A kind of Zygosaccharomyces bisporus F3404 and its application in reducing trans fatty acids

By screening and identifying the F3404 strain of Zygosaccharomyces bisporus, the problem of difficulty in reducing trans fatty acids in the existing technology was solved, and the effect of significantly reducing the trans fatty acid content and reducing the risk of cardiovascular disease was achieved.

CN118374367BActive Publication Date: 2025-09-23KUNMING UNIV OF SCI & TECH
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202410791264.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-19
Publication Date
2025-09-23
Estimated Expiration
2044-06-19

AI Technical Summary

Technical Problem

The existing technology lacks yeast strains that can effectively reduce the content of trans fatty acids and have probiotic capabilities, making it difficult to alleviate the harm of trans fatty acids to human health.

Method used

A Zygosaccharomyces bisporus F3404 strain was screened and identified. It metabolizes trans fatty acids and has the ability to withstand gastrointestinal digestion. It is suitable for use in food and medicine and has the function of reducing the risk of cardiovascular disease.

Benefits of technology

Strain F3404 can significantly reduce the content of trans fatty acids, reduce the risk of cardiovascular diseases in the body, is safe and edible, and is suitable for industrial production and market promotion.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118374367B_ABST
    Figure CN118374367B_ABST
Patent Text Reader

Abstract

The present invention discloses a strain of Zygosaccharomyces bisporus ( Zygosaccharomyces bisporus ) F3404, whose deposit number at the China General Microbiology Center is CGMCC No. 30463, was discovered through experimental research. This strain is capable of growing in trans-oleic acid culture medium. After 12 hours of culture, its trans-oleic acid metabolic capacity was 47.02±1.21%. Experiments demonstrating acid resistance, bile salt tolerance, simulated gastrointestinal digestion, heat resistance, and hemolysis resistance revealed that the strain is edible and can withstand gastrointestinal digestion and adapt to human body temperature. Zygosaccharomyces bisporus F3404 was isolated from preserved vegetables in Tengchong, Baoshan City, Yunnan Province. As a foodborne microorganism, it possesses the advantage of high safety and has promising development and application prospects for reducing trans fatty acids.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a strain of Zygosaccharomyces bisporus ( Zygosaccharomyces bisporus ) F3404 and its application in preparing products with the ability to reduce trans fatty acids belong to the field of functional microbial technology. Background Art

[0002] Trans fatty acids (TFA) are unsaturated fatty acids containing one or more double bonds in a trans configuration. Artificially produced TFA is also called industrial TFA, and the hydrogenation of oils and fats is the primary source of industrial TFA. Numerous studies have shown that industrial TFA has adverse effects on human health. Cardiovascular diseases such as atherosclerosis, thrombosis, and coronary heart disease are closely associated with the intake of industrial TFA, and have recently become a major concern in the food safety field. The World Health Organization reports that when TFA intake exceeds 1% of total energy intake, the risk of coronary heart disease mortality and other diseases increases, and that excessive TFA intake causes over 500,000 deaths from coronary heart disease worldwide each year. Trans-oleic acid is the most prevalent trans isomer of industrial TFA.

[0003] Probiotics are living microorganisms that, when present in sufficient quantities, are beneficial to the host's health. Probiotics generally need to meet three characteristics: safety, health benefits for the body, and a sufficient number of live bacteria. At the same time, probiotics are mainly composed of lactic acid bacteria and some yeasts, among which yeasts have excellent abilities to synthesize and metabolize fatty acids. Therefore, screening yeasts that can metabolize trans fatty acids and have beneficial effects is a new strategy to alleviate the harm of trans fatty acids to the human body, and also provides a new approach to reduce the intake of trans fatty acids. Summary of the Invention

[0004] The present invention provides a strain of Zygosaccharomyces bisporus ( Zygosaccharomyces bisporus ) F3404, which was deposited in the General Microbiology Center of China Culture Collection Administration on April 26, 2024, with the deposit number CGMCC No. 30463, and the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0005] Another object of the present invention is to use the above-mentioned Zygosaccharomyces bisporus F3404 in reducing the content of trans fatty acids. The strain has the ability to reduce trans fatty acids, tolerate gastrointestinal digestion, is edible, and has the ability to reduce the risk of cardiovascular diseases and other related diseases in the body.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] 1. Collect pickled vegetables from Tengchong, Baoshan City, Yunnan Province as samples for strain screening. Take the pickled vegetable samples, add them to physiological saline and shake them evenly. Dilute them by 10-fold gradient dilution method and select 10 -5 ~10 -7 The sample suspension at the concentration of 100 μg / mL was spread on Yeast Extract Peptone Dextrose Medium (YPD) and incubated at 30°C. A single colony was picked and streaked on YPD solid medium for purification. The colony was then expanded in YPD liquid medium and a small amount of bacterial liquid was aspirated for observation of the microscopic morphology of the strain under a microscope. The purified strain was preliminarily identified as yeast.

[0008] Pick the expanded culture solution and streak culture on trans-oleic acid solid medium. At the same time, use sterilized saline to wash the expanded culture strain and adjust the initial OD 600 nm The value was set to 2.0 ± 0.05 for future use, and 1% inoculum was used to inoculate into trans-oleic acid liquid medium to determine the growth curve of the strain;

[0009] 2. Molecular biological identification of strains

[0010] The bacterial suspension of the strain was used as a template and primers NL1: GCATATCAATAAGCGGAGGAAAAG, NL4: GGTCCGTGTTTCAAGACGG were used for amplification. The amplified product was sent to a sequencing company for sequence determination, and the 26S rRNA sequence shown as SEQ ID NO: 1 was obtained. The sequencing results were compared with the sequence on NCBI. Combined with the morphological characteristics and molecular identification results, the strain was finally identified as Zygosaccharomyces bisporus ( Zygosaccharomyces bisporus ), named F3404;

[0011] 3. Analysis of the ability of strains to metabolize trans fatty acids - taking trans oleic acid as an example

[0012] Detection using gas chromatography-mass spectrometry (GC-MS) Z. bisporus The results showed that strain F3404 had the ability to metabolize trans oleic acid. After 12 hours of culture, the trans oleic acid metabolism rate of the strain reached 47.02 ± 1.21%. Z.bisporus The distribution of fatty acids in F3404 after culture in trans-oleic acid liquid and YPD liquid medium showed that trans-oleic acid obviously entered the interior of the strain.

[0013] 4. Through acid resistance, bile salt resistance and simulated gastrointestinal digestion experiments, it was found that Z.bisporusF3404 has the ability to withstand gastrointestinal digestion, as demonstrated by hemolytic experiments Z.bisporus F3404 is edible, heat resistance test proves Z.bisporus F3404 can adapt to human body temperature.

[0014] The strain B2904 of the present invention can be used to prepare any one of medicines, cosmetics, foods, health products, fermentation agents, and feeds, and can also be added with one or more pharmaceutically acceptable excipients to prepare a suitable dosage form.

[0015] Compared with the prior art, the present invention has the following advantages:

[0016] 1. The present invention uses pickled vegetables from Tengchong, Baoshan, Yunnan as raw materials to screen and obtain foodborne functional strains Z.bisporus F3404, the raw material source is safe and reliable, and has been found to be resistant to acid, bile salt and simulated gastrointestinal digestion tests. Z.bisporus F3404 has the ability to withstand gastrointestinal digestion, as demonstrated by hemolytic experiments Z.bisporus F3404 is edible and can grow in the human body;

[0017] 2. Verification through experiments Z. bisporus F3404 has the ability to metabolize trans fatty acids, and trans fatty acids were observed inside the strain;

[0018] In summary, the present invention Z. bisporus F3404 can be used to reduce trans fatty acids in the host body, thereby reducing the risk of cardiovascular diseases and obesity. As a foodborne microorganism, it poses little harm to the human body, has good market prospects, and is suitable for industrial production and market promotion applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Morphological identification of Zygosaccharomyces bisporus F3404. Figures A and B show the results of observation on the plate and 40× microscope, respectively.

[0020] Figure 2 The growth results of Zygosaccharomyces bisporus F3404 in trans-oleic acid medium, Figure A and Figure B are the plate streaking and growth curve results respectively;

[0021] Figure 3 The results of the metabolic rate of trans-oleic acid by Zygosaccharomyces bisporus F3404 at different time periods are shown. All values ​​are expressed as mean ± standard deviation (n = 3). Different capital letters indicate significant differences ( p <0.05);

[0022] Figure 4The distribution of fatty acids in the cells of Zygosaccharomyces bisporus F3404 cultured in YPD liquid medium (Figure A) and trans-oleic acid liquid medium (Figure B), where the red triangles and arrows represent low and high fatty acid contents in the strain, respectively.

[0023] Figure 5 This is the growth curve of Zygosaccharomyces bisporus F3404 at different pH;

[0024] Figure 6 This is the growth curve of Zygosaccharomyces bisporus F3404 under different bile salt concentrations;

[0025] Figure 7 Figure 1 shows the viability of Zygosaccharomyces bisporus F3404 in simulated gastric and small intestinal fluids in vitro. Figure A and Figure B show colony-forming units (CFU) and survival rate, respectively. All values ​​are expressed as mean ± standard deviation (n = 3). Different lowercase letters indicate significant differences ( p <0.05);

[0026] Figure 8 The growth of Zygosaccharomyces bisporus F3404 under aerobic conditions at 30°C and anaerobic conditions at 37°C. All values ​​are expressed as mean ± SD (n = 3). Different lowercase letters indicate significant differences ( p <0.05);

[0027] Figure 9 These are the results of hemolytic experiments on Staphylococcus aureus CICC10306 and Zygosaccharomyces bisporus F3404. DETAILED DESCRIPTION

[0028] The technical solutions of the present invention are further described below with reference to the accompanying drawings and specific embodiments. However, these embodiments should not be used to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available unless otherwise specified. After reading the description of the present invention, various equivalent changes, modifications and modifications made by technicians in this field fall within the scope defined by the claims of the present invention.

[0029] Yeast Extract Peptone Dextrose Medium (YPD): consists of 1% yeast powder, 2% peptone, 2% glucose, and water. S. cerevisiae For the screening, activation, expansion culture and counting of B2904, 2% agar is added to the solid culture medium.

[0030] Trans-oleic acid liquid medium: Dissolve trans-oleic acid in a Tween-80 aqueous solution (w / w, 1 / 5) and heat with stirring at 70°C for 10 min. After visual observation for the absence of crystalline particles, sterilize the medium in an autoclave while still hot (121°C, 20 min). Prepare a medium containing 2% yeast powder and 4% peptone. Filter the medium using a 0.22 μm aqueous membrane and sterilize it under ultraviolet light for 30 min. Mix the sterilized trans-oleic acid-Tween-80 solution with the medium in equal proportions at 30°C to prepare a medium with trans-oleic acid as the sole carbon source, i.e., trans-oleic acid liquid medium. For the solid medium, add 2% agar to this medium.

[0031] Culture media containing different bile salt concentrations: 0.3, 0.5, 1.0, 1.5, and 2% (w / v) sodium taurocholate were added to YPD medium.

[0032] Different pH culture media: YPD culture medium was prepared by adjusting the pH value of the medium to 1.0-6.0 using 1M HCl.

[0033] Example 1: Isolation, screening and identification of strains that reduce trans fatty acids - taking trans oleic acid as an example

[0034] 1. Isolation and screening of strains

[0035] Weigh 1g of preserved vegetables from Tengchong, Baoshan, Yunnan Province, add 10mL of normal saline and shake to mix, dilute by 10-fold gradient dilution method, select 10 -5 ~10 -7 The sample suspension at the concentration was spread on YPD solid medium and cultured at 30℃ for 48h. A single colony was picked and streaked on YPD solid medium for purification. After expansion culture in YPD liquid medium, a small amount of bacterial liquid was taken and the microscopic morphology of the strain was observed under a microscope (DM 500, Leica, Germany). The colony morphology of the purified strain was as follows: Figure 1 As shown in A, the colony is milky white and smooth and round. Under the optical microscope, the bacteria are oval and accompanied by budding ( Figure 1 B), the bacterium was preliminarily identified as yeast and named F3404.

[0036] Take 1 μL of the expanded culture solution and streak it on trans-oleic acid solid medium, then culture it at 30℃ for 48h. The results of streak culture of strain F3404 on trans-oleic acid solid medium are as follows: Figure 2 As shown in A, the results showed that strain F3404 could grow under trans-oleic acid as the sole carbon source.

[0037] After washing and expanding the culture, the bacteria were resuspended twice with sterilized saline (0.85%, w / v), and the initial OD value of the bacterial suspension was adjusted using a UV-visible spectrophotometer (UV-5100BPC, Shanghai Yuanxi Instruments). 600 nmThe value was 2.0±0.05. 990 μL of sterilized trans-oleic acid liquid culture medium was added to a 1.5 mL sterile tube. Then, 10 μL of the bacterial suspension was added to a sterile tube. After vortexing, 200 μL was pipetted into a sterile 96-well plate. The experiment was repeated three times. Finally, the growth curve of the strain was measured using an automated microbial monitor (LogPhase 600, Agilent, USA) (culture conditions: 30°C, 500 rpm / min, measurement every 10 minutes).

[0038] The growth curve of strain F3404 in trans-oleic acid liquid medium is shown in Figure 2 B. The results showed that strain F3404 could grow normally and the OD 600 nm The change in the value was greater than 0.8, which proved that strain F3404 could grow significantly in the medium with trans-oleic acid as the sole carbon source. In summary, F3404 has the ability to utilize trans-oleic acid.

[0039] 2. Molecular biological identification of strain F3404

[0040] 1 mL of expanded bacterial culture was added to a 1.5 mL sterile tube. The cells were washed twice with sterile water and resuspended. 2 μL of the bacterial suspension was used as an RNA template for amplification using primers NL1 (GCATATCAATAAGCGGAGGAAAAG) and NL4 (GGTCCGTGTTTCAAGACGG). The PCR system consisted of 25 μL of 2× SanTaq PCR Mix (Sangon Biotechnology, China), 2 μL of RNA template, 1.5 μL of NL1, 1.5 μL of NL4 (Sangon Biotechnology, China), and 19 μL of double-distilled water. The PCR cycle was repeated (pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 50–60°C for 30 s, extension at 72°C for 20–60 s / kb for a total of 35 cycles, and end extension at 2°C for 10 min. The final product was stored at 4°C. After completion of the amplification, the product was sent to Sangon Biotechnology (Shanghai) Co., Ltd. for Sanger sequencing to obtain the 26Sr RNA sequence, the sequencing sequence is shown in SEQ ID NO: 1; the sequence was compared with the strain F3404 at the National Center for Biotechnology Information in the United States. Zygosaccharomyces bisporus isolate UTAD799, the similarity was 98.99%, so F3404 was identified as Zygosaccharomyces bisporus and named Zygosaccharomyces bisporus ( Zygosaccharomyces bisporus , Z. bisporus )F3404.

[0041] Example 2: Z. bisporus F3404's ability to reduce trans fatty acids - taking trans oleic acid as an example

[0042] 1. Detection of trans oleic acid in culture medium

[0043] Activated cryotubes Z.bisporus After F3404 was subcultured twice, the bacteria were washed twice with sterile saline (0.85%, w / v) and resuspended. The OD value of the bacterial suspension was adjusted using a UV-visible spectrophotometer (UV-5100BPC, Shanghai Yuanxi Instruments). 600 nm The value was 2.00±0.05, and the culture was inoculated into trans-oleic acid liquid culture medium at a 10% inoculum, cultured at 30℃ for 72 h, and the fatty acid content in the supernatant was measured at 12, 24, 48 and 72 h. At the same time, a blank control was set up in which 10% sterile water was used instead of bacterial suspension;

[0044] Fatty acid content was determined as follows: the bacterial suspension was centrifuged (1728 g, 10 min) to separate the bacterial cells and the supernatant. 800 μL of the supernatant was placed in a glass test tube. 2 mL of chloroform, 1 mL of methanol, and 1 mg / 100 mL of heptadecanoic acid (internal standard) were added, followed by vortexing for 3 min twice for extraction. After vortexing, the suspension was centrifuged (1728 g, 10 min) to separate the layers. The lower 2 mL of chloroform was removed and transferred to a glass test tube with a nut cap. The chloroform was completely evaporated using a water-bath nitrogen purging apparatus (CM-36, Beijing Chengmeng Weiye). 3 mL of 2% concentrated sulfuric acid-methanol solution was added to the glass test tube and vortexed. The mixture was then heated in a 70°C water bath for 3 h. After heating, the mixture was quickly cooled in a 4°C refrigerator. After cooling, 2 mL of n-hexane and 2 mL of saturated saline were added, each vortexed for 3 min twice (with a 2-min interval). The mixture was then centrifuged (1728 g, 10 min) to separate the layers. Finally, the upper liquid was aspirated and collected in a brown vial through a 0.22 μm organic phase filter membrane and stored in a -40°C refrigerator.

[0045] Fatty acid content was determined using an HP-88 column (0.25 mm × 60 μm, Agilent, USA) coupled to a GC-MS (6890N-5977B, Agilent, USA). GC conditions included an injection temperature of 250°C, an injection volume of 1 μL, and a split ratio of 10:1. The column oven temperature was initially 180°C (hold for 2 min), then increased at 2°C / min to 210°C (hold for 5 min), then increased at 2.5°C / min to 220°C (hold for 4 min) for a total of 30 min. MS conditions included a 70 eV source, a source temperature of 230°C, an m / z range of 50–500, and a 5-min delay time.

[0046] GC-MS data were analyzed using Agilent MassHunter. Chromatograms were first smoothed using the software's native settings. Analysis was performed by averaging the mass spectra at the beginning and end of the peaks, and an S / N ratio greater than 3 was used as the instrument's detection limit. The extracellular fatty acid content per mL of bacterial suspension (0.1 mg / 100 mL) was calculated according to the following formula:

[0047]

[0048] S1 is the peak area of ​​the fatty acid to be tested, S2 is the peak area of ​​heptadecanoic acid, V is the conversion factor of 1.25 for 1 mL of extracellular supernatant, and the factor 1 is the concentration of heptadecanoic acid;

[0049] The metabolic rate of trans-oleic acid by the strain was calculated according to the following formula (%):

[0050]

[0051] M1 is the trans oleic acid content of the supernatant of the trans oleic acid culture medium after the strain was cultured for 12, 24, 48, and 72 h, and M2 is the trans oleic acid content in the blank control.

[0052] Z. bisporus The trans-oleic acid metabolism rate of F3404 is as follows Figure 3 As shown in the results, at 12h of culture, the trans oleic acid metabolism rate of the strain reached 47.02 ± 1.21%. Furthermore, the trans oleic acid metabolism rates of the strain at 24, 48, and 72h were not significantly different from those at 12h. Z. bisporus F3404 was able to metabolize trans-oleic acid in the culture medium and reached equilibrium in the metabolism of trans-oleic acid after 12 hours.

[0053] 2. Observation of trans-oleic acid distribution in bacteria

[0054] Activated cryotubes Z. bisporus After F3404 was subcultured twice, the bacterial suspension was washed twice with sterile saline (0.85%, w / v) and resuspended. The OD value of the bacterial suspension was adjusted using a UV-visible spectrophotometer (UV-5100BPC, Shanghai Yuanxi Instruments). 600 nm The bacterial suspension was inoculated at a 10% inoculum into trans-oleic acid liquid medium and YPD liquid medium and cultured at 30°C for 72 hours. 2 μL of Nile Red Fat Fluorescent Stain (500×, Pulilai, China) was mixed with 998 μL of the strain sample and vortexed for 10 minutes. A 10 μL drop of the stained sample was placed on a glass slide, mounted with a coverslip, and observed under a confocal laser scanning microscope (A1 Plus, Nikon, Japan) with an excitation wavelength set to 488 nm.

[0055] Z. bisporusThe confocal laser scanning microscopy results of F3404 cultured in trans-oleic acid liquid medium and YPD liquid medium for 72 h are shown in Figure 2. Figure 4 As shown, the fatty acid content in the cells of the strain cultured in trans-oleic acid liquid medium was significantly higher than that in the cells cultured in YPD liquid medium. In summary, this indicates that trans-oleic acid enters the cells of the strain and is metabolized.

[0056] Example 3: Z. bisporus Analysis of physiological characteristics of F3404

[0057] 1. Acid and bile salt resistance test

[0058] Activated cryotubes Z. bisporus After F3404 was subcultured twice, the bacterial suspension was washed twice with sterile saline (0.85%, w / v) and resuspended. The OD value of the bacterial suspension was adjusted using a UV-visible spectrophotometer (UV-5100BPC, Shanghai Yuanxi Instruments). 600 nm The value should be within 1.5 ± 0.05 before use. 990 μL of sterilized bile salt culture medium with different concentrations, culture medium with different pH values, and YPD liquid culture medium were added to 1.5 mL sterile tubes. 10 μL of the bacterial suspension was then added to the sterile tubes. After vortex mixing, 200 μL was pipetted into a sterile 96-well plate. Each experiment was repeated three times. The growth curve of the strain was measured using an automated microbial monitor (LogPhase 600, Agilent, USA) (culture conditions: 30°C, 500 rpm / min, measurement every 10 minutes).

[0059] Microorganisms ingested by the human body usually need to be digested by the gastrointestinal tract and survive in the low pH (4-6) and high bile salt concentration in the intestine. Therefore, microorganisms colonizing the body's intestines must be resistant to gastrointestinal digestion and able to grow in low pH and high bile salt levels. This example explores the effects of different pH values ​​on the growth of microorganisms at pH values ​​of 1-6 and sodium taurocholate content of 0.3%-2.0%. Z. bisporus F3404 has acid and bile salt resistance.

[0060] The results are as follows Figure 5 、 6 As shown, when pH>3, the strain grows normally, but the OD 600 nm The value decreased slightly. When the bile salt content was 2.0% or below, it had no significant effect on yeast growth. Z. bisporus F3404 has significant acid and bile salt resistance.

[0061] 2. In vitro stress tolerance simulating gastrointestinal digestion

[0062] The simulated gastric fluid consists of 27 mg / 100 mL pepsin and a pH 2.5 saline solution (0.85%, w / v); the simulated small intestinal fluid consists of 40 mg / 100 mL pancreatin and a pH 8.0 saline solution. Z. bisporus After F3404 was subcultured twice, the bacteria were washed twice with sterile saline (0.85%, w / v) and resuspended. Simulated gastric fluid was added and the OD of the bacterial suspension was adjusted using a UV-visible spectrophotometer (UV-5100BPC, Shanghai Yuanxi Instruments). 600nm The value was 1.5 ± 0.05, and then after shaking in the dark at 37 ° C for 3 h, 0.5 mL of the above solution was transferred to 4.5 mL of simulated small intestinal fluid and shaken in the dark at 37 ° C for 3 h. The B2904 bacterial solution after initial conditions, simulated gastric juice digestion and simulated small intestinal juice digestion was diluted to 10 by 10-fold dilution method. -7 Take 1mL 10 -5 ~10 -7 The dilution was transferred to a sterile plate, poured into YPD solid medium and shaken to mix. Finally, the solidified solid medium was placed in a 30°C incubator for 72 hours, and the colony-forming units (CFU) of the bacteria were calculated using the direct counting method. Z. bisporus The survival rate of F3404 after digestion in gastric juice and small intestinal juice, respectively; the survival rate (%) is expressed using the following equation:

[0063]

[0064] A1 is the number of viable cells in the gastric juice or small intestinal juice after incubation (CFU / mL), and A2 is the initial number of viable cells (CFU / mL).

[0065] The ability of microorganisms to maintain survival during gastrointestinal digestion is a prerequisite for their colonization of the body. Z. bisporus The changes in CFU and survival rate of F3404 after gastrointestinal digestion are as follows Figure 7 As shown, with the digestion of gastric juice and small intestinal juice, Z. bisporus The CFU of F3404 decreased significantly ( p <0.05). In terms of survival rate after gastrointestinal digestion, Z. bisporus The survival rate of F3404 after digestion in gastric juice was significantly higher than that in small intestinal juice ( p <0.05), the final survival rate of the strain was 52.90±1.65%. Z. bisporus The vitality of F3404 is still more than half, indicating that Z. bisporus F3404 has the ability to withstand gastrointestinal digestion.

[0066] 3. Heat resistance

[0067] Activated cryotubes Z. bisporus After F3404 was subcultured twice, the bacterial solution was washed twice with sterile saline (0.85%, w / v) and resuspended. The OD was adjusted using a UV-visible microplate reader (BioTek Epoch 2, Agilent, USA). 600 nm The value was 0.20 ± 0.01. The bacterial suspension was inoculated into 10 mL of YPD liquid medium at a 1% inoculum volume and cultured in a 30°C constant temperature and humidity incubator (HWS-250D, Ningbo Southeast Instrument) and a 37°C anaerobic incubator (YY-S, Beijing Longfujia Biotechnology) for 48 h. After the incubation period, the bacterial sludge and the supernatant were separated by centrifugation (1728 g, 5 min). The supernatant was collected and 10 mL of sterile saline (0.85%, w / v) was added, and the supernatant was diluted to 10 by a 10-fold dilution method. -7 , take 1mL 10 -5 ~10 -7 The dilution was transferred to a sterile plate, poured into YPD solid medium and shaken to mix. After the medium solidified, it was placed in a 30°C incubator for 72 h. The CFU of the strain after growth under different conditions was calculated using the direct counting method.

[0068] The human intestine is an oxygen-free environment and the human body temperature is about 37°C. Z. bisporus The growth of F3404 at the optimal culture temperature and human environment respectively. Figure 8 As shown, under 30℃ aerobic and 37℃ anaerobic conditions, Z. bisporus There was no significant difference in the CFU of F3404, indicating Z. bisporus F3404 exhibits good heat resistance and anaerobic adaptability, and has the ability to adapt well to human body temperature.

[0069] 4. Hemolytic test

[0070] Activated cryotubes Z. bisporus After F3404 was subcultured twice, the bacteria were washed twice with sterile saline (0.85%, w / v) and resuspended. The OD value of the bacterial suspension was adjusted using a UV-visible spectrophotometer (UV-5100BPC, Shanghai Yuanxi Instruments). 600 nm The value should be within 1.5 ± 0.05 before use. Use a loop to pick 1 μL of the bacterial suspension and streak it onto blood agar solid medium (Antu Biotechnology, China) (30°C, 72 h), with Staphylococcus aureus CICC10306 as a positive control.

[0071] Hemolysis is a quick and reliable method to check the safety of the strain. If the strain shows a positive result in the hemolysis evaluation, the strain should not be taken. Figure 9 As shown in the figure, the control group Staphylococcus aureus CICC10306 lysed the red blood cells in the blood plate, and a transparent hydrolysis zone appeared around them. Z. bisporus F3404 did not show a transparent hydrolysis zone, indicating that the strain was hemolytically negative and the strain of the present invention was safe and edible.

Claims

1. A strain of Zygosaccharomyces bisporus ( Zygosaccharomyces bisporus ) F3404, whose deposit number in the General Microbiology Center of China Culture Collection Administration is CGMCC No.30463.

2. Use of the Zygosaccharomyces bisporus F3404 according to claim 1 in preparing a preparation with reduced trans oleic acid content.

3. Use of the Zygosaccharomyces bisporus F3404 according to claim 1 in preparing a preparation for reducing the trans-oleic acid content in the human gastrointestinal tract.

4. A microbial preparation, characterized in that: Contains the Zygosaccharomyces bisporus F3404 or a culture thereof according to claim 1.

Citation Information

Patent Citations

  • Saccharomyces cerevisiae B2904 and application thereof in reducing trans-fatty acid content

    CN118389306A

  • Fragrance-producing nitrogen-overflowing zygosaccharomyces rouxii and application of zygosaccharomyces rouxii in soy sauce brewing

    CN118530860A

  • Salt-tolerant zygosaccharomyces rouxii with high ethanol yield and application thereof in preparation of soy sauce

    CN119776163A