InDel molecular marker for identifying cotton fertility traits, primer and application thereof

By applying InDel molecular markers M10 and M14 and primers, the problem of fertility determination in cotton breeding has been solved, enabling early, rapid, and accurate fertility identification, thereby improving breeding efficiency and economic benefits.

CN118389732BActive Publication Date: 2026-02-06SHIHEZI UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410582970.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-11
Publication Date
2026-02-06
Estimated Expiration
2044-05-11

AI Technical Summary

Technical Problem

In existing cotton breeding, hybridization is costly, inefficient, and time-consuming. Traditional fertility determination requires waiting for flowering, making it impossible to distinguish between male sterility and fertile traits in the early stages, which makes it difficult to achieve new breeding goals.

Method used

InDel molecular markers M10 and M14 were developed for identifying fertility traits in cotton, and corresponding primers were designed. Through PCR amplification and polyacrylamide gel electrophoresis, the fertility and sterility phenotypes of cotton were identified at an early stage and with high efficiency.

Benefits of technology

It enables rapid and accurate identification of fertility traits at various stages of cotton growth, saving costs, improving breeding efficiency, and shortening the breeding cycle. It is applicable to molecular marker-assisted breeding of cotton.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004834637280000041
    Figure BDA0004834637280000041
  • Figure BDA0004834637280000051
    Figure BDA0004834637280000051
  • Figure BDA0004834637280000052
    Figure BDA0004834637280000052
Patent Text Reader

Abstract

The application discloses an InDel molecular marker for identifying a cotton fertility trait and application thereof, and belongs to the technical field of cotton genetic breeding. The molecular marker is located on a chromosome A09 of a cotton genome, and a nucleotide sequence thereof is shown in SEQ ID NO. 1 or SEQ ID NO. 2. The InDel molecular marker is M10 and is located at the 200-230 bp position of the nucleotide sequence of SEQ ID NO. 1. The InDel molecular marker is M14 and is located at the 217-251 bp position of the nucleotide sequence of SEQ ID NO. 2. The molecular marker can be used for accurately, rapidly and efficiently identifying the fertility of cotton at each period. Compared with the traditional breeding method of waiting for flowering to determine the fertility, the marker has the advantages of earlier time, higher accuracy and faster speed in the application of assisted breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology and cotton genetic breeding technology, and particularly relates to an InDel molecular marker for identifying fertility traits of cotton, a primer and application thereof. BACKGROUND

[0002] Cotton is not only an important fiber crop, but also an important oil crop. At the same time, it is also a feed crop with the potential to develop into an edible product. The "multi-talented" characteristics also make it a major economic crop in China and even the world, playing an important role in the economic development of China and the world, and is an important strategic material related to the national economy and people's livelihood. However, at the present stage, each cotton variety is accompanied by a restrictive short board. For example, a cotton variety with high yield is accompanied by low fiber quality; a cotton variety with high fiber quality is accompanied by poor disease resistance; a cotton variety with high disease resistance is accompanied by an unsuitable plant type for mechanical harvesting; a variety suitable for mechanical harvesting is accompanied by low yield, etc. These restrictive short boards greatly limit the maximization of cotton economic benefit, and the aggregation of multiple excellent traits greatly narrows the restrictive short boards of new cotton variety breeding. However, the manual detasseling method in the hybrid breeding process has high cost, low efficiency and long breeding cycle, which greatly increases the difficulty of realizing the new breeding target. The male sterile line avoids the characteristics of male sterility, which helps to realize the new breeding target.

[0003] Plant male sterility is divided into heritable and non-heritable types according to genetic stability. Heritable plant male sterility mainly includes cytoplasmic male sterility (CMS) and nuclear male sterility (GMS) (Vedel F, Pla M, Vitart V, et al. Molecular basis of nuclear and cytoplasmic male sterility in higher plants. Plant Physiol Bioch, 1994, 32(5): 601-618.). In hybrid advantage application, CMS uses three-line matching seed production to remove the cumbersome work of manual detasseling, achieving low cost, time saving, labor saving and high efficiency, but there are still some problems to be solved, including the adverse effects of CMS on yield and poor fertility restoration ability, which limit the large-scale production of hybrid cotton. GMS mainly has two types: dominant nuclear sterility (DGMS) and recessive nuclear sterility (RGMS). Among them, DGMS cotton materials can be used as a hybridization tool for recurrent selection in self-pollination crops, with the characteristics of increasing recombination between excellent genes and expanding genetic variation rate. However, the 1:1 separation characteristics of GMS breeding offspring fertility and sterility cannot be distinguished by phenotype before flowering, which brings inconvenience to its use in breeding and production, and it is urgent to use molecular marker technology for fertility identification.

[0004] The development of molecular markers facilitates the genetic selection of traits at the chromosome level, and the InDel marker with high accuracy and good stability avoids subsequent analysis ambiguity caused by specificity and complexity. In addition, the InDel marker can amplify mixed DNA samples and highly degraded trace DNA samples and effectively type. Meanwhile, the portable electrophoresis platform typing method has low operation difficulty and high applicability. SUMMARY

[0005] The purpose of the present application is to provide an InDel molecular marker for identifying the fertility trait of cotton, a primer for amplifying the molecular marker, and the application of the molecular marker.

[0006] To achieve the purpose of the present application, in the first aspect, the present application provides an InDel molecular marker for identifying the fertility trait of cotton, which is M10 and M14, both of which are located on chromosome A09 of the cotton genome, wherein M10 is located at the position of 200-230 bp of the nucleotide sequence of SEQ ID NO. 1, and M14 is located at the position of 217-251 bp of the nucleotide sequence of SEQ ID NO. 2.

[0007] In the second aspect, the present application provides a primer for amplifying the nucleotide sequences of SEQ ID NO. 1 and 2 where the molecular markers M10 and M14 are located, including the upstream primer of SEQ ID NO. 1F and the downstream primer of SEQ ID NO. 1R, and the upstream primer of SEQ ID NO. 2F and the downstream primer of SEQ ID NO. 2R.

[0008] In the third aspect, the present application provides a method for identifying the fertility trait of cotton, comprising the following steps:

[0009] 1) Extracting the genomic DNA of the cotton seedlings to be tested;

[0010] 2) Using the DNA extracted in step 1) as a template, and using the primers M10-F and M10-R or M14-F and M14-R for PCR amplification;

[0011] 3) Adding the PCR product amplified in step 2) to a polypropylene gel well, and after electrophoresis, silver staining the gel, observing the bands, and a single main band is the fertile phenotype, and two main bands are the sterile phenotype.

[0012] Further, the PCR amplification system used in the present application comprises: 50 ng / μL DNA template 1 μL, 2×Taq PCRmix 8 μL, 10 μM upstream and downstream primers each 0.5 μL.

[0013] PCR reaction procedure: 94℃ pre-denaturation 3 min; 94℃ denaturation 30 s, 55℃ annealing 30 s, 72℃ extension 45 s, 32 cycles; 72℃ final extension 5 min, 4℃ storage.

[0014] The concentration of polyacrylamide gel is 8%; the electrophoresis voltage is 160 V, and the time is 2.5-3 hours.

[0015] In a fourth aspect, the molecular marker, the marker primer and the identification method provided by the application can be applied as follows:

[0016] 1) for identifying the fertility trait of cotton

[0017] 2) for cotton molecular marker assisted breeding

[0018] By means of the above technical solution, the application has at least the following advantages and beneficial effects:

[0019] The application provides an InDel molecular marker for identifying the fertility trait of cotton, and the marker primer can be used to quickly and efficiently identify the fertile and sterile phenotypes of cotton at each period of cotton, while the traditional breeding needs to wait for the flower to open to determine the fertility, and compared with the traditional breeding, the marker has the advantages of early time, cost saving, accuracy and rapidness in the application of assisted breeding.

[0020] The method for identifying the InDel molecular marker for identifying the fertility trait of cotton provided by the application can be detected by means of ordinary PCR and polyacrylamide gel electrophoresis, without sequencing, and has the advantages of simple operation, rapidness and low cost compared with the identification method of other marker types such as SNP.

[0021] The molecular marker of the application is verified in a BC7F1 backcross population constructed by taking 1000 SD98-6A (BC6F1) sterile materials as female parents and upland cotton SD98-6 as male parent, and the accuracy is 100%, so that the cotton fertility trait identification by means of the molecular marker is reliable. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 Fig. 2 is the distribution of delta InDel-index on chromosomes of two offspring, the horizontal axis represents the length of chromosomes (Mb), and the vertical axis represents delta (InDel index);

[0023] Figure 2 Fig. 3 is the distribution of delta All-index on chromosomes of two offspring, the horizontal axis represents the length of chromosomes (Mb), and the vertical axis represents delta (All index);

[0024] Figure 3Figure 1 is a polyacrylamide gel electrophoresis chart of M10 and M14 markers of cotton fertility, A, M10 polyacrylamide gel electrophoresis chart; B, M14 polyacrylamide gel electrophoresis chart; M: DS2000, 1: parent SD98-6, 2-9: fertile offspring; 10-17: sterile offspring SD98-6A;

[0025] Figure 4 Figure 2 is a result of positioning of M10 and M14 markers of cotton fertility in multiple populations. DETAILED DESCRIPTION

[0026] In order to facilitate the understanding of the present application, the following will be a more comprehensive and detailed description of the present application in combination with the drawings of the specification and the preferred embodiments, but the protection scope of the present application is not limited to the following specific embodiments.

[0027] Unless otherwise defined, all the professional terms used in the following have the same meaning as understood by those skilled in the art. The professional terms used in this paper are only for the purpose of describing specific embodiments and are not intended to limit the protection scope of the present application.

[0028] The present application only describes the preferred methods and materials, but any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present application. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In the event of conflict with any incorporated document, the content of this specification shall prevail.

[0029] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present application can be purchased from the market or can be prepared by existing methods.

[0030] Example 1

[0031] 1. In the BC6F1 backcross population constructed with the sterile material of Gossypium hirsutum SD98-6A (BC5F1) as the female parent and Gossypium hirsutum SD98-6 as the male parent, 20 SD98-6A and 20 SD98-6 offspring were randomly selected, together with 1 fertile parent SD98-6, 1-1.5 g of tender leaves of each material were collected and placed in the corresponding 2 ml centrifuge tube. The 2 ml centrifuge tube containing the collected leaf samples was stored in liquid nitrogen under the condition of dry ice, and sent to Beijing Nuowozhengyuan Company to construct a fertile and sterile type mixed pool, and then resequenced (BSA) through an extreme trait mixed pool to realize the positioning of the sterility trait gene.

[0032] 2、Sample tender leaves were extracted with CTAB method (Song Guoli et al. Improved CTAB method for rapid extraction of cotton DNA. Cotton Science 05 (1998): 50-52.) to extract DNA, and the extracted DNA was detected to be qualified. The sample was randomly broken into 350 bp fragments using Covaris crusher according to the standard process, and the TruSeq Library Construction Kit was used for library construction, and then sequenced by illumina HiSeq™ PE150. The obtained Raw data was quality controlled to obtain Clean data, and then the Clean data was aligned to the reference genome of Gossypium hirsutum TM-1 (Zhang T Z, et al. Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement. Nat Biotechnol, 2015, 33(5): 531-537.) by BWA software. The alignment rate of all aligned samples was between 99.37% and 99.79%, the average depth was between 11.95X and 22.87X, and the 1X coverage was more than 97.38% (Table 1), which could be used for subsequent InDels detection and related analysis.

[0033] Table 1 Sequencing depth and coverage statistics

[0034]

[0035] Note: *SD98-6A (BC5F1) is a fertile offspring of backcrossing between SD98-6 and recurrent parent SD98-6.

[0036] 3、According to the genotyping results, homozygous markers were screened from the parents, and 390213 InDels polymorphic markers were obtained from the offspring. SD98-6 was selected as the reference parent, and the InDel-index of the two offspring at the InDels marker site between the parents was calculated respectively. Figure 1 According to the InDel-index threshold value, when the fitting posterior confidence is 0.95, the positioning result is on chromosome A09 ( Figure 2 ), and the size of the InDels candidate interval is 10.02 Mb.

[0037] 4、Through the InDels in the candidate interval located by BSA, we designed 120 pairs of polymorphic primers, and extracted DNA from any one of the tender leaves of the fertile parent and the sterile offspring as the amplification template. The amplification products were screened by polyacrylamide gel electrophoresis (Wang L, Liu X, Zhou T, et al. Optimization of silver-stained polyacrylamide gel electrophoresis technology system [J]. Xinjiang Agricultural Sciences, 2019, 56(12): 2312-2319.), and the main band of the fertile parent was a single band, while the main band of the sterile plant was two bands. Finally, we successfully obtained 21 pairs of polymorphic primers related to the sterile gene. Subsequently, we used the 21 pairs of primers to amplify 320 BC6F1 population, and analyzed according to the number of single crossover samples and the field cotton fertility investigation results of the amplification products by polyacrylamide gel electrophoresis. Finally, we narrowed down the candidate interval, and confirmed it between M10-M14 Figure 3 ), with a physical distance of 760 kb. The linkage markers of M10 and M14 had different sample numbers and quantities, indicating that their exchanges were completely independent. Finally, we constructed a genetic linkage map based on the marker results of the 21 pairs of primers, and by using Joinmap4.0 software Figure 4 ).

[0038] 5、In the 21 pairs of polymorphic primers related to the sterile trait, the M10-F upstream primer and the M10-R downstream primer amplified a single band with a product size of 398 bp in the fertile offspring and the parent SD98-6 cotton plants, and the band nucleotide sequence is shown in SEQ ID No. 1. In the sterile offspring SD98-6A cotton plants, the M10-F upstream primer and the M10-R downstream primer amplified double bands with product sizes of 398 bp and 367 bp, respectively. The band nucleotide sequence of the 398 bp product size is consistent with the nucleotide sequence shown in SEQ ID No. 1, while the M10 marker is located in the band with a product size of 367 bp, and its sequence characteristics are that there is a deletion of [TAGCATTTCCTATACATAAAAAAACTGCATA] sequence at the 200-230th position of the nucleotide sequence shown in SEQ ID No. 1 (Table 2).

[0039] SEQ ID No. 1:

[0040]

[0041] M10-F: ACATGTGATAGAGAGATTTGAACCA;

[0042] M10-R: GTCCCCCACCAAAACTGGAT.

[0043] 6、Similarly, in the 21 pairs of polymorphic primers associated with the sterility trait obtained, a single band with a product size of 377 bp was amplified in the fertile offspring and the parent SD98-6 cotton plants using the M14-F upstream primer and the M14-R downstream primer, and the band nucleotide sequence is shown in SEQ ID No. 2. In the sterile offspring SD98-6A cotton plants, a double band with product sizes of 377 bp and 342 bp was amplified using the M14-F upstream primer and the M14-R downstream primer. The 377 bp product size band nucleotide sequence is consistent with the nucleotide sequence shown in SEQ ID No. 2, and the M14 marker is located in the 342 bp product size band, which is characterized by the absence of the sequence [TAACATATGCTTTTGAATTAAGGATAAAATAACTT] at positions 217-251 of the nucleotide sequence shown in SEQ ID No. 2 (Table 2).

[0044] SEQ ID No. 2:

[0045]

[0046] M14-F: CCACTATGTCGAGGCCGTAA;

[0047] M14-R: TCTATAGCGCTCTCTCTGTTGA.

[0048] Table 2: Base type of InDel marker site in fertile parent and sterile offspring

[0049] InDel site SD98-6 SD98-6A M10 TAGCATTTCCTATACATAAAAAAACTGCATA Deletion M14 TAACATATGCTTTTGAATTAAGGATAAAATAACTT Deletion

[0050] Example 2

[0051] DNA was extracted from 1000 single plants in the BC7F1 backcross population constructed using the extracted SD98-6A (BC6F1) sterile material as the female parent and the upland cotton SD98-6 as the male parent. Amplification was performed using the primers corresponding to the M10 and M14 markers, and the target bands were counted by polyacrylamide gel electrophoresis of the amplification products. The results showed that among the 1000 single plants, the number of single plants with a single main band amplified by the M10 marker primer was 581, and the number of single plants with two main bands was 419. This indicates that among the 1000 single plants, 581 plants exhibit a fertile phenotype and 419 plants exhibit a sterile phenotype, which is consistent with the field cotton fertility investigation results (Table 3). At the same time, the identification results of the M14 marker primer are consistent with those of the M10 marker (Table 3), and the identification results of the two markers for the fertility of each single plant are also consistent. These results demonstrate that the M10 and M14 markers have a significant role in identifying cotton fertility.

[0052] Table 3 Identification of InDel markers in BC7F1 backcross population

[0053]

[0054] In summary, in the cotton breeding work and practical production based on the male sterile material SD98-6A, it is urgent to identify the fertility of cotton early, which is also the existing bottleneck technology. The M10 and M14 markers can assist in identifying the fertility of cotton, have very important application value, and have important significance for accelerating the breeding of new cotton varieties and improving the economic benefit of cotton.

[0055] The above-described embodiments are merely preferred modes of the present application and are not intended to limit the scope of the present application, and various modifications and improvements to the technical solutions of the present application made by those skilled in the art without departing from the design spirit of the present application shall fall within the protection scope of the present application defined by the claims.

Claims

1. The use of a reagent for detecting an InDel molecular marker in identifying a fertility trait of cotton or cotton molecular marker assisted breeding, characterized in that, the InDel molecular marker is M10 or M14, M10 is located at the position of 200-230 bp of the nucleotide sequence of SEQ ID NO. 1; M14 is located at the position of 217-251 bp of the nucleotide sequence of SEQ ID NO. 2; the breeding refers to the breeding of the fertility trait of cotton.

2. Use according to claim 1, wherein It is used for identifying the fertility trait of the sample of the offspring of the hybridization between tetraploid cotton as the male parent and upland cotton SD98-6A or its derived line as the female parent.

3. Use according to claim 1 or 2, characterized in that, The identification is carried out by amplifying the primers of the molecular marker.

4. Use according to claim 3, wherein the compound is ###0002### The specific sequences of the primers for amplifying the molecular marker M10 are as follows: M10-F: ACATGTGATAGAGAGATTTGAACCA; M10-R: GTCCCCCACCAAAACTGGAT; and the specific sequences of the primers for amplifying the molecular marker M14 are as follows: M14-F: CCACTATGTCGAGGCCGTAA; M14-R: TCTATAGCGCTCTCTCTGTTGA.

5. A method for identifying the fertility trait of cotton by detecting an InDel molecular marker, characterized in that, When the primers are used to amplify the molecular marker M10 or M14, the amplification product is displayed by polyacrylamide gel electrophoresis, and a single main band corresponds to the fertile phenotype of cotton, and two main bands correspond to the sterile phenotype of cotton. the InDel molecular marker is M10 or M14, M10 is located at the position of 200-230 bp of the nucleotide sequence of SEQ ID NO. 1; M14 is located at the position of 217-251 bp of the nucleotide sequence of SEQ ID NO.

2.

6. The method of claim 5, wherein, The sequences of the primers for amplifying the molecular marker M10 are as follows: M10-F: ACATGTGATAGAGAGATTTGAACCA; M10-R: GTCCCCCACCAAAACTGGAT; and the specific sequences of the primers for amplifying the molecular marker M14 are as follows: M14-F: CCACTATGTCGAGGCCGTAA; M14-R: TCTATAGCGCTCTCTCTGTTGA.

7. The method of claim 6, wherein, The method comprises the following steps: 1) extracting the genomic DNA of the cotton seedlings to be tested; 2) using a pair of the primers to carry out PCR amplification with the DNA extracted in step 1) as the template; 3) carrying out electrophoresis on the PCR product amplified in step 2), if it is a single main band, it is the fertile phenotype, and if it is two main bands, it is the sterile phenotype.

8. The method of claim 7, wherein, The electrophoresis is polyacrylamide gel electrophoresis, and the bands are observed by silver staining.