Molecular markers related to shoot root number in rice and their applications
By discovering and applying molecular markers related to the number of 5 crown roots in rice, the problem of insufficient molecular markers of rice crown roots in the prior art was solved, and the rapid and accurate detection of the rice crown root regulatory gene OsQHB was achieved, which promoted the improvement of rice breeding process and yield.
Patent Information
- Application Number
- CN202410821234.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-24
- Publication Date
- 2025-05-16
- Estimated Expiration
- 2044-06-24
AI Technical Summary
In the prior art, the excavation of molecular markers on the number of rice canopy roots is extremely limited, and it is difficult to achieve rapid and efficient screening of excellent traits, which affects the increase in rice yield.
A molecular marker related to the number of crown roots in rice is provided, including five polymorphic sites located on rice chromosome 1: SNP_1_36816059_A/C, SNP_1_36817315_G/C, SNP_1_36817701_T/C, SNP_1_36818252_T/C and INDEL_1_36817566_T/TAGCTCATGTAGATACCCTGAAACATGATACGCTA. Through KASP technology or electrophoresis detection, the genotype of the rice crown root regulatory gene OsQHB is quickly and accurately detected.
The rapid and accurate detection of the genotype of the rice crown root regulatory gene OsQHB in germplasm resources such as indica rice and japonica rice has been achieved, which has promoted the molecular breeding process and improved rice yield.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention relates to the field of crop genetic breeding and molecular marker technology, and in particular to a molecular marker related to the number of rice crown roots and its application. Background Art
[0002] As an important organ for plants to absorb water and nutrients, the root system plays a decisive role in the growth and development of plants. The plasticity of root growth and development helps plants obtain more water and nutrients under various adverse conditions, and is an important means for plants to adapt to different growth environments, especially adversity. Therefore, the plasticity of root growth and development is not only the basis for high yields of crops under favorable conditions, but also an important guarantee for the survival and stable yield of crops under adverse conditions.
[0003] The root system of monocots represented by rice is mainly composed of primary roots, crown roots and lateral roots. The primary roots of rice stop growing at the seedling stage, and the crown roots are mainly responsible for water and nutrient absorption and plant fixation in the subsequent growth and development stages. The development of crown roots is regulated by a variety of plant hormones and transcription factors. For example, the transcription factors encoded by the WUSCHEL-RELATEDHOMEOBOX (WOX) family are unique to plants and play different roles in plant development, such as embryogenesis, vascular differentiation, lateral organogenesis, and maintenance of root apical meristems. OsQHB (quiescent-center-specific homeobox gene, QHB) is a homologous gene of AtWOX5, which is specifically expressed in the root apical meristem and participates in the maintenance of the homeostasis of the rice root apical meristem. It also plays a key role in the regulation of crown root development. Its high level of expression can promote the increase in the number of rice crown roots, thereby increasing rice yield.
[0004] Since the natural variation sites of many genes often lead to enhanced or weakened gene functions, the excellent alleles can be used for crop molecular breeding. Molecular marker technology can achieve rapid and high-energy screening of excellent traits. However, the current mining of molecular markers for the number of rice crown roots is extremely limited. Therefore, the discovery of new molecular markers for the number of rice crown roots is of great significance.
[0005] Based on this, the embodiments of this specification provide a molecular marker related to the number of crown roots of rice and its application. Summary of the invention
[0006] The embodiments of this specification provide a molecular marker related to the number of rice crown roots and its application, which are used to solve the following technical problems: In crop molecular breeding, molecular marker technology can achieve rapid and high-energy screening for excellent traits. In rice, an increase in the number of crown roots can increase rice yield. However, the current mining of molecular markers for the number of rice crown roots is extremely limited, so it is of great significance to discover new molecular markers for the number of rice crown roots.
[0007] To solve the above technical problems, the embodiments of this specification are implemented as follows:
[0008] The embodiments of this specification provide a molecular marker related to the number of crown roots of rice and its application. The molecular marker is located on chromosome 1 of rice, and the molecular marker includes: molecular marker SNP_1_36816059_A / C, molecular marker SNP_1_36817315_G / C, molecular marker SNP_1_36817701_T / C, molecular marker SNP_1_36818252_T / C, and molecular marker INDEL_1_36817566_T / TAGCTCATGTAGATACCCTGAAACATGATACGCTA.
[0009] Further, the molecular marker SNP_1_36816059_A / C is located at 36816059bp on chromosome 1 of rice, and the single nucleotide polymorphism site is the presence of a nucleotide single base mutation A / C;
[0010] The molecular marker SNP_1_36817315_G / C is located at 36817315bp on chromosome 1 of rice, and the single nucleotide polymorphism site is a nucleotide single base mutation G / C;
[0011] The molecular marker SNP_1_36817701_T / C is located at 36817701bp on chromosome 1 of rice, and a nucleotide single base mutation T / C exists at the single nucleotide polymorphism site;
[0012] The molecular marker SNP_1_36818252_T / C is located at 36818252bp on chromosome 1 of rice, and the single nucleotide polymorphism site is a nucleotide single base mutation T / C;
[0013] The molecular marker INDEL_1_36817566_T / TAGCTCATGTAGATACCCTGAAACATGATACGCTA is located at 36817566bp on rice chromosome 1, and the single nucleotide polymorphism site has 34 nucleotide bases inserted.
[0014] The embodiment of the present specification also provides a method for detecting a molecular marker related to the number of rice crown roots, the detection method is used to detect a molecular marker related to the number of rice crown roots, the detection primer pair of the molecular marker SNP_1_36816059_A / C is a first detection primer pair, the first detection primer pair includes an upstream universal primer C1F and specific downstream primers FAM1R and HEX1R, the first detection primer pair is shown in the sequence table SEQ ID NO: 1-3;
[0015] The detection primer pair of the molecular marker SNP_1_36817315_G / C is a second detection primer pair, the second detection primer pair comprises specific upstream primers FAM2F and HEX2F and downstream universal primer C2R, and the second detection primer pair is shown in the sequence table SEQ ID NO: 4-6;
[0016] The detection primer pair of the molecular marker SNP_1_36817701_T / C is a third detection primer pair, and the third detection primer pair includes an upstream universal primer C3F and specific downstream primers FAM3R and HEX3R. The third detection primer pair is shown in the sequence table SEQ ID NO: 7-9;
[0017] The detection primer pair of the molecular marker SNP_1_36818252_T / C is the fourth detection primer pair, the fourth detection primer pair comprises an upstream universal primer C4F and specific downstream primers FAM4R and HEX4R, and the fourth detection primer pair is shown in the sequence table SEQ ID NO: 10-12;
[0018] The detection primer pair of the molecular marker INDEL_1_36817566_T / TAGCTCATGTAGATACCCTGAAACATGATACGCTA is the fifth detection primer pair, and the fifth detection primer pair includes a specific upstream primer 5F and a downstream primer 5R. The fifth detection primer pair is shown in the sequence table SEQ ID NO: 13-14.
[0019] Furthermore, the detection method of the molecular marker SNP_1_36816059_A / C, the molecular marker SNP_1_36817315_G / C, the molecular marker SNP_1_36817701_T / C and the molecular marker SNP_1_36818252_T / C is KASP technology, and the detection method of the molecular marker INDEL_1_36817566_T / TAGCTCATGTAGATACCCTGAAACATGATACGCTA is ordinary PCR method.
[0020] The present specification also provides an identification method for the rice gene OsQHB, wherein the identification method uses detection primers of molecular markers related to the number of rice crown roots to perform PCR reaction detection, and the identification method is used to determine the OsQHB genotype of rice and the number of rice crown roots.
[0021] Further, if the bases corresponding to the primer nucleotide sequences SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 8, and SEQ ID NO: 11 are detected based on the first detection primer pair, the second detection primer pair, the third detection primer pair, and the fourth detection primer pair, and the size of the PCR product detected based on the fifth detection primer pair is 255 bp, then the rice to be detected is a homozygous OsQHB genotype, and the rice to be detected has more crown roots;
[0022] If the bases corresponding to the primer nucleotide sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, and SEQ ID NO: 12 are detected based on the first detection primer pair, the second detection primer pair, the third detection primer pair, and the fourth detection primer pair, and the size of the PCR product detected based on the fifth detection primer pair is 221 bp, then the rice to be detected is a homozygous OsQHB genotype, and the crown root of the rice to be detected is small;
[0023] If the bases corresponding to the primer nucleotide sequences SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, and SEQ ID NO: 12 are detected based on the first detection primer pair, the second detection primer pair, the third detection primer pair, and the fourth detection primer pair, and the sizes of the PCR products detected based on the fifth detection primer pair are 255 bp and 211 bp, respectively, then the rice to be detected is a heterozygous OsQHB genotype, and the rice to be detected has many crown roots.
[0024] The embodiments of the present specification also provide a detection kit for molecular markers, the detection kit is used to detect molecular markers related to the number of rice crown roots, and the detection kit includes detection primers for the identification method of the rice gene OsQHB.
[0025] The embodiment of the present specification also provides a gene chip, which includes: molecular markers related to the number of rice crown roots and detection primers for a method for identifying the rice gene OsQHB.
[0026] The embodiments of the present specification also provide a rice breeding method, characterized in that the rice OsQHB genotype is identified based on the identification method of the rice gene OsQHB, and rice carrying the OsQHB genotype with more crown roots is selected as candidate rice for rice breeding.
[0027] At least one of the above technical solutions adopted in the embodiments of this specification can achieve the following beneficial effects: using the molecular markers and detection primer pairs provided in the embodiments of this specification, the genotype of the rice crown root regulatory gene OsQHB can be quickly and accurately detected in germplasm resources such as indica rice and japonica rice, as well as recombinant inbred line materials after hybridization of different parents. The present invention uses the SNP molecular markers and INDEL molecular markers to perform large-scale identification of breeding populations through KASP technology or electrophoresis detection, accelerate the molecular breeding process, and facilitate the application of the crown root regulatory gene OsQHB in breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 The number of crown roots in rice varieties with different genotypes of rice gene OsQHB at the three-leaf stage;
[0029] Figure 2 The expression difference of different genotypes of rice gene OsQHB in different rice varieties;
[0030] Figure 3 This is the application of the molecular markers of the embodiments of the present invention in the identification of rice crown root number materials. DETAILED DESCRIPTION
[0031] In order to more clearly illustrate the embodiments of this specification or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in this specification. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.
[0032] The test methods used in the examples are all conventional methods, and the materials used and the data on the number of crown roots are all stored or created by the applicant.
[0033] Example 1
[0034] In the embodiment of the present specification, the molecular markers related to the root crown of rice are obtained by analyzing the data of the crown root number of the core germplasm resources of rice, thereby obtaining several polymorphic sites in the rice gene OsQHB that regulate the crown root number, specifically including 4 SNPs and 1 INDEL. Specifically, the 4 SNPs and 1 INDEL are: molecular marker SNP_1_36816059_A / C, molecular marker SNP_1_36817315_G / C, molecular marker SNP_1_36817701_T / C, molecular marker SNP_1_36818252_T / C, molecular marker INDEL_1_36817566_T / TAGCTCATGTAGATACCCTGAAACATGATACGCTA.
[0035] In the examples of this specification, the molecular marker SNP_1_36816059_A / C is located at 36816059bp on chromosome 1 of rice, and the single nucleotide polymorphism site is the presence of a nucleotide single base mutation A / C;
[0036] The molecular marker SNP_1_36817315_G / C is located at 36817315bp on chromosome 1 of rice, and the single nucleotide polymorphism site is a nucleotide single base mutation G / C;
[0037] The molecular marker SNP_1_36817701_T / C is located at 36817701bp on chromosome 1 of rice, and a nucleotide single base mutation T / C exists at the single nucleotide polymorphism site;
[0038] The molecular marker SNP_1_36818252_T / C is located at 36818252bp on chromosome 1 of rice, and the single nucleotide polymorphism site is a nucleotide single base mutation T / C;
[0039] The molecular marker INDEL_1_36817566_T / TAGCTCATGTAGATACCCTGAAACATGATACGCTA is located at 36817566bp on rice chromosome 1, and the single nucleotide polymorphism site has 34 nucleotide bases inserted.
[0040] Example 2
[0041] In order to detect the molecular markers related to rice root cap, the detection method used in the examples of this specification is as follows:
[0042] The primers for the molecular markers were designed using the rice reference genome (os-Nipponbare-reference-IRGSp-1.0) sequence. Table 1 is a sequence table of the detection primer pairs provided in the examples of this specification.
[0043] Table 1 Sequence list of detection primer pairs
[0044] Example 3
[0045] Based on the molecular markers and detection primers provided above, the identification of the rice to be tested can be achieved.
[0046] Specifically, the CTAB method was used to extract rice leaf genomic DNA, and the molecular markers SNP_1_36816059_A / C, SNP_1_36817315_G / C, SNP_1_36817701_T / C and SNP_1_36818252_T / C were detected using the KASP technology, and the KASP reaction was performed on a genotyping platform. In one embodiment of the specification, the gene analysis platform is LGC SNPline, and the reaction system is shown in Table 2. The PCR amplification conditions are: 95°C for 15 minutes; 95°C for 10 seconds, 65°C for 60 seconds, the annealing temperature is reduced by 1°C in each cycle, for a total of 10 cycles; 95°C for 10 seconds, 57°C for 60 seconds, for a total of 38 cycles. After the reaction is completed, the fluorescence data is read. If only the fluorescence signal corresponding to the primer FAM is detected in the sample amplification product, the detection site is a homozygous OsQHB genotype with relatively more crown roots; if only the fluorescence signal corresponding to the primer HEX is detected, the detection site is a homozygous OsQHB genotype with relatively fewer crown roots; if both fluorescence signals are detected at the same time, the detection site is a heterozygous OsQHB genotype, which is a genotype with more crown roots. In the embodiments of this specification, more crown roots or fewer crown roots are relative. Specifically, the average value of the number of rice crown roots can be used as a basis for judgment. If the number of crown roots is greater than or equal to the first preset multiple of the average value of the number of rice crown roots, it is considered that the number of rice crown roots is large. If the number of crown roots is less than the second preset multiple of the average value of the number of rice crown roots, it is considered that the number of rice crown roots is small. The first preset multiple can be selected as 120%, and the second preset multiple can be 20%.
[0047] Table 2 KASP reaction system
[0048]
[0049] Ordinary PCR was used to detect the molecular marker INDEL_1_36817566_T / TAGCTCATGTAGATACCCTGAAACATGATACGCTA, and the reaction system is shown in Table 3. The PCR amplification conditions were: 95°C for 5 minutes; 95°C for 10 seconds, 56°C for 10 seconds, 68°C for 20 seconds, for a total of 35 cycles; 68°C for 5 minutes, and 4°C insulation. According to electrophoresis detection, if the PCR product size is 255 bp, the detection site is a homozygous OsQHB genotype with a large number of crown roots; if the PCR product size is 221 bp, the detection site is a homozygous OsQHB genotype with a small number of crown roots; if both 255 bp and 221 bp PCR products are detected, the detection site is a heterozygous OsQHB genotype.
[0050] Table 3 PCR reaction system
[0051]
[0052] In summary, if the bases corresponding to the primer nucleotide sequences SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 8, and SEQ ID NO: 11 are detected based on the first detection primer pair, the second detection primer pair, the third detection primer pair, and the fourth detection primer pair, and the size of the PCR product detected based on the fifth detection primer pair is 255 bp, then the rice to be detected is a homozygous OsQHB genotype, and the rice to be detected has more crown roots;
[0053] If the bases corresponding to the primer nucleotide sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, and SEQ ID NO: 12 are detected based on the first detection primer pair, the second detection primer pair, the third detection primer pair, and the fourth detection primer pair, and the size of the PCR product detected based on the fifth detection primer pair is 221 bp, then the rice to be detected is a homozygous OsQHB genotype, and the crown root of the rice to be detected is small;
[0054] If the bases corresponding to the primer nucleotide sequences SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, and SEQ ID NO: 12 are detected based on the first detection primer pair, the second detection primer pair, the third detection primer pair, and the fourth detection primer pair, and the sizes of the PCR products detected based on the fifth detection primer pair are 255 bp and 211 bp, respectively, then the rice to be detected is a heterozygous OsQHB genotype, and the rice to be detected has many crown roots.
[0055] Example 4
[0056] In order to further verify the molecular markers provided in the examples of this specification, this specification selects natural populations of multiple species for verification.
[0057] In the examples of this specification, 32 rice germplasm resources were used to verify the molecular markers SNP_1_36816059_A / C, SNP_1_36817315_G / C, SNP_1_36817701_T / C, SNP_1_36818252_T / C and the molecular marker INDEL_1_36817566_T / TAGCTCATGTAGATACCCTGAAACATGATACGCTA. The molecular marker detection results are shown in Tables 4 and Figure 1 As shown in the figure, it can be seen that 16 materials were detected as OsQHB genotypes with more crown roots, and the other 16 materials were OsQHB genotypes with fewer crown roots. Because rice has more crown roots when OsQHB expression is high, and fewer crown roots when OsQHB expression is low, the expression of OsQHB in 32 materials was detected by fluorescent quantitative PCR. The results are shown in Figure 2 As shown, the expression of OsQHB in the materials with the OsQHB crown root-rich genotype was higher than that in the materials with the OsQHB crown root-less genotype. It can be seen that the molecular markers described in the present invention can be used for the efficient detection of the OsQHB crown root genotype in rice.
[0058] Table 4 OsQHB molecular marker typing data in 32 germplasm resources
[0059]
[0060]
[0061] Example 5
[0062] The molecular markers and detection primer pairs provided in the embodiments of this specification can be applied to crop breeding to achieve the screening of rice materials.
[0063] In the examples of this specification, in order to expand the number of germplasm resources in natural populations, the molecular markers described in the present invention were used to genotype the rice crown root regulatory gene OsQHB, and the crown root number and yield data at the three-leaf stage were further analyzed. The results are as follows: Figure 3 As shown, the yield of the material containing the OsQHB genotype with more crown roots is higher than that of the material containing the OsQHB genotype with relatively fewer crown roots. It can be seen that the molecular markers described in the present invention can be used for the screening of rice varieties with higher crown roots and their subsequent breeding applications.
[0064] The embodiments of the present specification also provide a detection kit for molecular markers, wherein the detection kit is used to detect molecular markers, and the detection kit includes detection primers for the identification method of the rice gene OsQHB.
[0065] The embodiment of the present specification also provides a gene chip, which includes: molecular markers related to the number of rice crown roots and detection primers for a method for identifying the rice gene OsQHB.
[0066] By using the molecular markers and detection primer pairs provided in the embodiments of this specification, the genotype of the rice crown root regulatory gene OsQHB can be quickly and accurately detected in germplasm resources such as indica rice and japonica rice, as well as recombinant inbred line materials after hybridization of different parents. The present invention uses the SNP molecular markers and INDEL molecular markers to perform large-scale identification of breeding populations through KASP technology or electrophoresis detection, accelerate the molecular breeding process, and facilitate the application of the crown root regulatory gene OsQHB in breeding.
[0067] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.
Claims
1. A method for identifying the rice gene OsQHB, characterized in that: The identification method uses a first detection primer pair, a second detection primer pair, a third detection primer pair, a fourth detection primer pair and a fifth detection primer pair to perform PCR reaction detection, and the identification method is used to determine the OsQHB genotype of rice and the number of crown roots of rice, and the first detection primer pair, the second detection primer pair, the third detection primer pair, the fourth detection primer pair and the fifth detection primer pair are obtained by using the rice reference genome os-Nipponbare-reference-IRGSp-1.0 sequence to design primers for molecular markers; in, The molecular markers include: molecular marker SNP_1_36816059_A / C, molecular marker SNP_1_36817315_G / C, molecular marker SNP_1_36817701_T / C, molecular marker SNP_1_36818252_T / C and molecular marker INDEL_1_36817566_T / TAGCTCATGTAGATACCCTGAAACATGATA CGCTA; The detection primer pair of the molecular marker SNP_1_36816059_A / C is the first detection primer pair, the first detection primer pair includes an upstream universal primer C1F and specific downstream primers FAM1R and HEX1R, the first detection primer pair is shown in the sequence table SEQ ID NO: 1-3, the molecular marker SNP_1_36816059_A / C is located at 36816059 bp on chromosome 1 of rice, and the single nucleotide polymorphism site is a nucleotide single base mutation A / C; The detection primer pair of the molecular marker SNP_1_36817315_G / C is the second detection primer pair, the second detection primer pair includes specific upstream primers FAM2F and HEX2F and downstream universal primer C2R, the second detection primer pair is shown in the sequence table SEQ ID NO: 4-6, the molecular marker SNP_1_36817315_G / C is located at 36817315bp on chromosome 1 of rice, and the single nucleotide polymorphism site is a nucleotide single base mutation G / C; The detection primer pair of the molecular marker SNP_1_36817701_T / C is the third detection primer pair, the third detection primer pair includes an upstream universal primer C3F and specific downstream primers FAM3R and HEX3R, the third detection primer pair is as shown in the sequence table SEQ ID NO: 7-9, the molecular marker SNP_1_36817701_T / C is located at 36817701bp on chromosome 1 of rice, and a nucleotide single base mutation T / C exists at the single nucleotide polymorphism site; The detection primer pair of the molecular marker SNP_1_36818252_T / C is the fourth detection primer pair, the fourth detection primer pair includes an upstream universal primer C4F and specific downstream primers FAM4R and HEX4R, the fourth detection primer pair is shown in the sequence table SEQ ID NO: 10-12, the molecular marker SNP_1_36818252_T / C is located at 36818252bp on chromosome 1 of rice, and the single nucleotide polymorphism site is a nucleotide single base mutation T / C; The detection primer pair of the molecular marker INDEL_1_36817566_T / TAGCTCATGTAGATACCCTGAAACATGATA CGCTA is the fifth detection primer pair, and the fifth detection primer pair includes a specific upstream primer 5F and a downstream primer 5R. The fifth detection primer pair is shown in the sequence table SEQ ID NO: 13-14. The molecular marker INDEL_1_36817566_T / TAGCTCATGTAGATACCCTGAAACATGATA CGCTA is located at the 36817566bp on rice chromosome 1, and the single nucleotide polymorphism site has 34 nucleotide bases inserted.
2. The identification method according to claim 1, characterized in that If the bases corresponding to the primer nucleotide sequences SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 8, and SEQ ID NO: 11 are detected based on the first detection primer pair, the second detection primer pair, the third detection primer pair, and the fourth detection primer pair, and the size of the PCR product detected based on the fifth detection primer pair is 255 bp, then the rice to be detected is a homozygous OsQHB genotype, and the rice to be detected has more crown roots; If the bases corresponding to the primer nucleotide sequences SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, and SEQ ID NO: 12 are detected based on the first detection primer pair, the second detection primer pair, the third detection primer pair, and the fourth detection primer pair, and the size of the PCR product detected based on the fifth detection primer pair is 221 bp, then the rice to be detected is a homozygous OsQHB genotype, and the crown roots of the rice to be detected are few; If the bases corresponding to the primer nucleotide sequences SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, and SEQ ID NO: 12 are detected based on the first detection primer pair, the second detection primer pair, the third detection primer pair, and the fourth detection primer pair, and the sizes of the PCR products detected based on the fifth detection primer pair are 255 bp and 211 bp, respectively, then the rice to be detected is a heterozygous OsQHB genotype.
3. A rice breeding method, characterized in that: The OsQHB genotype of rice is identified based on the identification method according to any one of claims 1 to 2, and rice with the OsQHB genotype having more crown roots is selected as candidate rice for rice breeding.