Primer set and method for SMN gene amplification and copy number detection

By designing the amplification-blocking primer and internal labeling system, the non-specific amplification problem when distinguishing SMN1 and SMN2 genes is solved, and efficient and low-cost gene copy number detection is achieved, improving the accuracy and sensitivity of the detection.

CN118374587BActive Publication Date: 2025-08-19GUANGZHOU JINGKE BIOTECH CO LTD +2
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202410236484.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-03-01
Publication Date
2025-08-19
Estimated Expiration
2044-03-01

AI Technical Summary

Technical Problem

The prior art has nonspecific amplification problems when distinguishing SMN1 and SMN2 genes, especially when there are only individual base differences in the detection, resulting in low detection accuracy, and the existing methods are complex in operation and high in cost, making it difficult to achieve efficient and low-cost accurate identification.

Method used

A primer set is designed, including amplification-blocking primers, by introducing specific base differences and base modifications at the 3' end of the primer, combining a zigzag structure and an internal labeling system, improving amplification specificity, and achieving target gene copy number detection through detection probes.

Benefits of technology

It significantly reduces non-specific amplification, improves the accuracy and sensitivity of SMN1 and SMN2 gene quantification, reduces detection cost, shortens reaction time, and the specificity and accuracy of the detection results reach more than 99%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118374587B_ABST
    Figure CN118374587B_ABST
Patent Text Reader

Abstract

The present invention discloses a primer set and method for SMN gene amplification and copy number detection. The primer set includes an upstream primer and a downstream primer, one of which is an amplification-blocking primer. The amplification-blocking primer includes a first part and a second part. The first part is an amplification part, which guides base synthesis after complementary binding with the target gene. Its 3' end base is modified and cannot synthesize bases, triggering template amplification; the second part is a sequence that can form annealing complement with the blocking primer, which is shorter than the first part. The first part and the second part are connected by a spacer. At the annealing temperature, the amplification primer and the blocking primer form a zigzag structure and bind to their respective target genes. The amplification primer binds to the target gene to trigger amplification extension, and the blocking primer binds to the non-target sequence to block the extension of the non-target sequence, greatly preventing the amplification of very similar non-target sequences. With the help of an internal labeling system, copy number detection of the target gene can also be completed.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a primer set and method for SMN gene amplification and copy number detection. Background Art

[0002] Spinal muscular atrophy (SMA) is an autosomal recessive neurodegenerative disease caused by degeneration of the anterior horn of the spinal cord and alpha motor neurons. Clinical manifestations include progressive, symmetrical muscle weakness and atrophy, primarily affecting the proximal limbs. SMA is categorized into types I to IV based on onset and clinical phenotype. Patients vary widely in phenotype, with symptoms including decreased muscle tone, hyporeflexia, difficulty sucking, swallowing, and breathing, growth retardation, and, in severe cases, death in early childhood. Approximately 95% of SMA cases are caused by homozygous deletions in exon 7 of the SMN1 gene, while the remainder often harbor compound heterozygous variants or minor biallelic variants.

[0003] Currently, the main genetic diagnostic techniques used clinically for SMA include denaturing high-performance liquid chromatography (PCR-DHPLC), polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), multiplex ligation-dependent probe amplification (MLPA), and real-time quantitative PCR. PCR-DHPLC can detect both heterozygous and homozygous SMN1 exon 7 deletion carriers, but it has low throughput, is complex and time-consuming, and requires specialized instrumentation. PCR-RFLP can only qualitatively detect homozygous SMN1 exon 7 deletion carriers and cannot distinguish between heterozygous and normal individuals. This method is significantly affected by enzyme digestion, potentially leading to missed or misdiagnosed cases due to incomplete digestion. MLPA can also be used to detect both heterozygous and homozygous deletion carriers, but it requires manual labor, is time-consuming, and has low throughput. The instrumentation required for experimental operation carries the risk of contamination. Furthermore, the reagents are primarily manufactured abroad and are expensive, and the instrumentation required for interpreting the results is also expensive, resulting in a high cost for this type of testing. Compared to the methods described above, real-time fluorescence quantitative PCR offers advantages such as high specificity, rapid speed, high throughput, high sensitivity, and the use of a blocking reaction. However, the SMN1 and SMN2 genes are highly homologous, differing only in a few bases within exon 7. Conventional qPCR has difficulty distinguishing and amplifying two fragments that differ by only a single base. Consequently, experimental results often fail to avoid nonspecific amplification of the SMN2 gene. In particular, the influence of multiple copies of the SMN2 gene on the relative quantification of the SMN1 gene affects the accuracy of SMN1 detection.

[0004] In practical applications, it is common to need to identify or differentially amplify a single base. This is especially challenging when it comes to differentially amplifying sequences like those in the SMN1 and SMN2 genes, which differ by only a single digit. Therefore, it is essential to design a simple, easy-to-use, and cost-effective system that can accurately identify sequences with differences at a single site. Summary of the Invention

[0005] The object of the present invention is to overcome at least one deficiency of the prior art and to provide a primer set and method for SMN gene amplification and copy number detection.

[0006] The technical solution adopted by the present invention is:

[0007] The first aspect of the present invention provides: a primer set for SMN gene amplification, comprising an upstream primer and a downstream primer, one of the upstream primer and the downstream primer being an amplification-blocking primer, the amplification-blocking primer comprising a first part and a second part, wherein: the first part is an amplification part, which guides base synthesis after complementary binding with the target gene and triggers template amplification; the second part is a sequence that can form an annealing complement with the blocking primer, which is shorter than the first part, and the first part and the second part are connected by a spacer.

[0008] Amplification-blocking primers are amplification primers for target genes, but cannot cause amplification of non-target genes and are blocking primers.

[0009] There is no special requirement for the spacer. It is used to link the first and second sequences. Common ones are straight carbon chains or ethylene glycol.

[0010] The inability to synthesize bases means that the bases used lack the necessary structure for synthesizing bases and cannot be synthesized, thereby blocking the amplification of non-target sequences.

[0011] Primers used in pair with the amplification-retardation primers can be designed according to conventional methods.

[0012] In some examples of primer sets, the length of the first portion of the amplification-retardation primer is 16 to 28 bases.

[0013] In some examples of primer sets, the second portion of the amplification-retardation primer is 8 to 15 bases long.

[0014] In some examples of primer sets, the length of the first portion of the amplification-retardation primer is 16 to 28 bases, and the length of the second portion of the amplification-retardation primer is 8 to 15 bases.

[0015] In some examples of primer sets, a base different from both the target and non-target genes is introduced at positions 2 to 5 from the 3' end of the first part of the amplification-retardation primer. For example, if the target sequence base is A and the non-target sequence base is T, the primer at that position should be T, but it may be designed to be G or C. By introducing a base different from both the target and non-target genes, greater steric resistance is introduced.

[0016] In some examples of primer sets, a C base, different from the bases in both the target gene and non-target genes, is introduced at bases 2 to 5 from the 3' end of the first part of the amplification-blocking primer. Experiments have shown that C has the greatest steric resistance and has better detection effect.

[0017] In some examples of primer sets, the second portion of the amplification-blocking primer is not homologous to the genome to be detected, which is beneficial for improving the specificity of amplification.

[0018] In some examples of primer sets, the free end of the second portion of the amplification-retarding primer has a base modification, rendering this end unable to initiate base synthesis. The modified base is a commonly used amplification-retarding primer in the art, and modifications include but are not limited to C3, C6, etc.

[0019] In some examples of primer sets, the second part of the amplification-retardation primer is not homologous to the genome to be detected, and the free end of the second part of the amplification-retardation primer has a base modification, so that this end cannot trigger base synthesis.

[0020] In some examples of primer sets, the length of the first portion of the blocking primer is 15 to 25 bases.

[0021] In some examples of primer sets, a detection probe is also included.

[0022] In some examples of primer sets, a detection probe, an internal labeling probe, and an internal reference gene primer are also included.

[0023] In some examples of primer sets, for detecting exon 7 of the SMN1 gene, the primer set includes SMN1-7-F: G AAACCCTGT- Spacer -CTTCCTTTATTTTCCTTACAGGG C TTC (amplification-blocking primer, bases that are different from those in both target and non-target genes are underlined) and SMN1-7-R: TTCACTTTCATAATGCTGGCAG.

[0024] In some examples of primer sets for detecting SMN1 gene exon 7, the detection probe SMN1-7-P:VIC-GGAAGGTGCTCACATTCCTTA-MGB is also included. The fluorescent group and quencher group at both ends of the probe can be replaced with other well-known fluorescent groups and quencher groups.

[0025] In some examples of primer sets, for detecting exon 7 of the SMN2 gene, the primer set includes SMN2-7-F: G AAACCCTGT- Spacer -CTTCCTTTATTTTCCTTACAGGG C TTT (amplification-retardation primer, the underlined bases are different from those of both target and non-target genes) and SMN2-7-R: TTCACTTTCATAATGCTGGCAG.

[0026] In some examples of primer sets, for detecting exon 7 of the SMN2 gene, the primer set also includes a detection probe SMN2-7-P: VIC-GGAAGGTGCTCACATTCCTTA-MGB.

[0027] In some examples of primer sets, the internal reference gene is β-actin, and the primers include ACTB-F: CGGACTCGTCATACTCCTGCTTG, ACTB-R: TCCCCTTCCCTCCTCAGAT, and the internal label probe ACTB-P: CY5-CACATCTGCTGGAAGGTGG-MGB. The fluorescent group and quencher groups at both ends of the probe can be replaced with other well-known fluorescent groups and quenchers.

[0028] The fluorophores of the detection probe and the internal labeling probe should be different so that the corresponding signals can be detected separately.

[0029] The second aspect of the present invention provides: a kit for SMN gene detection, comprising a PCR reaction solution and the primer set described in the first aspect of the present invention.

[0030] The third aspect of the present invention provides:

[0031] A method for detecting the SMN gene comprises the following steps:

[0032] Obtaining DNA from the sample to be tested;

[0033] Amplifying the sample DNA using the primer set described in the first aspect of the present invention;

[0034] The amplified products were tested to determine the SMN gene test results.

[0035] A fourth aspect of the present invention provides:

[0036] The primer set described in the first aspect of the present invention is used in SMN gene amplification and copy number detection.

[0037] The beneficial effects of the present invention are:

[0038] In some examples of the present invention, primer sets for SMN gene amplification are used. At the annealing temperature, the double strands of the amplification primer and the blocking primer open, the primers fold themselves into a Z-shaped structure, and bind to their respective target genes. The amplification primer binds to the target gene to trigger amplification extension, while the blocking primer binds to non-target sequences to block the extension of the non-target sequences. This can not only greatly prevent the amplification of very similar non-target sequences, but also, with the assistance of an internal labeling system, can complete the copy number detection of the target gene.

[0039] Some examples of the present invention use primer sets for SMN gene amplification, overcoming the problem of amplification primers potentially inducing nonspecific amplification when the detection system contains sequences highly similar to the sequence to be detected. The primer-modifying group at the 3' end of the primer significantly increases the resistance to amplification of non-target sequences. The binding of the blocking primer to the non-target sequence further reduces nonspecific binding and amplification, resulting in high amplification specificity. Furthermore, the complementary sequences of the amplification primer and the blocking primer bring the two primers closer together, allowing for complementary annealing. Within a small space, the target sequence, non-target sequence, amplification primer, and blocking primer all coexist. Consequently, the amplification primer must bind to the target sequence, while the blocking primer must bind to the non-target sequence. This further enhances the specificity of target gene amplification. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is the detection result of a sample of human SMN1 gene copy number detected by real-time fluorescence in Example 1.

[0041] Figure 2 This is the detection result of a sample of human SMN2 gene copy number detected by real-time fluorescence in Example 2. DETAILED DESCRIPTION

[0042] The technical solution of the present invention is further illustrated below with reference to examples.

[0043] Example 1: Real-time fluorescence detection of human SMN1 gene copy number

[0044] A primer amplification system was designed for the SMN1 gene to perform real-time quantitative detection of SMN1 gene copy number.

[0045] 1. Sample DNA extraction and concentration determination:

[0046] The subjects' peripheral EDTA-anticoagulated venous whole blood was used to extract genomic DNA using a human genome extraction kit, and the concentration and purity were measured using an ultraviolet spectrophotometer to ensure that the quality of the extracted genome was qualified.

[0047] 2. Primer and probe design:

[0048] 2.1 Gene detection site selection and primer design:

[0049] Using a single base difference (C→T) in exon 7 of the SMN1 and SMN2 genes, the first primer segment was designed with this position as the 3' end. The first segment was 25-27 bp in length, with the terminus perfectly matching the SMN1 gene. A mismatch was added at the fourth position from the 3' end, and the second segment was designed to be 10 bp. The first and second segments were connected by a spacer. The internal reference gene was β-actin, and primer probes were designed within its highly conserved region.

[0050] 2.2 Primer and probe sequences:

[0051] The primers and probes for the target genes and internal reference genes are shown in Table 1.

[0052] Table 1

[0053]

[0054] 2.3 Amplification detection reaction system: The specific reaction system is shown in Table 2.

[0055] Table 2

[0056]

[0057] 3. Amplification Detection Reaction Conditions

[0058] Denaturation was performed at 95°C for 5 min, followed by 40 cycles of 95°C for 15 s and 60°C for 30 s. During each cycle, the PCR instrument collected VIC (target gene) and CY5 fluorescence (reference gene) in real time at 60°C.

[0059] 4. Result Analysis and Copy Number Quantification

[0060] The relative quantitative result analysis adopts the ΔΔCt value method, which is based on the logarithmic linear relationship between the Ct value of each template and the starting copy number of the template. The more the starting copy number, the smaller the Ct value. This method simultaneously amplifies the target gene fragment and the internal reference gene fragment, and measures the difference in the Ct values of the two, that is, ΔCt. By comparing the changes in the ΔCt values of different test samples with the ΔCt values of the control samples, the relative expression of the genes in the unknown samples can be judged, and the copy number of the unknown samples can be analyzed. In normal human samples, both the target gene and the internal reference gene have 2 copies. During quantitative detection, the ΔCt values of the two genes are constant, and ΔΔCt is 0. At this time, 2 -ΔΔCt The value is 1; if the sample target gene is missing one copy, the CT value increases by 1, the corresponding ΔCt value also increases by 1, and the ΔΔCt is also 1. The calculated 2 -ΔΔCt The value is 0.5; if both target genes are missing in the sample, there will be no target gene amplification. This method can be used to directly analyze the copy number of the SMN1 gene, achieving accurate detection of the SMN1 gene copy number.

[0061] The relative quantitative analysis and judgment are shown in Table 3.

[0062] Table 3

[0063]

[0064] 5. Interpretation and Analysis of Results

[0065] Adjust the baseline: start = 3, end = 18-22 (usually set automatically or manually at the cycle before the inflection point of the amplification curve to maintain consistency in the amplification efficiency of the target gene and the internal standard gene).

[0066] Adjust the threshold: Set thresholds for SMN1 (VIC) and β-actin (CY5) separately. The threshold range for each channel is: VIC: 0.4-0.6, CY5: 0.6-0.8. Due to instrument deviations in clinical practice, the fluorescence intensity of each channel may vary. You can adjust the threshold according to your experimental conditions.

[0067] If 2 -ΔΔCt The values are 0.25 and 0.75, which are critical values and need to be retested.

[0068] 6. Clinical Sample Experiments and Analysis

[0069] The reagent of the present invention was used to test 50 clinical samples (numbered 1-50 in sequence), and the MLPA reagent was used for comparative testing. The test results are shown in Table 4.

[0070] Table 4

[0071]

[0072] As shown in Table 4, the test results using the reagent of the present invention are completely consistent with the MLPA test results, with an accuracy rate of 100%. The results of one sample are shown in Figure 1.

[0073] Example 2: Real-time fluorescence detection of human SMN2 gene copy number

[0074] A primer amplification system was designed for the SMN2 gene to perform real-time quantitative detection of SMN2 gene copy number.

[0075] 1. Sample DNA extraction and concentration determination:

[0076] The subjects' peripheral EDTA-anticoagulated venous whole blood was used to extract genomic DNA using a human genome extraction kit, and the concentration and purity were measured using an ultraviolet spectrophotometer to ensure that the quality of the extracted genome was qualified.

[0077] 2. Primer and probe design:

[0078] 2.1 Gene detection site selection and primer design:

[0079] Using a single base difference (C→T) in exon 7 of the SMN1 and SMN2 genes, the first primer segment was designed with this position as the 3' end. The first segment was 25-27 bp in length, with the terminus perfectly matching the SMN1 gene. A mismatch was added at the fourth position from the 3' end, and the second segment was designed to be 10 bp. The first and second segments were connected by a spacer. The internal reference gene was β-actin, and primer probes were designed within its highly conserved region.

[0080] 2.2 Primer and probe sequences: The primer and probe sequences for the target gene and internal reference gene are shown in Table 5.

[0081] Table 5

[0082]

[0083] 2.3 Amplification detection reaction system: The specific reaction system is shown in Table 6.

[0084] Table 6

[0085]

[0086] 3. Amplification Detection Reaction Conditions

[0087] Denaturation was performed at 95°C for 5 min, followed by 40 cycles of 95°C for 15 s and 60°C for 30 s. During each cycle, the PCR instrument collected VIC (target gene) and CY5 fluorescence (reference gene) in real time at 60°C.

[0088] 4. Result Analysis and Copy Number Quantification

[0089] The relative quantitative result analysis adopts the ΔΔCt value method, which is based on the logarithmic linear relationship between the Ct value of each template and the starting copy number of the template. The more the starting copy number, the smaller the Ct value. This method simultaneously amplifies the target gene fragment and the internal reference gene fragment, and measures the difference in the Ct values of the two, that is, ΔCt. By comparing the changes in the ΔCt values of different test samples with the ΔCt values of the control samples, the relative expression of the genes in the unknown samples can be judged, and the copy number of the unknown samples can be analyzed. In normal human samples, both the target gene and the internal reference gene have 2 copies. During quantitative detection, the ΔCt values of the two genes are constant, and ΔΔCt is 0. At this time, 2 -ΔΔCt The value is 1; if the sample target gene is missing one copy, the CT value increases by 1, the corresponding ΔCt value also increases by 1, and the ΔΔCt is also 1. The calculated 2 -ΔΔCt The value is 0.5; if both target genes are missing in the sample, there will be no target gene amplification. This method can be used to directly analyze the copy number of the SMN1 gene, achieving accurate detection of the SMN1 gene copy number.

[0090] The relative quantitative analysis and judgment are shown in Table 7.

[0091] Table 7:

[0092]

[0093] 5. Interpretation and Analysis of Results

[0094] Adjust the baseline: start = 3, end = 18-22 (usually set automatically or manually at the cycle before the inflection point of the amplification curve to maintain consistency in the amplification efficiency of the target gene and the internal standard gene).

[0095] Adjust the threshold: Set thresholds for SMN2 (VIC) and β-actin (CY5) separately. The threshold range for each channel is: VIC: 0.4-0.6, CY5: 0.6-0.8. Due to instrument deviations in clinical practice, the fluorescence intensity of each channel may vary. You can adjust the threshold according to your experimental conditions.

[0096] If 2 -ΔΔCt The values are 0.25 and 0.75, which are critical values and need to be retested.

[0097] 6. Clinical Sample Experiments and Analysis

[0098] Five clinical samples (numbered 1-5 in sequence) were tested using the reagent of the present invention. The test results are shown in Table 8, and the result of one of the samples is shown in Figure 2.

[0099] Table 8:

[0100]

[0101] In summary:

[0102] The present invention uses the aforementioned primer pairs and Taqman probes to accurately quantify the copy numbers of the SMN1 and SMN2 genes, clearly differentiating SMA carriers, patients, and healthy individuals. For patients with homozygous SMN1 deletions, SMN2 copy number analysis allows for classification into four patient types, enabling targeted treatment and timely intervention.

[0103] This method not only significantly reduces nonspecific amplification and improves the accuracy of SMN1 and SMN2 gene quantification, but also enhances detection sensitivity. Sample DNA input can be as low as 2 ng, significantly reducing DNA input compared to MLPA. The reaction time is approximately 1.5 hours, which is approximately 20 hours shorter than MLPA, significantly reducing reaction time. The specificity and accuracy of the test results exceed 99%, with 50 clinical samples showing consistent results with MLPA.

[0104] The above is a further detailed description of the present invention and should not be considered as a limitation on the specific implementation of the present invention. For those skilled in the art, simple deductions or substitutions that do not depart from the concept of the present invention are within the scope of protection of the present invention.

Claims

1. A primer set for SMN gene amplification, comprising an upstream primer and a downstream primer, characterized in that: One of the upstream primer and the downstream primer is an amplification-retardation primer, and the amplification-retardation primer includes a first part and a second part, and the first part and the second part are connected by a spacer, wherein: The first part is the amplification part, which guides base synthesis after complementary binding with the target gene and triggers template amplification. The length of the first part of the amplification-blocking primer is 16 to 28 bases. From the 3' end to the 5' end of the first part of the amplification-blocking primer, a base C different from the bases of the target gene and non-target genes is introduced at the position of the 2nd to 5th base; The second part is a sequence that can form annealing complementarity with the blocking primer, and its length is shorter than the first part. The length of the second part of the amplification-blocking primer is 8 to 15 bases. The second part of the amplification-blocking primer is not homologous to the genome to be detected. The free end of the second part of the amplification-blocking primer is base-modified, so that this end cannot trigger base synthesis. At the annealing temperature, the double strands of the amplification primer and the blocking primer are opened, and the primers themselves fold to form a Z-shaped structure and bind to their respective target genes. The amplification primer binds to the target gene to trigger amplification extension, and the blocking primer binds to the non-target sequence to block the extension of the non-target sequence.

2. The primer set according to claim 1, characterized in that The primer set is used to detect exon 7 of the SMN1 gene, and the primer set includes SMN1-7-F: G AAACCCTGT- Spacer -CTTCCTTTATTTTCCTTACAGGG C TTC and SMN1-7-R: TTCACTTTCATAATGCTGGCAG, detection probe SMN1-7-P: GGAAGGTGCTCACATTCCTTA; or The primer set is used to detect exon 7 of the SMN2 gene, and the primer set includes SMN2-7-F: G AAACCCTGT- Spacer -CTTCCTTTATTTTCCTTACAGGG C TTT and SMN2-7-R: TTCACTTTCATAATGCTGGCAG, detection probe SMN2-7-P: GGAAGGTGCTCACATTCCTTA.

3. The primer set according to claim 1, characterized in that The length of the first part of the blocking primer is 15 to 25 bases.

4. The primer set according to any one of claims 1 to 3, characterized in that It also includes at least one of a detection probe, an internal labeling probe, and an internal reference gene primer.

5. A kit for SMN gene detection, characterized in that: The method comprises a PCR reaction solution and the primer set according to any one of claims 1 to 4.

6. A method for detecting the SMN gene, the method not being used for disease diagnosis, comprising the following steps: Obtaining DNA from the sample to be tested; amplifying the sample DNA using the primer set according to any one of claims 1 to 4; The amplified products were tested to determine the SMN gene test results.

7. Use of the primer set according to any one of claims 1 to 4 in SMN gene amplification and copy number detection, not for disease diagnosis.

Citation Information

Patent Citations

  • Improved ARMS (amplification refractory mutation system) primer structure (Super-ARMS) and application method thereof

    CN106755388A

  • SMN1 gene fluorescent quantitative detection primer, probe and kit

    CN115948516A

  • Primer probe group and kit for detecting spinal muscular atrophy virulence gene SMN1

    CN115976182A