Coenzyme q10-producing genetically engineered bacteria and application thereof

Abstract

The application provides a coenzyme Q10-producing genetically engineered bacterium and application thereof.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biological fermentation, and particularly relates to a coenzyme Q10-producing genetically engineered bacterium and application thereof. BACKGROUND

[0002] Ubiquinone (abbreviation UQ) is also called coenzyme Q, which is a liposoluble quinone compound existing in nature. The ubiquinone molecule contains a side chain connected to a p-benzoquinone nucleus by a plurality of isoprene units, and the length of the side chain is different according to the source of ubiquinone, generally containing n = 6-10 isoprene units. For humans and mammals, n = 10, so it is also called coenzyme Q10 (CoQ10), and its structural formula is shown as formula (I):

[0003]

[0004] Coenzyme Q10 is an important hydrogen carrier in the respiratory chain of biological cells, and participates in the energy metabolism of cells. In human body cells, it participates in energy production and activation, and is an effective antioxidant component for preventing the formation of arteriosclerosis. In recent years, it has been widely used in the treatment of various heart diseases, diabetes, cancer, acute and chronic hepatitis, Parkinson's disease and other diseases. In addition, it also has significant effects in the treatment of scurvy, duodenal ulcer, necrotizing periodontitis, and promotion of pancreatic function and secretion. Recently, researchers have found that coenzyme Q10 has an anti-aging effect, so it has been applied to the fields of cosmetics and health products, and its demand has further expanded at home and abroad.

[0005] At present, there are three main methods for producing coenzyme Q10, namely, extraction from animal and plant tissues, chemical synthesis and microbial fermentation. The content of coenzyme Q10 in animal and plant tissues is low, and various chemical components are complex, and are limited by raw materials and sources, so the product cost is high, the price is expensive, and the large-scale production is limited to a certain extent. The chemical synthesis method is relatively mature in technology, which mainly uses the relatively abundant solanesol as raw material for synthesis, but the product is a mixture of cis-trans isomers, and the biological activity is low. The synthesis of coenzyme Q10 with high biological activity has not yet reached the level of industrial production. The microbial fermentation method has the advantages of low cost, no optical isomers, good biological activity and high yield, and good application effect in large-scale production, and gradually becomes the main method for industrial production of coenzyme Q10.

[0006] Microorganisms for producing coenzyme Q10 are various, among which Rhodobacter sphaeroides belonging to photosynthetic bacteria is an important strain for industrialized large-scale production of coenzyme Q10 at present, because it has a high content of intracellular coenzyme Q10 synthesis and a relatively simple extraction step. At present, it has been reported in the prior art that the biosynthetic pathway of coenzyme Q10 of Rhodobacter sphaeroides can be genetically modified and transformed by means of metabolic engineering, so as to improve the yield of coenzyme Q10 of Rhodobacter sphaeroides. For example, Chinese invention patent CN103509729B discloses that the key genes DXS and DDS for synthesizing polydecaisoprene pyrophosphate in the intracellular MEP pathway of Rhodobacter sphaeroides can be used to increase the yield of coenzyme Q10 of the engineering bacteria. However, the product yield of coenzyme Q10 obtained in the prior art is not ideal.

[0007] At present, it is still necessary to provide a genetically engineered bacteria with improved coenzyme Q10 yield, so as to be more conducive to the industrialized large-scale production and downstream application of coenzyme Q10. SUMMARY

[0008] The inventors have surprisingly found that in a parent strain of Rhodobacter sphaeroides, the coenzyme Q10 yield of Rhodobacter sphaeroides can be effectively improved by simultaneously expressing UbiF gene and RegA gene, and the strain has good stability.

[0009] Correspondingly, in a first aspect, the present application provides a Rhodobacter sphaeroides engineering bacteria, which is modified to express UbiF gene and RegA gene, wherein: the UbiF gene is integrated into the genome of the Rhodobacter sphaeroides engineering bacteria, and the RegA gene is expressed by a plasmid vector.

[0010] QMP (quinone modification pathway) is the last few modification steps for cyclic structure quinone in the coenzyme Q10 synthesis pathway, involving UbiA, UbiD, UbiX, UbiI, UbiG, UbiH, UbiE, UbiF, UbiB, etc. The enzymes encoded by each gene are as follows: ubiA, 4-hydroxybenzoic acid octenyltransferase; ubiD, 3-octenyl-4-hydroxybenzoic acid decarboxylase; ubiX, xanthine pre-base transferase; ubiI, 2-octenyl phenol hydroxylase; ubiG, 2-octenyl-6-hydroxyphenol / 2-octenyl-3-methyl-5-hydroxy-6-methoxy-1,4-benzoquinone methyltransferase; ubiH, 2-octenyl-6-methoxyphenol hydroxylase; ubiE, ubiquinone / cerebrospinal lipid quinone biosynthesis methyltransferase; ubiF, 2-octenyl-3-methyl-6-methoxy-1,4-benzoquinone hydroxylase; ubiB, which is possibly a protein kinase, and the function is unknown.

[0011] In embodiments of the present application, the UbiF gene can be derived from a variety of species, as long as the UbiF protein encoded by the UbiF gene has 2-octenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase activity. In some embodiments, the UbiF gene is derived from E. coli.

[0012] In some preferred embodiments, the UbiF gene encodes an E. coli UbiF protein having 2-octenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase activity and comprises an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 2. In some more preferred embodiments, the UbiF gene encodes the amino acid sequence of SEQ ID NO: 2.

[0013] In some preferred embodiments, the UbiF gene is an E. coli UbiF gene, preferably comprising a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 1. In some more preferred embodiments, the UbiF gene comprises the nucleotide sequence of SEQ ID NO: 1.

[0014] RegA and RegB are a two-component transcriptional regulatory system present in a variety of photosynthetic and non-photosynthetic bacteria, capable of regulating the expression of downstream genes in response to the redox state in the bacteria. In embodiments of the present application, the RegA gene can be derived from a variety of species, as long as the RegA gene has transcriptional regulatory activity. In some embodiments, the RegA gene is derived from Rhodobacter sphaeroides, such as Rhodobacter sphaeroides KD131 (KCTC 12085), Rhodobacter sphaeroides 2.4.1 (ATCC 17023), Rhodobacter sphaeroides ATCC 17029, Rhodobacter sphaeroides strain AB24, Rhodobacter sphaeroides strain AB25, Rhodobacter sphaeroides strain AB27, Rhodobacter sphaeroides strain AB29, Rhodobacter sphaeroides strain CH10, Rhodobacter sphaeroides strain DSM 158, Rhodobacter sphaeroides strain MBTLJ-13, Rhodobacter sphaeroides strain MBTLJ-20, Rhodobacter sphaeroides strain MBTLJ-8, Rhodobacter sphaeroides strain HJ, or a Rhodobacter sphaeroides strain derived therefrom.

[0015] In some preferred embodiments, the RegA gene encodes a RegA protein of Rhodobacter sphaeroides having a transcription activation function and comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 4. In some preferred embodiments, the RegA gene encodes the amino acid sequence of SEQ ID NO: 4.

[0016] In some preferred embodiments, the RegA gene is a RegA gene of Rhodobacter sphaeroides, preferably comprising a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 3. In some preferred embodiments, the RegA gene comprises the nucleotide sequence of SEQ ID NO: 3.

[0017] To achieve expression of the UniF gene and the RegA gene in the engineered Rhodobacter sphaeroides, a promoter capable of initiating gene expression in Rhodobacter sphaeroides can be selected, for example, the promoters provided in Table 1 of the present application.

[0018] In some embodiments, the UbiF gene is initiated for expression by a strong promoter. In some embodiments, the UbiF gene is initiated for expression by a strong promoter having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 105%, at least 110%, at least 115%, or at least 120% relative strength in the engineered Rhodobacter sphaeroides relative to the Tac promoter. In some preferred embodiments, the UbiF gene is initiated for expression by a promoter selected from T334-6 (SEQ ID NO: 10), T334-36 (SEQ ID NO: 9), NOLALANC_02773 (SEQ ID NO: 11), T167-31 (SEQ ID NO: 12), NOLALANC_02328 (SEQ ID NO: 13), T334-7 (SEQ ID NO: 14), NOLALANC_02693 (SEQ ID NO: 15), T167-27 (SEQ ID NO: 16), T167-29 (SEQ ID NO: 17), or T334-26 (SEQ ID NO: 18). In some more preferred embodiments, the UbiF gene is initiated for expression by the T334-6 promoter (SEQ ID NO: 10).

[0019] In some embodiments, the RegA gene is initiated for expression by a weak promoter. In some embodiments, the RegA gene is initiated for expression by a weak promoter having at most 40%, at most 30%, at most 25%, at most 20%, at most 19%, at most 18%, at most 17%, at most 16%, at most 15%, at most 14%, at most 13%, at most 12%, at most 11%, at most 10%, at most 9%, at most 8%, at most 7%, at most 6%, at most 5%, at most 4%, at most 3%, at most 2%, or at most 1% relative strength of the Tac promoter in the Rhodopseudomonas engineer. In some preferred embodiments, the RegA gene is initiated for expression by a promoter selected from the group consisting of NOLALANC_04400 (SEQ ID NO: 60), NOLALANC_03111 (SEQ ID NO: 55), NOLALANC_00059 (SEQ ID NO: 56), NOLALANC_01751 (SEQ ID NO: 57), NOLALANC_03340 (SEQ ID NO: 58), NOLALANC_03519 (SEQ ID NO: 59), NOLALANC_03841 (SEQ ID NO: 61), NOLALANC_03925 (SEQ ID NO: 62), NOLALANC_03961 (SEQ ID NO: 63), NOLALANC_01082 (SEQ ID NO: 64), NOLALANC_01569 (SEQ ID NO: 65), or NOLALANC_02822 (SEQ ID NO: 66). In some more preferred embodiments, the RegA gene is initiated for expression by the NOLALANC_04400 promoter (SEQ ID NO: 60).

[0020] In embodiments of the application, the UbiF gene is expressed by integration into the genome of the Rhodopseudomonas engineer.

[0021] Methods for integrating a gene fragment of interest into the genome of a host cell are well known to those skilled in the art. For example, a gene fragment of interest can be integrated into a target site in the genome of a host cell by homologous recombination. The process of homologous recombination relies on homology between DNA molecules. When applying homologous recombination, it is often necessary to add upstream and downstream sequences having homology to the target site, also referred to as homology arms, upstream and downstream of the exogenous DNA sequence or gene fragment of interest.

[0022] In some embodiments of the present application, the target site for UbiF gene integration is the NOLALANC_00703 site in the genome of Rhodobacter sphaeroides, which corresponds to a flagellar basal body MS-ring / rod protein gene. In some embodiments, the UbiF gene is integrated into or upstream or downstream of the flagellar basal body MS-ring / rod protein gene in the genome of the engineered Rhodobacter sphaeroides strain. In some preferred embodiments, the UbiF gene is integrated within 1000 bp upstream or downstream of the flagellar basal body MS-ring / rod protein gene in the genome of the engineered Rhodobacter sphaeroides strain. In some more preferred embodiments, the UbiF gene replaces the fragment from 1000 bp upstream to 1000 bp downstream of the flagellar basal body MS-ring / rod protein gene.

[0023] In some embodiments, the flagellar basal body MS-ring / rod protein gene comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 5. In some preferred embodiments, the flagellar basal body MS-ring / rod protein gene comprises the nucleotide sequence of SEQ ID NO: 5.

[0024] In some embodiments, the flagellar basal body MS-ring / rod protein gene encodes an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 6. In some preferred embodiments, the flagellar basal body MS-ring / rod protein gene encodes the amino acid sequence of SEQ ID NO: 6.

[0025] In some embodiments, the 1000 bp upstream of the flagellar basal body MS-ring / rod protein gene comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 7. In some preferred embodiments, the 1000 bp upstream of the flagellar basal body MS-ring / rod protein gene comprises the nucleotide sequence of SEQ ID NO: 7.

[0026] In some embodiments, the 1000 bp downstream of the flagellar basal body MS-ring / rod protein gene comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 8. In some preferred embodiments, the 1000 bp downstream of the flagellar basal body MS-ring / rod protein gene comprises the nucleotide sequence of SEQ ID NO: 8.

[0027] In some embodiments, the gene fragment of interest for integration of the UbiF gene into the target site comprises a homology arm N-terminal and a homology arm C-terminal. In some embodiments, the homology arm comprises at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, or at least 1000 contiguous nucleotides of the flagellar basal body MS-ring / co-rings gene of Rhodobacter sphaeroides. In some embodiments, the homology arm comprises at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, or at least 1000 contiguous nucleotides within the range of 1000 bp upstream of the flagellar basal body MS-ring / co-rings gene of Rhodobacter sphaeroides. In some embodiments, the homology arm comprises at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, or at least 1000 contiguous nucleotides within the range of 1000 bp downstream of the flagellar basal body MS-ring / co-rings gene of Rhodobacter sphaeroides.

[0028] In some preferred embodiments, the N-terminal homology arm of the gene fragment of interest for integration of the UbiF gene into the target site comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 7. In some more preferred embodiments, the N-terminal homology arm comprises the nucleotide sequence of SEQ ID NO: 7. In some preferred embodiments, the C-terminal homology arm of the gene fragment of interest for integration of the UbiF gene into the target site comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 8. In some more preferred embodiments, the C-terminal homology arm comprises the nucleotide sequence of SEQ ID NO: 8.

[0029] In some preferred embodiments, the N-terminal homology arm of the gene fragment of interest for integration of the UbiF gene into the target site comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the reverse complement of SEQ ID NO: 8. In some more preferred embodiments, the N-terminal homology arm comprises the nucleotide sequence reverse complementary to SEQ ID NO: 8. In some preferred embodiments, the C-terminal homology arm of the gene fragment of interest for integration of the UbiF gene into the target site comprises a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the reverse complement of SEQ ID NO: 7. In some more preferred embodiments, the C-terminal homology arm comprises the nucleotide sequence reverse complementary to SEQ ID NO: 7.

[0030] In some embodiments of the present application, whether the UbiF gene is integrated into the target site can be confirmed by PCR identification of the Rhodobacter sphaeroides engineering strain using primer A (SEQ ID NO: 78, TGAAGACGGGATCCATCACATAC) / primer B (SEQ ID NO: 79, GAGCGTGCTGGCGTGTTGA). If a positive target fragment of 1576 bp can be obtained by PCR identification, it is proved that the UbiF gene is successfully integrated into the target site of the Rhodobacter sphaeroides engineering strain genome.

[0031] In some embodiments of the present application, the RegA gene is expressed by a plasmid. The plasmid for expressing the RegA gene is constructed by inserting the RegA gene expression cassette into a plasmid vector suitable for Rhodobacter sphaeroides. In some embodiments, the plasmid vector comprises a replication origin capable of self-replication in Rhodobacter sphaeroides. In some embodiments, the replication origin is selected from the group consisting of pUC, ColE1, pBBR1, pMB1, pBR322, pSC101, R6K, and p15A.

[0032] In some preferred embodiments, the plasmid vector comprises the replication origin pBBR1. In some preferred embodiments, the vector for plasmid expression of the RegA gene is the pBBR1MCS2 vector.

[0033] In embodiments of the present application, the Rhodobacter sphaeroides engineered bacteria are prepared by modifying a parent Rhodobacter sphaeroides to express a UbiF gene and a RegA gene. The parent Rhodobacter sphaeroides can be selected from the group consisting of: Rhodobacter sphaeroides KD131 (KCTC 12085), Rhodobacter sphaeroides 2.4.1 (ATCC 17023), Rhodobacter sphaeroides ATCC 17029, Rhodobacter sphaeroides strain AB24, Rhodobacter sphaeroides strain AB25, Rhodobacter sphaeroides strain AB27, Rhodobacter sphaeroides strain AB29, Rhodobacter sphaeroides strain CH10, Rhodobacter sphaeroides strain DSM 158, Rhodobacter sphaeroides strain MBTLJ-13, Rhodobacter sphaeroides strain MBTLJ-20, Rhodobacter sphaeroides strain MBTLJ-8, Rhodobacter sphaeroides strain HJ, and Rhodobacter sphaeroides strain CGMCC No. 7.275.

[0034] In some preferred embodiments, the parent Rhodobacter sphaeroides strain has the accession number CGMCC No. 7.275.

[0035] In a second aspect, the present application provides a Rhodobacter sphaeroides engineered bacteria, the strain of which has the accession number CGMCC No. 30222.

[0036] In some embodiments, the Rhodobacter sphaeroides engineered bacteria of the present application has an increased production of coenzyme Q10 compared to the parent Rhodobacter sphaeroides. In some embodiments, the Rhodobacter sphaeroides engineered bacteria of the present application has a production of coenzyme Q10 that is at least 100%, at least 105%, at least 110%, at least 115%, at least 120%, at least 125%, at least 130%, at least 140%, at least 150%, at least 160%, at least 170%, at least 180%, at least 190%, at least 200%, at least 250%, at least 300%, at least 350%, at least 400%, at least 450%, at least 500%, at least 550%, or at least 600% of the production of coenzyme Q10 of the parent Rhodobacter sphaeroides.

[0037] In a third aspect, the present application provides a method of producing coenzyme Q10, the method comprising:

[0038] (1) culturing the Rhodobacter sphaeroides engineered bacteria of the first or second aspect of the present application under conditions suitable for the production of coenzyme Q10;

[0039] (2) recovering coenzyme Q10 from the culture of the Rhodobacter sphaeroides engineered bacteria.

[0040] In a fourth aspect, the present application provides the use of the Rhodobacter sphaeroides engineered bacteria of the first or second aspect of the present application in the production of coenzyme Q10.

[0041] In a fifth aspect, the present application provides a method for preparing the Rhodobacter sphaeroides engineering bacteria of the first aspect or the second aspect of the present application, the method comprising:

[0042] (1) integrating a UbiF gene into the genome of a parent Rhodobacter sphaeroides, thereby obtaining a Rhodobacter sphaeroides intermediate strain; and

[0043] (2) transforming a plasmid vector comprising a RegA gene into the Rhodobacter sphaeroides intermediate strain obtained in step (1), thereby obtaining the Rhodobacter sphaeroides engineering bacteria.

[0044] In some embodiments, the target site for integration of the UbiF gene is the NOLALANC_00703 site in the genome of Rhodobacter sphaeroides, which corresponds to a flagellar basal body MS-ring / rod protein gene. In some embodiments, the UbiF gene is integrated into or upstream or downstream of the flagellar basal body MS-ring / rod protein gene in the genome of the Rhodobacter sphaeroides engineering bacteria. In some preferred embodiments, the UbiF gene is integrated into the genome of the Rhodobacter sphaeroides engineering bacteria within a range of 1000 bp upstream or downstream of the flagellar basal body MS-ring / rod protein gene. In some more preferred embodiments, the UbiF gene replaces the fragment from 1000 bp upstream to 1000 bp downstream of the flagellar basal body MS-ring / rod protein gene. DETAILED DESCRIPTION

[0045] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0046] To facilitate a better understanding of the present disclosure, certain terms are defined first below. Additional definitions for the following terms and other terms are set forth throughout this specification.

[0047] As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise.

[0048] In this document, the terms “comprise(s),” “have(s),” “include(s),” and “contain(s),” are each to be interpreted as open terms (i.e., meaning “including, but not limited to”).

[0049] In this document, “and / or” is used to mean any and all possible combinations of one or more of the associated listed items. For example, the composition comprises A and / or B can be interpreted to mean that the composition comprises A; the composition comprises B; or the composition comprises A and B.

[0050] All numerical names, such as pH, temperature, time, concentration, and molecular weight, including ranges, are approximate values, appropriately varying in increments of 1.0 or 0.1, or optionally changing (+) or (-) by variations of + / - 15%, 10%, 5%, or 2%. It should be understood that all numerical names are preceded by the term "about." It should also be understood that the reagents described herein are exemplary only, and their equivalents are known in the art. When referring to measurable values ​​such as amount or concentration, the term "about" as used herein means a variation within 20%, 10%, 5%, 1%, 0.5%, or 0.1% of the specified amount.

[0051] In this document, the terms “nucleic acid,” “nucleic acid molecule,” “nucleic acid sequence,” “nucleotide sequence,” and “polynucleotide” are used interchangeably and refer to polymeric forms of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Therefore, the term includes, but is not limited to, single-stranded, double-stranded, or mixed-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers comprising, consisting of, or substantially consisting of purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derived nucleotide bases.

[0052] The terms “protein,” “peptide,” “polypeptide,” and “amino acid sequence” are used interchangeably and, in their broadest sense, refer to a polymer of two or more amino acid subunits, amino acid analogs, or peptide mimics. “Protein,” “peptide,” “polypeptide,” and “amino acid sequence” contain at least two amino acids, and there is no limit to the maximum number of amino acids. As used herein, the term “amino acid” refers to natural and / or non-natural or synthetic amino acids, including D and L optical isomers and amino acid analogs.

[0053] Equivalents having one or more amino acid modifications compared to a protein or amino acid sequence described herein are also encompassed within the scope of the present application, provided that the one or more amino acid modifications do not affect or substantially affect the activity of the protein or amino acid sequence. In this context, the amino acid modification can be an amino acid substitution, an amino acid deletion, or an amino acid insertion. The amino acid substitution can be a conservative amino acid substitution or a non-conservative amino acid substitution. A conservative substitution (also referred to as a conservative mutation, conservative replacement, or conservative variation) is an amino acid substitution in a protein that changes a given amino acid to a different amino acid with similar biochemical properties (e.g., charge, hydrophobicity, or size). In this context, a “conservative substitution” refers to the replacement of an amino acid residue by another biologically similar residue. Examples of conservative substitutions include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another; or the substitution of one charged or polar residue such as arginine for lysine, glutamic acid for aspartic acid, glutamine for asparagine, and the like. Other exemplary examples of conservative substitutions include the following changes: alanine to serine; asparagine to glutamine or histidine; aspartic acid to glutamic acid; cysteine to serine; glycine to proline; histidine to asparagine or glutamine; lysine to arginine, glutamine or glutamic acid; phenylalanine to tyrosine, serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and the like.

[0054] The terms “equivalent” or “functional variant” can be used interchangeably when referring to a particular molecule, biological material, or cellular material, and refer to those having minimal homology while retaining the desired structure or function. Non-limiting examples of equivalent polypeptides include polypeptides having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to a reference polypeptide (e.g., a UbiF or RegA protein described herein); or polypeptides encoded by a polynucleotide having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to a reference polynucleotide (e.g., a UbiF gene or RegA gene described herein).

[0055] In this context, “expression” refers to the process by which a nucleic acid sequence is transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, amino acid sequence, or protein. If the nucleic acid sequence is from genomic DNA, expression can include splicing of the mRNA in a eukaryotic cell.

[0056] When the term "encoding" is applied to a nucleic acid sequence, it refers to a nucleic acid sequence which, if in its native state or when manipulated by methods well known to those skilled in the art, can be transcribed to produce mRNA and / or translated to produce a polypeptide. The coding sequence can be deduced from the complement of such a nucleic acid.

[0057] "Homology" or "identity" refers to sequence similarity between two polypeptides or between two nucleic acid sequences. The percent identity can be determined by comparing positions in each sequence, which can be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are identical at that position. A degree of homology between sequences is dependent on the number of matching positions. "Unrelated" or "non-homologous" sequences share less than 40% identity, less than 25% identity with one of the sequences of the present application. Tools for comparing similarity between sequences are well known to those skilled in the art, for example, by importing the nucleic acid or amino acid sequences into ClustalW (available at https: / / genome.jp / tools bin / clustalw / ) and using this ClustalW, the alignment and percent sequence identity of the nucleic acid or amino acid sequences provided herein can be determined.

[0058] The term "promoter" as used herein refers to an expression control sequence that controls initiation and rate of transcription of a gene or transgene. The promoter can be, for example, constitutive, inducible, repressible, or tissue-specific. The promoter can contain genetic elements to which regulatory proteins and molecules such as RNA polymerase and transcription factors can bind.

[0059] The term "relative strength" when applied to a promoter refers to the percentage of the strength of a test promoter compared to the strength of a control promoter (for example, the Tac promoter used in the present application, the strength of which is defined as 100%) in a strain or cell of interest. The strength of a promoter can be determined by methods well known to those skilled in the art. For example, the promoter to be tested can be operably linked to a nucleotide sequence encoding a fluorescent protein, such that the expression of the fluorescent protein is initiated by the promoter to be tested. In this case, the expression level of the fluorescent protein reflects the strength of the promoter to be tested.

[0060] The term "operably linked" or "operatively linked" in the present invention means linkage of nucleic acid sequences such that one sequence is able to provide the function required of the linked sequence. In the present invention, "operably linked" can mean linkage of a promoter to a sequence of interest such that transcription of the sequence of interest is controlled and regulated by the promoter. When the sequence of interest encodes a protein and expression of the protein is desired, "operably linked" means linkage of the promoter to the sequence in such a way that the sequence is able to undergo efficient transcription and translation.

[0061] The term "vector" generally refers to a nucleic acid molecule that is capable of self-replication in a suitable host or that is capable of inserting a gene fragment of interest into the host genome, which transfers the gene fragment of interest carried to a host cell and / or between host cells. The vector can include a vector mainly for inserting DNA or RNA into a cell, a vector mainly for replicating DNA or RNA, and a vector mainly for expression of transcription and / or translation of DNA or RNA. The vector also includes a vector having a plurality of the above functions. The vector can be a polynucleotide that is capable of being transcribed and translated into a polypeptide when introduced into a suitable host cell. Generally, the vector can produce a desired expression product by culturing a suitable host cell containing the vector.

[0062] In this context, the terms "genomic insertion" and "genomic integration" are used interchangeably to mean insertion of an exogenous DNA sequence or a gene fragment of interest into the genome of a target strain.

[0063] In this context, the terms "insertion site" and "integration site" are used interchangeably to mean a target site in the genome into which an exogenous DNA sequence or a gene fragment of interest is inserted.

[0064] In some embodiments, the target site for genomic insertion can be an endogenous gene, and the original endogenous gene coding sequence is disrupted or replaced after insertion of the exogenous DNA. In some embodiments, the upstream and downstream sequences of the endogenous gene remain unchanged. In some embodiments, the upstream and downstream sequences of the endogenous gene can be changed, for example, by changing the upstream and downstream sequences by homologous recombination.

[0065] In some embodiments, the target site for genomic insertion can be upstream or downstream of an endogenous gene, preferably within 1000 bp upstream or downstream. The original endogenous gene coding sequence remains unchanged after insertion of the exogenous DNA.

[0066] As used herein, "genomic insertion overexpression" refers to expression of a target gene in a target strain using a method of integrating an exogenous DNA. In this case, the gene fragment of interest is inserted into the target site of the host cell genome and expressed.

[0067] Methods for inserting an exogenous DNA sequence or a gene fragment of interest into a target site of a genome are well known to those skilled in the art. For example, an exogenous DNA sequence or a gene fragment of interest can be inserted into a target site of a genome by a method of homologous recombination. The homologous recombination process relies on homology between DNA molecules. When homologous recombination is applied, it is often necessary to add an upstream sequence and a downstream sequence having homology with the target integration site, which can also be referred to as homology arms, upstream and downstream of the exogenous DNA sequence or the gene fragment of interest.

[0068] As used herein, "plasmid overexpression" refers to a manner of expressing a target gene in a target strain using a plasmid. In this case, the gene fragment of interest is located on a plasmid that is capable of existing and / or self-replicating in a host cell, without being integrated into the genome of the host cell.

[0069] As used herein, the relative yield of coenzyme Q10 (%) refers to the relative production of coenzyme Q10 in comparison with a parent strain (defined as 100%).

[0070] As used herein, the increased amount of coenzyme Q10 (%) refers to the percentage of increased production of coenzyme Q10 in comparison with the production of coenzyme Q10 of a parent strain, which is defined as 100%.

[0071] In this context, "parent strain" refers to a strain used for modification by means of genetic engineering, etc., and can also be referred to as "starting strain". A strain obtained by modification through rational design or by modification through mutagenesis based on a "parent strain" is referred to as "genetically engineered strain" or "engineered strain".

[0072] In order to make the objects, technical solutions and advantages of the present application clearer, the present application will be further described below in conjunction with specific examples, and the advantages and features of the present application will become more apparent as the description proceeds. It should be understood that these examples are only used to illustrate the present application and not intended to limit the scope of the present application. The experimental methods not specified in the following examples are carried out according to the conventional conditions in the art, for example, the conditions described in Sambrook and Rusself et al., Molecular Cloning: A Laboratory Manual (3rd edition) (2001), CSHL Press, or the conditions recommended by the manufacturer. Unless otherwise specified, the experimental materials and reagents used in the following examples are commercially available.

[0073] Example

[0074] Example 1. Obtaining different strength promoters

[0075] The selection of promoters currently reported in the literature for Rhodobacter sphaeroides is limited, and in order to achieve the regulation of gene expression intensity and thus modify Rhodobacter sphaeroides, this example studies promoters of different strengths in order to facilitate the use of strain construction.

[0076] (1) Promoter selection

[0077] Promoters in Rhodobacter sphaeroides were selected for strength test in this example. The strength of the commonly used promoter Ptac was taken as 100% to calculate the relative strength of each test promoter.

[0078] (2) Plasmid construction

[0079] The plasmid pK18mobsacB was used to construct the integrated expression required vector (purchased from ATCC, #87097) or the plasmid pBBR1MCS2 was used to construct the episomal expression required vector (purchased from Addgene, plasmid #85168).

[0080] When constructing plasmids, the above vectors were used as PCR templates, and the linearized vector DNA fragments were amplified with the following primers:

[0081] Upstream and downstream primers of pK18mobsacB:

[0082] F: TGCCGCAAGCACTC (SEQ ID NO: 67)

[0083] R: ATTGCGTTGCGCTC (SEQ ID NO: 68)

[0084] Upstream and downstream primers of pBBR1MCS2:

[0085] F1: TCATCCCAGGTGGCACTTTTCGGGG (SEQ ID NO: 69)

[0086] R1: ATGTCAGCTACTGGGCTATCTGGAC (SEQ ID NO: 70)

[0087] PCR using High-Fidelity 2X Master Mix was used. The method was as follows: start: 98°C for 30 seconds; cycle 30 times: 98°C for 10 seconds, 57°C for 10 seconds, 72°C for 30 seconds / kb; final extension: 72°C for 30 seconds. After the amplified PCR product was treated with Dpnl for template digestion, AxyPrep PCR clean kit was used for DNA clean-up and recovery, and finally the cleaned DNA fragments were determined for concentration by Nanodrop.

[0088] The same PCR method was used to amplify the linearized DNA of the plasmid insert (such as promoter, terminator, gene). The PCR template was synthesized by Huada Gene.

[0089] Linearized insert and vector DNA fragments were assembled by Gibson assembly (https: / / www.nature.com / articles / nmeth.1318) to insert the relevant gene fragments into the vector, using The HiFi DNA Assembly (NEB E5520S) kit was used to combine different fragments to complete the construction of the target plasmid. The construction method was according to the kit instructions. pBBR1MCS2 was used as the vector, and Dasher GFP was used as the overexpression gene. The [promoter-Dasher GFP-rrnB terminator] expression cassette was constructed in the pBBR1MCS2 vector to obtain a plasmid for testing the strength of each promoter. The nucleotide sequence of Dasher GFP is shown in SEQ ID NO: 71, and the amino acid sequence of the encoded protein is shown in SEQ ID NO: 72. The rrnB terminator is derived from the E. coli rrnB gene, and the nucleotide sequence is shown in SEQ ID NO: 73. The constructed plasmid was identified and verified by sequencing by Huada Gene.

[0090] (3) Mating transformation

[0091] The hemA gene of E. coli S17 strain (ATCC 47055) was knocked out to obtain a hemA-knockout E. coli S17 strain (hereinafter referred to as S17 hemA^). The knocking-out method is described in the literature (Thoma, S., et al. An improved Escherichia coli donor strain for diparental mating. FEMS Microbiol Lett. 2009 May; 294(2): 127-32. https: / / doi.org / 10.1111 / j.1574-6968.2009.01556.x).

[0092] The target plasmid was transformed into S17 hemA^, and the transformation process was as follows: 2 μl of target plasmid was added to 50 μl of S17 hemA^ competent cells, which were then incubated in an ice bath for 30 min and then quickly placed on ice for 2 min after being heated at 42°C. 5-aminolevulinic acid (hereinafter referred to as ALA) was added to 400 μl of SOB medium to form a liquid medium containing 5-aminolevulinic acid at a concentration of 50 μg / ml; the liquid medium was incubated at 37°C for 1 hour. 200 μl of the recovered bacterial solution was transferred to 400 μl of liquid medium containing kanamycin (26 μg / ml) and ALA (50 μg / ml), and incubated at 37°C overnight. On the same day, Rhodobacter strain monoclones were picked into 400 μl of fermentation medium (see (4) Strain culture for detailed formula), and incubated at 30°C at 800 rpm overnight. The preparation method of SOB medium is described at https: / / cshprotocols.cshlp.org / content / 2018 / 3 / pdb.rec102723.full?rss=1.

[0093] The OD600 was measured the next day, and the S17 hemA^ that had been incubated overnight after transformation was washed twice with LB and adjusted to an OD600 of 0.4-0.6 with LB. The Rhodobacter strain NHU5915 (which was classified as Rhodobacter sphaeroides and was deposited with the China General Microbiological Culture Collection Center (CGMCC, No. 1 Xibei West Road, Haidian District, Beijing City) on March 18, 2024, with the accession number CGMCC No. 7.275) was collected by centrifugation and adjusted to an OD660 of 1.5 with LB. The S17 hemA^ and the Rhodobacter strain NHU5915 were mixed at a volume ratio of 1:1 and then diluted and plated onto LB solid plates containing kanamycin (26 μg / ml), and incubated at 30°C for 3-5 days until Rhodobacter strain monoclones appeared and were verified.

[0094] (4) Strain culture medium

[0095] Seed medium (1L): 5g (NH4)2SO4, 1g Ajinomoto monosodium glutamate, 1g corn powder, 1g KH2PO4, 1g K2HPO4, 10g glucose monohydrate, 4g MgSO4·7H2O, 8g CaCO3, 4g NaCl, 2g yeast extract, 2mL trace element stock 1 (0.1g / L CoCl2·6H2O, 3g / L MnSO4·H2O), 2.4g FeSO4·7H2O, and the pH value was adjusted to 6.85-6.9 with 6M NaOH. If necessary, the corresponding antibiotics, such as 25mg kanamycin, were added after sterilization.

[0096] Fermentation medium (1 L): 6 g (NH4)2SO4, 6 g Ajinomoto monosodium glutamate, 4 g corn flour, 1.5 g KH2PO4, 50 g monohydrate glucose, 12.6 g MgSO4·7H2O, 5 g CaCO3, 2.8 g NaCl, 0.5 g yeast extract, 1 mL trace elements stock 2 (7 g / L CaCl2, 5 g / L MnSO4·H2O), 0.2 g FeSO4·7H2O, adjust pH to 6.85-6.9 with 6 M NaOH. If needed, add corresponding antibiotics after sterilization, such as 25 mg kanamycin.

[0097] (5) Fluorescence assay

[0098] Pick the correct Rhodobacter sphaeroides strain monoclonal into 2.2 mL 96-well plate containing 400 μl seed medium (hereinafter referred to as PC plate), and select the corresponding antibiotics according to the strain requirements.

[0099] Place the PC plate in the incubator shaker at 30°C, 1000 rpm, 90% humidity, and culture for three days;

[0100] Transfer 60 μl of bacterial solution to 2.2 mL 96-well plate containing 600 μl of fermentation medium, and incubate in the incubator shaker at 30°C, 1000 rpm, 90% humidity, and culture for four days;

[0101] Transfer 10 μl of bacterial solution to 190 μl of enzyme-labeled plate containing 190 μl of sterile water, and mix well;

[0102] Place the enzyme-labeled plate in the BioTek spectrometer to measure the OD660 and fluorescence intensity. For DasherGFP, the parameter settings are excitation 485 nm and emission 528 nm.

[0103] (6) Experimental results

[0104] By detecting the expression intensity of the fluorescent protein started by each promoter, and taking the commonly used strong promoter Tac promoter (SEQ ID NO: 74) as a control to calculate the relative strength of each promoter, the results are shown in Table 1.

[0105] Table 1. Relative strength of test promoters relative to Tac promoter

[0106]

[0107]

[0108] Example 2. Overexpression of UbiF by genomic insertion to improve Rhodobacter sphaeroides coenzyme Q10 production

[0109] NOLALANC_00703 site was selected as the integration site of UbiF expression cassette, which corresponds to the gene encoding flagellar basal-body MS-ring / collar protein, the coding sequence of which is shown as SEQ ID NO: 5, and the encoded amino acid sequence is shown as SEQ ID NO: 6. The sequence 1000 bp upstream of the gene is shown as SEQ ID NO: 7, and the sequence 1000 bp downstream of the gene is shown as SEQ ID NO: 8.

[0110] (1) Plasmid construction

[0111] The vector is described in Example 1.

[0112] In this example, pK18mobsacB was used as the vector, T334-6 promoter was selected, and the [homologous arm 1-promoter-UbiF-rrnB terminator-homologous arm 2] expression cassette was constructed into the vector by Gibson assembly method, which was used to transform Rhodobacter sphaeroides strain NHU5915 and determine the coenzyme Q10 yield. The UbiF gene is derived from E. coli, the nucleic acid sequence of which is shown as SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO: 2. The sequence of T334-6 promoter is shown as SEQ ID NO: 10. The rrnB terminator is derived from E. coli rrnB gene, the nucleic acid sequence of which is shown as SEQ ID NO: 73. The homologous arm 1 is the 1000 bp upstream of the flagellar basal-body MS-ring / collar protein gene, the nucleotide sequence of which is shown as SEQ ID NO: 7, and the homologous arm 2 is the 1000 bp downstream of the flagellar basal-body MS-ring / collar protein gene, the nucleotide sequence of which is shown as SEQ ID NO: 8.

[0113] (2) Conjugation transformation

[0114] The same as Example 1.

[0115] (3) Strain culture

[0116] The same as Example 1.

[0117] (4) Coenzyme Q10 determination

[0118] ① Instruments:

[0119] Agilent 1290 infinity II UHPLC System with DAD.

[0120] Centrifuge (Eppendorf, 5810R; Thermo, Multifuge X pro)

[0121] Oscillator (OHRUS and DM)

[0122] 2) Column:

[0123] Thermo Scientific Hypersil ODS (C18) Column, 2.1x150 mm, 3 pm Cat#30103-152130

[0124] 3) Chemicals:

[0125] CoQ10

[0126] Ethanol (EtOH), Sigma-Aldrich,

[0127] Methanol (MeOH), Sigma-Aldrich

[0128] Isopropanol (IPA), Sinopharm,

[0129] 4) Consumables

[0130] 2 mL vials, Agilent

[0131] 50 mL ampoule volumetric flask, thermo

[0132] 96-well deep well plate, A-gen

[0133] Microplate, 0.5 mL, U, Agilent

[0134] 5) Method

[0135] Standard preparation

[0136] 1) Weigh 25.00 mg of Coenzyme Q10 and 25.00 mg of 4-hydroxybenzoic acid into a 50 mL ampoule.

[0137] 2) Dilute to volume with isopropanol (IPA).

[0138] Calibration standard preparation

[0139] Dilute the standard to 10, 50, 100, 200, 300, 500 ppm with IPA. Transfer to injection vials.

[0140] Sample preparation

[0141] Transfer 100 μL of Rhodopseudomonas spp. culture to each well of a 96-well deep plate. Add 500 μL of IPA to each well. Shake at 2000 rpm for 20 minutes. Then shake on a shaker at 40°C and 800 rpm for 90 minutes. For fermentation samples, centrifuge at 6000 rpm for 10 minutes. Transfer 200 μL to a 0.5 mL Agilent microplate.

[0142] Analytical methods

[0143] Mobile phase B1: 1:1 EtOH / MeOH

[0144] Mobile phase A1: H2O

[0145] Injection volume 2 μl

[0146] Pump cleaning: 10% IPA

[0147] Needle cleaning: 75% IPA

[0148] Column temperature: 55℃

[0149] Flow rate: 0.55 ml / min

[0150] Wavelengths: 275nm and 256nm

[0151] Table 2. Gradient Dilution

[0152] Time (min) 0.5 A1(％) B1(％) 0 90 10 0.2 90 10 0.5 0 100 2 0 100 2.01 90 10 3 90 10

[0153] (5) Experimental Results

[0154] The constructed genome-integrating plasmid was transformed into the Rhodotorula globosum strain NHU5915 (parental strain) to obtain strain Bota20101 [NOLALANC_00703::pT334-6>UbiF_TrrnB]. The coenzyme Q10 production of Bota20101 and NHU5915 was tested and compared. The results showed that the coenzyme Q10 production of Bota20101 reached 172% of that of NHU5915, indicating that inserting UbiF into the genome of a coenzyme Q10-producing parental strain (e.g., inserting it at the NOLALANC_00703 site) can effectively increase coenzyme Q10 production (results are shown in Table 3).

[0155] Table 3. Effect of genome insertion overexpression of UniF on coenzyme Q10 production

[0156]

[0157] The strain Bota20101 is classified as Rhodobacter sphaeroides and was deposited with the China General Microbiological Culture Collection Center (CGMCC, No. 1 Yard, Beichen West Road, Chaoyang District, Beijing) on April 1, 2024, and was assigned accession number CGMCC No. 30221.

[0158] Example 3. Increasing the production of coenzyme Q10 in Rhodobacter sphaeroides by overexpressing RegA via a plasmid

[0159] This example uses the endogenous promoter of RegA or the NOLALANC_04400 promoter to overexpress RegA via a plasmid in the genetically engineered coenzyme Q10-producing strain Bota20101 and tests the effect on the production of coenzyme Q10.

[0160] (1) Target plasmid construction

[0161] The plasmid used in this example was constructed using pBBR1MCS2 (purchased from Addgene, plasmid #85168). The linearized vector DNA fragment was amplified using pBBR1MCS2 as the PCR template and the following primers:

[0162] Upstream and downstream primers for pBBR1MCS2

[0163] F2: GGATCGGTTGTCGAGTAAG (SEQ ID NO: 75)

[0164] R2: ATTGCGTTGCGCTC (SEQ ID NO: 76)

[0165] The remaining methods were the same as in Example 1. The plasmid numbers and information constructed are shown in Table 4.

[0166] Table 4. Plasmid information

[0167]

[0168]

[0169] Note: The coordinates within brackets "[]" in RegA[-775S:275E] refer to the upstream and downstream sequences relative to the RegA gene. "S" represents the start position of the RegA gene coding sequence, and "E" represents the end position. A negative sign "-" indicates upstream, and no negative sign indicates downstream. In RegA[-775S:275E], -775S refers to 775bp upstream (-775) of the start position (S) of the RegA gene coding sequence. 275E refers to 275bp downstream (275) of the end position (E) of the RegA gene coding sequence. Therefore, the overall meaning of RegA[-775S:275E] is "a DNA sequence that begins 775 bp upstream (-775) of the start position (S) of the RegA gene coding sequence and terminates 275 bp downstream (275) of the end position (E) of the RegA gene coding sequence." This sequence contains the endogenous promoter and terminator of the RegA gene, as shown in SEQ ID NO:77. The RegA overexpressed by plasmid pRSA1012 is the wild-type RegA gene, as shown in SEQ ID NO:3.

[0170] (2) Conjugation transformation

[0171] Same as Example 1.

[0172] (3) Straw culture

[0173] Same as Example 1.

[0174] (4) Coenzyme Q10 assay

[0175] Same as Example 2.

[0176] (5) Experimental Results

[0177] The results of the coenzyme Q10 yield determination are shown in Table 5. As can be seen from Table 5, the effect of RegA expression using the endogenous promoter on increasing coenzyme Q10 yield is limited, increasing it by only 8%. Using the NOLALANC_04400 promoter resulted in a greater than 6-fold increase in coenzyme Q10 yield. The effect of the NOLALANC_04400 promoter is significantly higher than that of using the endogenous promoter.

[0178] Table 5. Effect of plasmid overexpression of RegA on increasing coenzyme Q10 production

[0179]

[0180] Therefore, it can be seen that overexpressing UbiF by inserting it into the genome and combining it with plasmid overexpression of RegA can significantly increase the yield of coenzyme Q10 in Rhodopseudomonas spp. The obtained strain has good application prospects in the industrial-scale production of coenzyme Q10.

[0181] The strain Bota20102 is classified as Rhodobacter sphaeroides, and was preserved in China General Microbiological Culture Collection Center (CGMCC, No. 1, Xibaheyanli 3th Courtyard, Chaoyang District, Beijing) on April 1, 2024, with the preservation number of CGMCC No. 30222.

[0182] While the application has been described with reference to specific implementations thereof, it should be understood by those skilled in the art that various changes can be made and equivalents can be substituted without departing from the true spirit and scope of the application. In addition, many modifications can be made to adapt a particular situation, material, composition of matter, process steps or steps thereof, to the objective, spirit and scope of the application. All such modifications are intended to be within the scope of the claims.

[0183]

[0184]

[0185]

[0186]

[0187]

[0188]

[0189]

[0190]

[0191]

[0192]

[0193]

Claims

1. A type of Rhodococcus ( Rhodobacter sphaeroides The engineered bacteria, namely the Rhodotorula globulus engineered bacteria, are modified to express the exogenous UbiF gene and RegA gene, wherein: The exogenous UbiF gene is integrated into the genome of the engineered Rhodotorula globulus, and the RegA gene is expressed via a plasmid vector; The exogenous UbiF gene is the UbiF gene of Escherichia coli.

2. The engineered Rhodotorula globulus of claim 1, wherein the UbiF gene is expressed by a strong promoter, the strong promoter having a relative strength of at least 70% relative to the Tac promoter in the engineered Rhodotorula globulus.

3. The engineered Rhodotorula globulus of claim 2, wherein the strong promoter has a relative strength of at least 80% relative to the Tac promoter in the engineered Rhodotorula globulus.

4. The engineered Rhodotorula globulus of claim 2, wherein the strong promoter has a relative strength of at least 90% relative to the Tac promoter in the engineered Rhodotorula globulus.

5. The engineered Rhodotorula globulus of claim 2, wherein the strong promoter has a relative strength of at least 100% relative to the Tac promoter in the engineered Rhodotorula globulus.

6. The engineered Rhodopseudomonas spp. of claim 1, wherein the exogenous UbiF gene is expressed by a promoter selected from the following: T334-6 as shown in SEQ ID NO: 10, T334-36 as shown in SEQ ID NO: 9, NOLALANC_02773 as shown in SEQ ID NO: 11, T167-31 as shown in SEQ ID NO: 12, NOLALANC_02328 as shown in SEQ ID NO: 13, T334-7 as shown in SEQ ID NO: 14, NOLALANC_02693 as shown in SEQ ID NO: 15, T167-27 as shown in SEQ ID NO: 16, T167-29 as shown in SEQ ID NO: 17, and T334-26 as shown in SEQ ID NO:

18.

7. The engineered Rhodotorula globulus of claim 1, wherein the RegA gene is the RegA gene of Rhodotorula globulus.

8. The engineered Rhodotorula glomeratus of claim 1, wherein the RegA gene is expressed by a weak promoter, the weak promoter having a relative strength of up to 40% relative to the Tac promoter in the engineered Rhodotorula glomeratus.

9. The engineered Rhodotorula globulus of claim 8, wherein the weak promoter has a relative strength of up to 30% relative to the Tac promoter in the engineered Rhodotorula globulus.

10. The engineered Rhodotorula globulus of claim 8, wherein the weak promoter has a relative strength of up to 20% relative to the Tac promoter in the engineered Rhodotorula globulus.

11. The engineered Rhodotorula globulus of claim 8, wherein the weak promoter has a relative strength of up to 10% relative to the Tac promoter in the engineered Rhodotorula globulus.

12. The engineered Rhodopseudomonas spp. of claim 1, wherein the RegA gene is expressed by a promoter selected from the following: NOLALANC_04400 as shown in SEQ ID NO: 60, NOLALANC_03111 as shown in SEQ ID NO: 55, NOLALANC_00059 as shown in SEQ ID NO: 56, NOLALANC_01751 as shown in SEQ ID NO: 57, NOLALANC_03340 as shown in SEQ ID NO: 58, NOLALANC_03519 as shown in SEQ ID NO: 59, NOLALANC_03841 as shown in SEQ ID NO: 61, NOLALANC_03925 as shown in SEQ ID NO: 62, NOLALANC_03961 as shown in SEQ ID NO: 63, NOLALANC_01082 as shown in SEQ ID NO: 64, etc. NOLALANC_01569 as shown in SEQ ID NO: 65 and NOLALANC_02822 as shown in SEQ ID NO:

66.

13. The engineered Rhodotorula glomeratus of claim 1, wherein the exogenous UbiF gene is integrated into the flagellar matrix MS-loop / loop protein gene site in the genome of the engineered Rhodotorula glomeratus.

14. The engineered Rhodotorula globosum of claim 13, wherein the exogenous UbiF gene is integrated into the flagellar matrix MS-loop / loop protein gene or within 1000 bp upstream or downstream thereof.

15. The engineered Rhodotorula globosum of claim 13, wherein the exogenous UbiF gene replaces a 1000bp upstream to 1000bp downstream segment of the flagellar matrix MS-loop / loop protein gene.

16. The engineered Rhodotorula globulus of any one of claims 1-15, wherein the plasmid vector used to express the RegA gene is the pBBR1MCS2 vector.

17. An engineered Rhodotorula globulinii strain, with accession number CGMCC No. 30222.

18. A method for preparing coenzyme Q10, the method comprising: (1) Cultivate the engineered Rhodotorula glomeratum of any one of claims 1-17 under conditions suitable for producing coenzyme Q10; (2) Coenzyme Q10 was recovered from the culture of the engineered Rhodotorula globulus.

19. Use of the engineered Rhodotorula globulus strain of any one of claims 1-17 in the production of coenzyme Q10.

20. A method for preparing the engineered Rhodophyton floccosum of any one of claims 1-17, the method comprising: (1) The exogenous UbiF gene was integrated into the genome of the parental Rhodotorula glomeratus to obtain an intermediate strain of Rhodotorula glomeratus; and (2) Transform the plasmid vector containing the RegA gene into the intermediate strain of Rhodotorula glomeratus obtained in step (1) to obtain the engineered Rhodotorula glomeratus strain; The exogenous UbiF gene is the UbiF gene of Escherichia coli.

Images