214 results about "Gene expansion" patented technology

Methods of identifying changes in genomic DNA copy number are disclosed. Methods for identifying homozygous deletions and genetic amplifications are disclosed. An array of probes designed to detect presence or absence of a plurality of different sequences is also disclosed. The probes are designed to hybridize to sequences that are predicted to be present in a reduced complexity sample. The methods may be used to detect copy number changes in cancerous tissue compared to normal tissue. The methods may be used to diagnose cancer and other diseases associated with chromosomal anomalies.

A method is provided for selecting nucleric acids encoding gene product is in which the nucleic acid encoding the gene product is selectly and quantitatively amplified depending on the activity of the gene itself or the gene product. The method may, for example, be used in selecting gene products arising from in vitro evolution of molecular libraries.

The invention discloses a detection primer combination and a kit for HER2 (human epidermal growth factor receptor 2) gene amplification. The detection primer combination comprises an HER2 primer combination and a GAPDH reference primer combination; each combination comprises upstream and downstream amplification primers of a target gene of the combination and a Taqman fluorescent probe. The kit comprises the detection primer combination, a positive quality control and a negative quality control. By using the detection primer combination and the kit, whether the HER2 gene in patients with breast carcinoma is amplified or not can be detected quickly and simply; compared with the FISH (fluorescent in situ hybridization) method, a method using the detection primer combination and the kit is high in detection sensitivity, low time consumption, generally 1.5 to 2 hours for acquiring reaction results, low in cost, low in false positive ratio, and suitable for large-scale clinical development; thus, quick, effective and accurate detection is achieved for HER2 gene amplification, and timely disease treatment and treatment effect monitoring are guaranteed.

The invention discloses a quantitative detection method for a gene copy number. The method comprises the following steps of: respectively designing primers and fluorescence probes for target gene and reference gene amplification sequences, and designing a closed probe for the target gene amplification sequence; detecting a sample: performing multiple TaqMan fluorescent quantitative polymerase chain reaction (PCR) on target genes and reference genes by using the DNA sample to be detected as a template, and respectively recording Ct values by using a DNA sample with known target gene copy number as a reference sample; and analyzing the result. By the method, the copy number of the functional genes can be directly and quantitatively detected, and deletion, deletion number and multiple copies (CNVs) of the detected genes are directly reflected, so that synchronous quick detection of gene deletion and multiple gene copies is realized; and the method is high in sensitivity, the synchronous quick detection of the gene deletion and the multiple gene copies can be finished only by a common fluorescent quantitative PCR instrument, and experiments prove that the method is accurate and reliable.

The invention discloses a detection chip for a tumor driving gene and application thereof. The detection chip for the tumor driving gene comprises an ALK (anaplastic lymphoma kinase) fusion detection agent, an EGFR (epidermal growth factor receptor) fusion detection agent, an RET (reticulocyte) fusion detection agent and an ROS1 (reactive oxygen species 1) fusion detection agent. Proofed by the results of clinical detect, after fusion probes corresponding to the ALK, the EGFR, the RET and the ROS1 are specifically designed, the detection chip has the advantages that the sensitivity is high, and the gene fusion between a particular site area of the ALK, the EGFR, the RET and the ROS1 and fusion segments is specifically detected. The invention further discloses a detection chip for detecting a second sequence group of the gene mutation and a third sequence group of the gene amplification; after detecting once, the gene fusion, gene mutation and gene amplification of the multiple tumor driving genes, such as the ALK, BRAF (aserine/theroninespecific kinases), DDR2 (discordin domain receptor 2), the EGFR, ERBB2 (receptor tyrosine kinase 2), FGFR1 (fibroblast growth factor receptor 1), KRAS (kirstenrat sarcoma viral oncogene), MET (methionine), NRAS, PIK3CA (phosphatidylino-sitol 3-kinases), the RET and the ROS1.

The present invention generally relates to amplfication reactions. One aspect of the invention provides amplification reaction enhancer compositions comprising trehalose, carnitine, and a non-ionic detergent, such as NP40. These enhancer compositions can improve efficiency, specificity, and sensitivity of amplification reactions in conventional and real-time PCR and RT-PCR. In addition, these compositions permit nucleic acid amplification directly in crude samples containing blood, blood components, or soil extract with little or no nucleic acid extraction prior to amplification. Another aspect of the invention provides a method of enhancing an amplification reaction containing a crude blood sample with heparin. Another improvement derived from the invention is improved detection of difficult, high GC content nucleic acid targets.

This invention relates to a method for preparing molecular weight internal standard. The method comprises: immobilizing upstream primer 5'GCGAAACCCGACAGGACTA3' with pUC18 plasmid as the template, designing downstream primers with a certain distance, and proliferating to obtain multiple nucleotide segments. The method obtains a series of segments with different lengths by immobilizing the upstream primer and designing the downstream primers in sequence. The traditional method for synthesizing primers by fluorescent labeling has such disadvantages as high cost and short preservation time. The method in this invention synthesizes the upstream immobilized primer only, which can largely lower the primer synthesis cost and production cost. Since the upstream primer is the same, the lengths and annealing temperatures of the downstream primers are similar, and the proliferation conditions for all segments are identical, which can facilitate easy operation (all proliferations are performed on the same gene proliferation apparatus with the same reaction program), saved time, high working efficiency, and large-scale production.

The invention provides a goose-origin gene RIG-I (retinoic acid-inducible gene-I) with anti-Newcastle disease virus activities and an application thereof. According to the goose-origin gene RIG-I and the application of the goose-origin gene RIG-I, mRNA (Messenger Ribonucleic Acid) sequences of the goose-origin gene RIG-I are amplified based on a duck-origin gene RIG-I, and the homology of the goose-origin gene RIG-I and the duck-origin gene RIG-I is found to reach 93.8%; heterogenously-expressed gRIG-I is proved to be capable of expressing an anti-NDV (Newcastle disease virus) effect after over-expressing transfection cells of the full-length gRIG-I (gRIG-I full) and a gRIG-I CARD structural domain (gRIG-I CARD); the gRIG-ImRNA levels are detected by respectively infecting primary-culture geese embryo fibroblasts (GEF) and 2-week Yangzhou geese by utilizing three NDV viruses; the gRIG-ImRNA levels are found to averagely rise after the GEFs are infected by the NDV; and after being infected by the NDV, the gRIG-ImRNA levels in tissues of lungs and air sacs of the geese averagely rise, and the virus growths in in-vitro and in-vivo experiments are all restrained.

The invention relates to a method for rapidly and efficiently screening a rhamnolipid producing bacteria nutrition system. The method comprises the following steps: synthesizing a primer of rhamnolipid producing gene rhlAB, performing gene amplification by using PCR, synthesizing rhlAB gene fragments, connecting the rhlAB gene fragment to the position in front of lux luminescence gene on pMS402 plasmid by utilizing gene engineering shearing and splicing technology, then transferring the recombinant plasmid into pseudomonas aeruginosa DN1, coating the recombinant strain onto an LB solid plate containing 200mg/L-300mg/LTmp, screening out positive clone, naming the strain as rhlAB-lux strain, picking out positive monoclonal colonies to be enriched on the solid LB culture medium, refrigeratingat at 4DEG C for later use; taking out the refrigerated rhlAB-lux strain, and enriching the thallus overnight; and screening a nutrient optimized system. According to the method, the luminescence value can be determined by a multifunctional microplate reader, and the method has the characteristics that the flux is high, and the screening process is simplified and rapid.

The invention discloses establishment and application of a novel HIV-1 drug resistance detection method. The novel HIV-1 drug resistance detection method established according to the invention has theadvantages that 1, by utilizing multiple sets of primer combinations, a problem of low amplification efficiency of target genes, which is caused by differences of different subtypes of strain sequences, is considered; and 2, synthesis of PR, RT and IN target gene cDNA and first-round amplification of a target gene nested PCR are completed in one reaction tube so as to avoid respective amplification on the target genes, simplify the experimental process and save reagent cost by 50%. The detection method established according to the invention can simultaneously cover multiple strain subtypes, and simultaneously cover multiple gene regions, which enables HIV-1 drug resistance detection efficiency to be greatly improved, and has the great influence on aids prevention and public health.

Primer sets for amplifying target regions containing sites to be detected in the CYP2C19 gene by a gene amplification method are provided, wherein the primer sets can amplify the regions specifically. Two pairs of primer sets are used including forward primers consisting of the base sequences of SEQ ID NOs: 12 and 32 as well as reverse primers consisting of the base sequences of SEQ ID NOs: 22 and 48, respectively. The use of these primer sets makes it possible to amplify two target regions including parts where two types of polymorphisms (CYP2C19*2 and CYP2C19*3) of the CYP2C19 gene are generated, respectively, in the same reaction solution at the same time.

The invention relates to the technical field of gene polymorphism detection, in particular to a detection method of yak FOXO1 gene single nucleotide polymorphism and a kit thereof. The detection method comprises the following steps: 1) preparing a yak FOXO1 gene amplification product; 2) synthesizing a high and low temperature interior label; 3) preparing an HRM-PCR (High Resolution Melt-Polymerase Chain Reaction) amplification product; 4) collecting a fluorescence signal. Compared with an HRM method used for detecting polymorphic sites in the prior art, a gene probe designed by the detection method is more accurate and flexible in positioning, is accurate in parting, does not need PCR post-processing, has high working efficiency and good repeatability and is low in sample quality and quantity requirements, especially, the concentration requirement of a DNA template can be lowered to 0.1ng/mu L, and time and labor are saved when a sample size is large. Meanwhile, the detection kit has the advantages of high sensitiveness, high detection speed and good stability.

The invention discloses a primer group for detecting Bordetella pertussis, a detection test kit and a detection method. The primer group comprises an IS481 gene amplification pair and/or a PT gene amplification primer pair, wherein the primer pair sequence of the IS481 gene amplification pair is a nucleotide sequence shown as SEQ IDNO:1 and SEQ IDNO:2, and the primer pair sequence of the PT gene amplification primer pair is a nucleotide sequence shown as SEQ IDNO:3 and SEQ IDNO:4. The invention detects two genes simultaneously in the same reaction system, and the two genes can be detected through gel electrophoresis. The specificity of detection is guaranteed, and the sensitivity of detection is increased; meanwhile, detection efficiency is greatly increased, and detection cost is saved.

The invention discloses an amplification method of porcine epidemic diarrhea virus S-gene epitope. The amplification method comprises the steps of: (1) extraction of virus RNA (Ribonucleic Acid); (2) amplification of RT-PCR (Reverse Transcription-Polymerase Chain Reaction); (3) amplification of nested PCR (Reverse Transcription-Polymerase); and (4) cloning, sequencing analysis and the like of a PCR product and the like. An S-gene of the porcine epidemic diarrhea virus (PEDV) is amplified, and the amplified fragment is 782bp in length (situated in a range from 1316bp-2097bp of the S-gene) and comprises neutralized antigenic epitope situated in a range from 1495bp-1914bp of the S-gene; and according to the amplification method, different generations of S-genes of PEDV (porcine epidemic diarrhea virus) seed, which are cultured on a vero cell, can be amplified, and the S gene of the porcine epidemic diarrhea virus in a cell culture and passage process, particularly the sequence change of the neutralized antigenic epitope, is captured, thus the relationship between the sequence change of the neutralized antigenic epitope and the immune efficacy change of the PEDV can be known.

The invention relates to adenocarcinoma specificity EpCAM-GM-CSF genetic recombinant fusion protein and a preparation method thereof. The method comprises the first step of designing and compositing a primer, the second step of amplifying and sequencing genes, the third step of constructing a recombinant vector pET-EpCAM-hGM-CSF, the fourth step of screening and identifying the recombinant vector pET-EpCAM-hGM-CSF, the fifth step of recombining plasmid pET-EpCAM-hGM-CSF to transform escherichia coli Rosetta, the sixth step of recombining EpCAM-hGM-CSF fusion protein to induce to express in escherichia coli Rosetta, the seventh step of purifying the EpCAM-hGM-CSF fusion protein, and the eighth step of permeating and concentrating the purified EpCAM-hGM-CSF fusion protein.

The invention discloses a method for simultaneously detecting multiple trace sample TCR (T cell receptor) repertoires. The method includes: taking a sample RNA (ribonucleic acid) as a template to synthesize a first-strand cDNA (complementary deoxyribonucleic acid), performing 5'-terminal RACE PCR, designing specific 5' RACE nested PCR primers and TCR alpha-beta gene specific primers, performing RT-PCR amplification to obtain alpha-beta gene amplification products of each sample TCR, mixing the multiple sample PCR products for sequencing, distinguishing different samples according to joining regions of the specific primers, and analyzing frequency distribution of V and J gene segments in each sample. The method for simultaneously detecting the multiple trace sample TCR repertoires has the advantages that on the premise that distinguishing of different samples is guaranteed, sequencing cost of the TCR repertoires is greatly reduced, and authenticity in frequency distribution of each family is guaranteed; establishment of disease entity RCR repertoires requiring a great quantity of samples is promoted.

The invention discloses a CRISPR-Cas12a-based streptococcus suis rapid visual RPA detection kit and application thereof. The kit comprises a pair of specific primer pairs for amplifying a streptococcus suis cps2j gene, gRNA and a fluorescent report probe, wherein the nucleotide sequences of the primer pairs are shown as SEQ ID NO: 6 and 7 or SEQ ID NO: 8 and 9; and the nucleotide sequence of DNA complementary to the gRNA is shown as SEQ ID NO: 2 or 3. According to the kit, specific Recombinase Polymerase Amplification (RPA) primers and a CRISPR/Cas12a system probe are designed according to the specific gene Cps2j of streptococcus suis, RPA specific target gene amplification and report gene cutting of a CRISPR/Cas12a system are realized, and a rapid visual detection method for the streptococcus suis is established. The method is rapid, visual, good in specificity, high in sensitivity and particularly suitable for detecting the streptococcus suis in resource-deficient areas.

The invention relates to a kit for genotyping hepatitis C virus (HCV), which comprises HCVNS5B gene amplification primers, HCVNCR conserved region gene amplification primers, an HCVRNA extraction reagent, a negative control, a positive control, a cDNA (complementary deoxyribonucleic acid) synthetic reagent, a PCR (polymerase chain reaction) solution and a PCR sequencing reagent, wherein the sequence of the HCVNS5B gene forward primer is disclosed as SEQ ID NO.1, the sequence of the HCVNS5B gene reverse primer is disclosed as SEQ ID NO.2, the sequence of the HCVNCR conserved region gene forward primer is disclosed as SEQ ID NO.3, and the sequence of the HCVNCR conserved region gene forward primer is disclosed as SEQ ID NO.4. The kit provided by the invention has the advantages of high detection sensitivity and good specificity, and can be used for detecting all the reported HCV genotypes (subtypes) at high speed (within 12-14 hours).

The invention discloses a phomopsis RNA polymerase (RPB1) gene amplification primer, as well as a design method and application thereof. The primer is designed to aim at a universal primer of phomopsis funguses. An upstream primer PhR1-F has 43 basic groups: CGCCAGGGTTTTCCCAGTCACGACTGCAGCAAGGTGTTGGCTG, and a downstream primer PhR1-R has 43 basic groups: AGCGGATAACAATTTCACACAGGAGCGATGTCGTTGTCCATGTA. The primer can rapidly perform large-scaled genetic background analysis on the phomopsis funguses, and provides an important tool for species identification, geographical population identification or inspection and quarantine works of phomopsis in the country of China.