coding gene, the primers were designed as follows:

[0038] Forward primer F: CTGGAATTCATGAAAATGAAACAAC;

[0039] Downstream primer R: CTGGTCGACTTAAGGTTTTTTAACT;

[0040] PCR amplification of the target gene of YjgB family protein using the genome of Bacillus megaterium as template, as shown in Figure 3 A. The target gene fragment of YjgB family protein was then ligated with the expression vector pET-28a plasmid after enzyme digestion, ligation and transformation, and positive clones were detected by bacterial liquid PCR, as shown in Figure 3 B, indicating that the expression vector was successfully constructed. Further, the recombinant plasmid with correct sequencing was transformed into an expression strain (E. coli BL21 (DE3)), and a positive clone expression strain was obtained by bacterial liquid PCR screening. Then IPTG was used for induction expression, and then Ni column affinity chromatography was used for purification, as shown in Figure 3 C, indicating that the pure target protein was obtained by elution with 500 mM imidazole, indicating that the YjgB family protein was successfully expressed.

[0041] The YjgB family protein obtained by recombinant expression was subjected to ultrafiltration to remove imidazole and LPS, and then the activity was verified. The results of the mouse peritoneal macrophage domestication model showed that the recombinant YjgB family protein had an activity of inducing domestication immunity comparable to that of the natural protein, as shown in Figure 3 D-E.

[0042] Experimental Example 1

[0043] Safety evaluation of YjgB family protein;

[0044] Mouse and chicken blood were collected in heparin sodium-containing anticoagulant tubes, and the blood was mixed quickly but also with attention to prevent coagulation and hemolysis. The collected blood was slowly dispensed into centrifuge tubes, centrifuged at 4°C, 1500 xg for 5 min, and the plasma and blood cells were separated. The supernatant was discarded, and appropriate PBS was added for washing until the supernatant was no longer red. The red blood cell suspension was resuspended in PBS at a proportion of 2%, and stored at 4°C for standby. The red blood cell suspension was incubated with different concentrations of YjgB family protein at 37°C for 1 h, and 1% Triton X-100 and PBS were used as positive and negative controls, respectively, and then the absorbance of the supernatant at 450 nm was measured, as shown in Figure 4 A-B, when the concentration of YjgB family protein reached 1.0 mg / mL, the hemolysis rate of red blood cells was still less than 7%, indicating that the hemolysis rate of YjgB family protein was very low. In addition, the passage of mouse peritoneal macrophages and RAW264.7 cells was 2 x 10 5cells / well were plated in 96-well cell plates, and then different concentrations of YjgB family proteins were added, with 0.5% Triton X-100 and PBS as positive and negative controls, respectively, and incubated at 37°C in a 5% CO2 cell incubator for 24 h. Then the medium was replaced, and CCK-8 reagent was added for incubation for 1 h. The absorbance of the cells at 450 nm was detected, as shown in Figure 4 As shown in Figs. C-D, when the concentration of YjgB family proteins was lower than 0.5 mg / mL, neither mouse peritoneal macrophages nor RAW 264.7 cells showed obvious cytotoxicity. Meanwhile, even when the concentration of YjgB family proteins for treating cells reached 1.0 mg / mL, the survival rates of the two types of cells were still as high as 85%. This result indicated that YjgB family proteins had no obvious damage to cells, showing good cell safety.

[0045] To evaluate the stability of YjgB family proteins, they were treated with protease K and trypsin, respectively, or treated at temperatures of 40-121°C for 20 min, or treated at different pH values for 2 h. Then, the activity of YjgB family proteins was evaluated by using mouse peritoneal macrophage domestication immunosuppression model, and the results are shown in Figs. E-G. Figure 4 As shown in Figs. E-G, after treatment at different temperatures, YjgB family proteins showed a trend that, as the temperature gradually increased from room temperature to 80°C, the activity of YjgB family proteins slightly decreased, and once the temperature reached or exceeded 100°C, the domestication induction activity of YjgB family proteins was completely lost. After treatment with trypsin and protease K, the ability of YjgB family proteins to induce domestication immunity decreased significantly. After treatment at different pH values, the activity of YjgB family proteins to induce domestication immunity basically remained stable, and no significant change was observed.

[0046] Experimental Example 2

[0047] Adjuvant activity analysis of YjgB family proteins

[0048] To study the adjuvant effect of YjgB family proteins on model antigen ovalbumin (OVA) immunized mice, female C57 / BL6 mice were randomly divided into a blank control group (Saline), a group immunized with OVA alone (OVA), a group immunized with OVA+aluminum adjuvant (OVA+Alum), and a group immunized with OVA+YjgB family proteins at low and high doses (5 mg / kg and 20 mg / kg), as shown in Fig. A. Figure 5 As shown in Fig. A, the primary immunization was performed at 0 week, and the booster immunization was performed at 2 week. The body weight was measured every week, and the serum was collected at 4-7 week for analysis of IgG antibody levels by ELISA. The spleen tissue was collected at the end of the experiment for subsequent analysis. We detected the body weight of mice before and after immunization, as shown in Figs. B-C. Figure 5As shown in B, the results show that the body weight of each group of mice before and after immunization increases without significant difference, indicating that the ribosomal protein has no obvious effect on the body weight of mice after immunization; as Figure 5 As shown in C, the YjgB family protein shows a significant effect on enhancing the humoral immune response of the model antigen OVA. Specifically, whether it is a low dose or a high dose of YjgB family protein combined with OVA immunization group, compared with the OVA control group, the secretion level of IgG antibody in the serum is increased. In addition, this enhanced immune response maintains a high level within 4 weeks of observation, showing that the YjgB family protein has a lasting enhancing effect on the humoral immune response, and compared with the classic aluminum salt adjuvant, the OVA+YjgB family protein immunization group can produce stronger OVA-specific IgG antibody levels in the serum than the OVA+aluminum salt adjuvant immunization group, indicating that it can enhance the humoral immune response of the model antigen OVA as an adjuvant. As Figure 5 As shown in D, the mouse spleen tissue was isolated and collected at the 7th week of the experiment, and compared with the OVA group and the OVA+Alum group, the weight of the spleen tissue of the experimental group increased significantly, as Figure 5 As shown in E, the volume of the spleen tissue increased significantly. At the same time, the spleen lymphocytes were isolated and cultured, and under the stimulation of LPS, the proliferation ability was detected by CCK8 method. As Figure 5 As shown in F, after OVA combined with YjgB family protein immunization, the proliferation ability of spleen lymphocytes was significantly improved.

[0049] From the above examples, it can be seen that the present application provides a natural immune memory active substance YjgB family protein, and its purification preparation method is clarified, and a recombinant expression method of YjgB family protein is provided. Further, the natural immune memory activity induced by YjgB family protein and the adjuvant activity analysis are evaluated, but it can also be seen that some modifications and expansions can be made on the basis of the present application, therefore, the modifications or improvements made without deviating from the spirit and principles of the present application, all belong to the scope of the present application.

Claims

1. Use of a Bacillus megaterium-derived YjgB family protein in the preparation of an adjuvant for an immunopotentiating vaccine, characterized in that: The amino acid sequence of the YjgB family protein from the said Bacillus megaterium is shown as SEQ ID NO. 1, and the coding gene is shown as SEQ ID NO.

2. The amino acid sequence of the YjgB family protein from the said Bacillus megaterium is shown as SEQ ID NO. 1, and the coding gene is shown as SEQ ID NO.

2. The amino acid sequence of the YjgB family protein

Citation Information

Patent Citations

  • Ribosomal protein S11, preparation method thereof and application of ribosomal protein S11 in vaccine adjuvant

    CN116199750A

  • Difunctional UDP (User Datagram Protocol) glycohydrolase / 5apos; preparation and antibacterial application of nucleotidase

    CN118291422A