Construction method of a hypertension mouse model and use thereof

By knocking in the PNO1 gene into a mouse model, a hypertensive mouse model with systemic overexpression was constructed, overcoming the limitations of existing hypertension models, enabling efficient screening of hypertension drugs and disease research, and providing research on the pathogenesis and treatment of hypertension.

CN118402502BActive Publication Date: 2025-11-07FUJIAN UNIV OF TRADITIONAL CHINESE MEDICINE
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410497706.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-04-24
Publication Date
2025-11-07
Estimated Expiration
2044-04-24

AI Technical Summary

Technical Problem

Existing animal models of hypertension have limitations. They are difficult to accurately simulate the pathogenesis of human hypertension and provide an effective drug screening platform. Furthermore, they are costly to study and make it difficult to gain a deeper understanding of the molecular mechanisms of hypertension and identify therapeutic targets.

Method used

The PNO1 gene was knocked into mice using the Cre-loxp system to construct a hypertensive mouse model with systemic overexpression of PNO1. This model was used to screen drugs for the prevention and treatment of hypertension and to study the pathogenesis and etiology of hypertension.

Benefits of technology

It provides a more accurate hypertension model, enabling rapid research into the pathogenesis and treatment of hypertension, reducing research costs, and providing an effective platform for screening hypertension drugs, thus enabling the identification of effective antihypertensive treatments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004807728210000101
    Figure BDA0004807728210000101
  • Figure BDA0004807728210000112
    Figure BDA0004807728210000112
  • Figure BDA0004807728210000113
    Figure BDA0004807728210000113
Patent Text Reader

Abstract

The application discloses a method for constructing a hypertension mouse model and application of the mouse model. The application discloses application of PNO1 in at least one of the following: 1) screening of hypertension treatment or prevention drugs; and 2) preparation of a hypertension mouse model. The application also discloses a method for constructing a hypertension mouse model. The mouse model constructed by the method presents typical hypertension symptoms, and can be used for preparation or screening of drugs for related diseases with PNO1 as a target, in particular, preparation or screening of hypertension drugs; and the mouse model can also be used for pathogenesis and etiology of hypertension.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and particularly relates to a method for constructing a hypertensive mouse model and use thereof. BACKGROUND

[0002] PNO1 (Partner of NOB1 homolog), also named Dim2, Rrp2 or Yor145, is a highly conserved ribosome regulatory factor from yeast to mammals. The human PNO1 gene is located on chromosome 2Q14, including 7 exons. The full-length cDNA sequence (1637bp) of PNO1 contains a 759bp open reading frame, encoding a 252 or 248 residue protein containing a conserved C-terminal KH domain responsible for RNA binding. In eukaryotes, ribosome biogenesis is achieved through the coordinated action of more than 200 assembly factors, including helicases, ATPases, GTPases and kinases, which are added to the 40S precursor at different times of ribosome maturation, and then released from the 40S precursor. PNO1 protein is a nucleolar protein, which plays a key role in ribosome biogenesis as an RNA-binding protein. Its main function is to regulate the synthesis of proteasome and the cleavage of 18S base by binding with NOB1. The absence of PNO1 will lead to the reduction of 18S and 40S subunit synthesis, which is regulated by various cell regulatory proteins such as CDK1 / 2, Rb and p53. Mutations or functional abnormalities of PNO1 are closely related to human diseases. At present, it has been reported that PNO1 is related to the proliferation, invasion and metastasis of breast cancer, and PNO1 is also related to human lung cancer. In addition, PNO1 can be used as a biomarker for colorectal cancer. However, there is no report on the correlation between PNO1 and cardiovascular diseases.

[0003] Hypertension is a common cardiovascular disease that poses a serious threat to global health. According to statistics, more than 1 billion people worldwide suffer from hypertension, and a large proportion of cases are not effectively controlled. Hypertension is considered one of the main risk factors for cardiovascular disease, kidney disease and stroke, and other serious consequences. However, modern medicine still has many cognitive deficiencies in the exact cause and pathogenesis of hypertension. Therefore, the study of hypertensive animal models helps humans to better understand the pathogenesis, drug treatment and pathophysiology of hypertension, and to develop new treatment strategies.

[0004] Hypertensive animal models can be classified according to their mechanism of inducing hypertension, species and use. At present, some common classification of hypertensive animal models mainly includes the following several kinds: 1. Genetic hypertension model. 2. Exogenous hypertension model. 3. Drug-induced hypertension model. 4. Genetic engineering hypertension model. However, the first four kinds of models have certain limitations: such as genetic hypertension model, spontaneous hypertension rats are bred by selection, which is different from human disease, and has defects in immune function; Exogenous hypertension model of two-kidney two-clamp and one-kidney one-clamp model is limited to the study of severe complications of hypertension; Drug-induced hypertension model is affected by the concentration of drug administration. Therefore, it is of great significance to seek a new and more ideal hypertension animal model for the study of the pathogenesis and drug treatment of hypertension.

[0005] Genetic engineering hypertension model simulates hypertension by manipulating the genes of animals. For example, specific genes can be introduced or knocked out to study their effects on hypertension. It is a hot research topic, which has obvious advantages, including: 1. Precise control of gene variation, which helps to study the effects of specific genes on hypertension and better understand the pathophysiological mechanisms; 2. Simulate genetic hypertension, many human hypertension cases are related to genetic genes, and the use of transgenic animals can better simulate this genetic hypertension to study the mechanisms of hypertension related to these genetic variations; 3. Save research time and cost, compared with naturally developed hypertension animal models, the results of transgenic animal models can usually be produced faster. This helps to accelerate hypertension research and drug development; 4. Provide a drug screening platform, transgenic animal models can be used as a high-throughput drug screening platform to evaluate potential hypertension treatment drugs. This can accelerate the discovery and development of new drugs; 5. In-depth study of molecular mechanisms, by studying transgenic animals, the role of specific genes or signaling pathways in hypertension pathology can be understood in depth, thereby identifying new therapeutic targets. Therefore, the preparation of transgenic hypertension model can provide effective guidance for the diagnosis and treatment of hypertension. SUMMARY

[0006] In view of the above-mentioned disadvantages of the prior art, the purpose of the present application is to provide a construction method of a hypertensive mouse model and its use, thereby solving the problems in the prior art.

[0007] To achieve the above-mentioned objects and other related objects, the present application is obtained by the following technical solutions.

[0008] The first aspect of the present application protects the use of PNO1 in at least one of the following: 1) screening of hypertension prevention and / or treatment drugs; 2) preparation of a hypertensive mouse model.

[0009] The second aspect of the present application protects a method for constructing a hypertensive mouse model, wherein PNO1 is knocked into a mouse by using a Cre-loxp system to obtain the hypertensive mouse model.

[0010] The third aspect of the present application protects the use of the hypertensive mouse model obtained by the method for constructing as described above in at least one of the following: A1) screening of a hypertensive prevention and / or treatment drug; A2) research of the pathogenesis and etiology of hypertension.

[0011] The fourth aspect of the present application protects a method for screening a candidate drug for preventing and / or treating hypertension, comprising the following steps: administering the drug to the hypertensive mouse model obtained by the method for constructing as described above, and screening the candidate drug by comparing the changes of the hypertensive mouse model before and after the administration.

[0012] The fifth aspect of the present application protects the use of a PNO1 inhibitor in the preparation of a product for preventing and / or treating hypertension.

[0013] The technical solution of the present application has the following beneficial effects:

[0014] The PNO1 hypertensive mouse model constructed by the method for constructing provided by the present application is mated with a Cre tool mouse to achieve specific overexpression in various tissues and organs, cell types in the whole body. The hypertensive mouse model can be used to prepare or screen drugs for related diseases with PNO1 as a target, in particular, to screen treatment and / or prevention drugs for hypertension; the mouse model can also be used for the pathogenesis and etiology of hypertension. In addition, the present application also finds that PNO1 can be used as an effective target for screening products for preventing, treating or diagnosing hypertension. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 A graph showing the expression level of PNO1 in the abdominal aorta of the AngII-induced hypertensive mouse model in Example 1 of the present application.

[0016] Figure 2A A graph showing the construction strategy of the targeting vector in Example 2 of the present application.

[0017] Figure 2B A graph showing the construction strategy of the plasmid VB009-fv in Example 2 of the present application.

[0018] Figure 2C A graph showing the linearized targeting vector in Example 2 of the present application.

[0019] Figure 2D A graph showing the PCR verification results of the targeting vector in Example 2 of the present application.

[0020] Figure 3AFigure showing PCR identification strategy of positive clones in Example 2 of the present application.

[0021] Figure 3B Figure showing PCR identification of 30 positive clone cells in Example 2 of the present application, part 1.

[0022] Figure 3C Figure showing PCR identification of 30 positive clone cells in Example 2 of the present application, part 2.

[0023] Figure 3D Figure showing PCR identification of 30 positive clone cells in Example 2 of the present application, part 3.

[0024] Figure 3E Figure showing Southern Blot analysis of 6 positive clones in Example 2 of the present application.

[0025] Figure 4A Figure showing PCR identification strategy of F1 hybrid mice in Example 2 of the present application.

[0026] Figure 4B Figure showing PCR identification of Kl 1 in Example 2 of the present application, part 1.

[0027] Figure 4C Figure showing PCR identification of Kl 2 in Example 2 of the present application, part 2.

[0028] Figure 5 Figure showing Western-Blot detection results of PNOl expression in heart, liver, spleen, lung, brain, and blood vessel tissues in Example 2 of the present application.

[0029] Figure 6 Figure showing blood pressure detection results of mice in each group in Example 3 of the present application.

[0030] Figure 7 Figure showing heart function detection results of mice in each group in Example 3 of the present application.

[0031] Figure 8 Figure showing abdominal aorta blood vessel function detection results of mice in each group in Example 3 of the present application.

[0032] Figure 9 Figure showing mesenteric artery blood vessel function detection results of mice in each group in Example 3 of the present application.

[0033] Figure 10 Figure showing renal artery blood vessel function detection results of mice in each group in Example 3 of the present application.

[0034] Figure 11A graph showing the blood pressure detection results of each group of mice in Example 4 of the present application. DETAILED DESCRIPTION

[0035] The present application accidentally found that the expression of PNO1 in the abdominal aorta of the mouse model induced by AngII was significantly increased; then, PNO1 was knocked into mice and a hypertensive mouse model was constructed, and it was found that the expression level of PNO1 in the heart, brain, lung, spleen and other systemic tissues of the hypertensive mouse model was increased; further, the effects of knocking in PNO1 in the hypertensive mouse model on blood pressure, heart, abdominal aorta vascular function, mesenteric artery vascular function, renal artery vascular function and the like were studied, and it was found that overexpression of PNO1 would cause the mouse to present a high blood pressure related performance. Therefore, the hypertensive mouse model constructed by the present application presents typical symptoms of hypertension, and can be used for subsequent research on the pathogenesis and etiology of hypertension, as well as diagnosis of hypertension disease and screening of drugs for treating hypertension. On this basis, the present application is completed.

[0036] The first aspect of the present application protects the use of PNO1 in at least one of the following:

[0037] 1) screening of drugs for preventing and / or treating hypertension; 2) preparation of a hypertensive mouse model.

[0038] In some embodiments, screening of drugs for preventing and / or treating hypertension refers to using PNO1 as a target of drug action, screening or designing drugs capable of antagonizing the biological function mediated by the target, so as to screen out drugs for preventing or treating hypertension. Drug screening is usually achieved through a drug screening model, which includes in vivo and in vitro models. The in vivo model usually adopts an animal model such as a mouse, a rat, a pig, a monkey, etc.; the in vitro model usually refers to research in vitro, such as in vitro cell experiments, tissue section experiments, etc., and the in vitro cell experiments include human cells, animal cells or bacteria, etc.

[0039] The PNO1 gene in the present application has the number NM_025443.2 in the NCBI database and the number ENSMSUG0000002016 in the Ensembl database, and is located on chromosome 11 of the mouse. The CDS sequence comprises the sequence shown in SEQ ID NO. 1.

[0040] Atggagacgcaaagcaccggaacggaggacggctttactcccgtcacgcacagagggggccgccgggcgaagaaacgacaggctgagc

[0041] agtcgtcagcggcgggacaggatggagaagccggacgcatggacacggaggaggcgcggccggcgaagaggccggtcttcccgccgct

[0042] ctccggggatcagctcctgactgggaaagaagaaacgaggaaaattcccgtcccaggtaacagatacacaccgttgaaagaaaactggatga

[0043] agatatttactccgattgtagaacatttgggacttcagatacgctttaacctgaaatcaaggaatgtagaaatcaggacttgtaaagacaccaagga

[0044] tgtcagtgccctgacaaaagcggccgactttgtgaaagcctttgttcttggctttcaggtggaggatgcacttgcccttatccgactagatgacctct

[0045] tcctagagtcttttgaaataactgatgttaagcccctaaaaggagaccacctgtcaagggcaataggaagaattgctggcaaaggaggaaaaac

[0046] caaatttaccatagagaacgtaacacggacacggattgtcctggcagatgtgcacgttcacattcttggctctttccaaaatatcaagatggcaag

[0047] aacagctatttgcaacctcatcctaggaaatcctccatcaaaggtgtatggcaatatccgagctgtggccagcagatcagcagatcggttctga(SEQ ID NO.1)

[0048] The second aspect of the present application protects a method for constructing a hypertensive mouse model, wherein PNO1 is knocked into a mouse by using a Cre-loxp system to obtain the hypertensive mouse model.

[0049] The application successfully constructs an inducible hypertensive mouse model by a genetic modification method, the PNO1 in the mouse model is overexpressed in the whole body, which leads to the increase of blood pressure of the mouse, the decrease of cardiac ejection fraction, the shortening of cardiac short axis, the thickening of abdominal aorta vascular wall, the increase of abdominal aorta pulse wave propagation speed, the increase of mesenteric artery resistance index, the increase of mesenteric artery pulsatility index, the increase of renal artery resistance index, and the increase of renal artery pulsatility index.

[0050] The application obtains a stably heritable hypertensive mouse model by precise modification of genetic material DNA, and does not need subcutaneous injury modeling. Compared with the Ang II induced hypertensive mouse model, the application finds that the PNO1 knock-in in the Ang II induced hypertensive mouse has a more obvious increase in blood pressure, and can be better used for pathogenesis and treatment research of diseases.

[0051] In certain embodiments, the Cre-loxp system comprises a targeting vector which recognizes and cleaves a friendly site, and the targeting vector comprises the following expression frame: promoter-Loxp-3*SV40-Loxp-PNO1-polyA.

[0052] In certain specific embodiments, the friendly site is selected from the Rosa26, Hprt and hipp11 gene sites. Preferably, it is Rosa26. The most classic method for integrating an exogenous gene into a cell is transfection or injection of linearized DNA, so as to achieve random and non-specific integration of the friendly site. A genome site suitable for benign insertion and expression of an exogenous gene is important. The friendly site, also known as a safe harbor, is a site that is generally recognized as having little effect on cells or living bodies and can stably express after knock-in of the target gene. Rosa26 is a non-coding gene located on chromosome 6 of mice, which is composed of three exons. Because this region is easy to perform gene insertion operation, and because it has not been found to express functional proteins, and because it is easy to perform homologous recombination, the proteins inserted into this region can be well expressed, and will not affect the expression and function of other endogenous genes, and has wide expression in all cell types and developmental stages, so the Rosa26 site of mice is often used as a safe site for gene targeting.

[0053] In certain embodiments, the Loxp comprises the sequence shown in SEQ ID NO. 2.

[0054] ataacttcgtatagcatacattatacgaagttat (SEQ ID NO. 2)

[0055] In certain specific embodiments, the 3*SV40 (same as 3*ployA) comprises the sequence shown in SEQ ID NO. 3.

[0056] In some embodiments, the promoter is a CAG promoter. The CAG promoter comprises the sequence set forth in SEQ ID NO. 4.

[0057] In some embodiments, the polyA comprises the sequence set forth in SEQ ID NO. 5.

[0058] In some embodiments, the targeting vector further comprises a DTA element, which is located upstream of the promoter. The DTA comprises the sequence set forth in SEQ ID NO. 6.

[0059] In some embodiments, the targeting vector further comprises a Neo element, which is located downstream of the polyA. Preferably, the Neo is flanked by SDA. The Neo comprises the sequence set forth in SEQ ID NO. 7.

[0060] In some embodiments, the targeting vector further comprises a left homology arm and a right homology arm, wherein the left homology arm is a homology arm homologous to the 5' end of the friendly site sequence, and the right homology arm is a homology arm homologous to the 3' end of the friendly site sequence. The left homology arm comprises the sequence set forth in SEQ ID NO. 8, and the right homology arm comprises the sequence set forth in SEQ ID NO. 9. In some embodiments, the left and right homology arms of the ROSA26 gene exon are amplified by PCR using the C57BL / 6BAC mouse genome as a template.

[0061] In some more specific embodiments, the targeting vector comprises: DTA-left homology arm-CAG promoter-Loxp-3*SV40-Loxp-PNOl-polyA-SDA-Neo-SDA-right homology arm. Specifically, the targeting vector comprises the sequence set forth in SEQ ID NO. 10 and SEQ ID NO. 20.

[0062] In some more specific embodiments, the method comprises the following steps:

[0063] 1) transfecting the targeting vector as described above into embryonic stem cells, and then transplanting into surrogate mice to obtain PNOl knock-in mice;

[0064] 2) crossing the PNOl knock-in mice with Cre tool mice to obtain the hypertensive mouse model.

[0065] The application inserts the "promoter-Loxp-3*SV40-Loxp-PNOl-polyA" expression frame into the first intron 1 of ROSA26 of the mouse by the targeting vector described above, to obtain a floxed mouse. Before the floxed mouse is crossed with a mouse expressing Cre recombinase, Loxp-3*SV40-Loxp will prevent the transcription of the transgene, resulting in no expression of the PNOl gene; after the floxed mouse is crossed with a mouse expressing tissue-specific (systemic) Cre enzyme, in each cell expressing Cre recombinase, Loxp-3*SV40-Loxp is excised by Cre, thus obtaining a hypertensive mouse model expressing the exogenous PNOl gene in a tissue-specific (systemic) manner.

[0066] In some embodiments, the method further comprises introducing the targeting vector into ES cells of the mouse by ES targeting to obtain a gene knock-in mouse. Positive ES cells are selected and identified by positive and negative screening. The ES cells are derived from C57BL / 6, BALB / c, ICR and KM mice. Specifically, the ES cells are derived from C57BL / 6 mice. The means for introducing into the mouse include but are not limited to various transformation or transfection methods, such as calcium phosphate, liposome-mediated chemical transfection method, gene gun, electroporation, microinjection and other physical methods. Further, the identified positive ES cells are cloned and injected into C57BL / 6N embryos, and then implanted into a pseudopregnant female to obtain a gene knock-in mouse. The primers for PCR identification include the sequences shown in SEQ ID No. 11-SEQ ID No. 16.

[0067] In some embodiments, the mouse is selected from C57BL / 6, BALB / c, ICR and KM mice. Most preferably, the mouse is a C57BL / 6 mouse.

[0068] In some embodiments, the method of construction further comprises identifying the genotype and phenotype of the gene knock-in mouse, such as identifying the genotype of the gene knock-in animal by PCR, Southern blotting and the like, and identifying the expression and distribution of the target gene, such as the PNOl gene, by real-time RT PCR, Western blotting and immunofluorescence and the like. Preferably, the genotype is identified by PCR, and the primers for PCR identification include the sequences shown in SEQ ID No. 17-SEQ ID No. 19.

[0069] The application constructs an embryonic stem cell (ES cell) targeting vector by the method of In-Fusion Cloning, linearizes, and proves that the targeting plasmid is successfully constructed by enzyme digestion identification; C57BL / 6 ES cells are electroporated, and resistant ES cell clones are obtained by drug screening, a total of 185 resistant ES cell clones are obtained, the positive clones of homologous recombination are screened and cloned by long fragment PCR, and a total of 6 positive clones 2G5 of correct homologous recombination are obtained; the positive clone 2G5 is injected into a blastocyst of a C57BL / 6 mouse, a chimeric mouse is obtained, and 10 chimeric mice are screened out; the chimeric mouse is mated with a wild-type C57BL / 6 mouse to obtain a positive F1 generation mouse, and the F1 generation mouse is identified by PCR and sequencing. Conclusion: The Rosa26 site-specific knock-in F1 generation hybrid mouse of the PNO1 gene is successfully established, which lays a foundation for obtaining a systemic PNO1 gene knock-in mouse in the future.

[0070] The application obtains a systemic knockout mouse by using a transgene or gene knock-in Cre mouse of Cre recombinase expressed systemically through a LoxP site, such as Ella-Cre.

[0071] The third aspect of the application protects the use of the hypertensive mouse model obtained by the construction method as described above in at least one of the following: A1) screening of hypertensive prevention and / or treatment drugs; A2) studying the pathogenesis and etiology of hypertension.

[0072] The fourth aspect of the application protects a method for screening a candidate drug for preventing and / or treating hypertension, comprising the following steps: administering the drug to the hypertensive mouse model obtained by the construction method as described above, and screening the candidate drug by comparing the changes of the hypertensive mouse model before and after administration.

[0073] The fifth aspect of the application protects the use of a PNO1 inhibitor in the preparation of a product for preventing and / or treating hypertension.

[0074] The PNO1 inhibitor has at least one of the following effects:

[0075] 1) improving vascular function reduction;

[0076] 2) improving cardiac function reduction;

[0077] 3) improving vascular wall thickening.

[0078] In some embodiments, the blood vessels include one or more of renal artery blood vessels, mesenteric artery blood vessels, and abdominal aorta blood vessels.

[0079] In some embodiments, the PNOl inhibitor can include, but is not limited to, a nucleic acid molecule, a small molecule chemical, an antibody, a polypeptide, a protein, a nucleic acid construct, an interfering lentivirus, an interfering adeno-associated virus, and an editing system, etc. that can inhibit the transcription or translation of the PNOl gene, or can inhibit the expression or activity of the PNOl protein.

[0080] More preferably, the PNOl inhibitor is a nucleic acid molecule. The nucleic acid molecule can be selected from, but not limited to, an antisense oligonucleotide, a double-stranded RNA, or an shRNA. Further, the double-stranded RNA can be synthesized by chemical methods, and then injected into the human body to silence the PNOl gene by RNA interference to treat hypertension; or a mutant of PNOl can be designed and constructed, and then injected into the cell to compete with the original PNOl for the substrate, thereby inhibiting the function of PNOl to achieve the treatment purpose.

[0081] The above description is only used to explain the specific embodiments of the present application. Those skilled in the art can easily understand other advantages and effects of the present application from the above description. The present application can also be implemented or applied by other different specific embodiments, and the details in the description can be modified or changed based on different views and applications without departing from the spirit of the present application.

[0082] Before further describing the specific embodiments of the present application, it should be understood that the scope of protection of the present application is not limited to the following specific embodiments; it should also be understood that the terms used in the embodiments of the present application are used to describe the specific embodiments, but not to limit the scope of protection of the present application; in the description and claims of the present application, the singular form "a", "an" and "the" include the plural form, unless otherwise explicitly stated in the text.

[0083] When the embodiments give numerical ranges, it should be understood that, unless otherwise stated by the present application, each numerical range of two endpoints and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present application have the same meaning as generally understood by those skilled in the art. In addition to the specific methods, devices, materials used in the embodiments, any method, device and material of the prior art similar or equivalent to those described in the embodiments of the present application can also be used to implement the present application according to the master of the prior art and the description of the present application by those skilled in the art.

[0084] Example 1

[0085] 1.1, Experimental animals

[0086] The experimental animals were SPF C57BL / 6 male mice, weighing 19±1 g. The animal experiments were performed according to the Guidelines for the Care and Use of Laboratory Animals issued by the Ministry of Science and Technology of the People's Republic of China in 2006.

[0087] The experimental animals were bred in the SPF laboratory of the Experimental Animal Center of Fujian University of Traditional Chinese Medicine, and were free to eat and drink. The room was well ventilated and well lit, with room temperature controlled at (24±2) °C, relative humidity of about 50-60%, 12h light / dark cycle, and the feeding environment was quiet and undisturbed. After 5-7 days of adaptive feeding, the mice were used for experiments.

[0088] An appropriate amount of AngII powder was dissolved in high-pressure water to prepare a mother liquor with a concentration of 1 mM. After preparation, it was stored in a -80°C refrigerator for standby, and an AngII solution was obtained.

[0089] 1.2, Construction of AngII-induced hypertensive model

[0090] On the day of the operation, the operating table was routinely disinfected, and the mice were anesthetized with isoflurane in a prone position. The skin on the back of the head and neck was shaved, disinfected with iodophor, and cut open with scissors. The subcutaneous tissue was bluntly separated, and the mouse was given a pre-set osmotic mini-pump containing 200 μL of AngII solution (2.952 mg / mL). Then the skin was sutured and disinfected. It was marked as the WT+AngII group.

[0091] At the same time, the WT+NS group was set up, which was a pre-set osmotic mini-pump containing the same volume of normal saline, and the rest was the same as the WT+AngII group.

[0092] 1.3, Immunohistochemical experiment

[0093] After 4 weeks of induction, the mice in each group were sacrificed after isoflurane anesthesia. The abdominal aorta tissue of the mouse was stripped and fixed in 4% paraformaldehyde for 24 h, then dehydrated with different concentrations of ethanol, replaced with ethanol by immersing in xylene, immersed in wax, and the tissue block was cut into 4 μm slices by a microtome. After dewaxing, the tissue was repaired with 100 ℃ citrate for 10 min, cooled and then restored to room temperature; endogenous peroxidase was added dropwise for 10 min, and PBS was washed for 3 times, each for 5 min; the blocking solution was used for blocking at room temperature for 1 h, and the primary antibody (proteintech, 21059-1-AP) was incubated; the next day, the mouse / rabbit secondary antibody (Fuzhou Mayxin Biotechnology Development Co., Ltd., KIT-9710) was treated for 1 h, and the streptomycin was treated for 1 h, and PBS was washed for 3 times, each for 5 min; after DAB color reagent staining, hematoxylin staining was performed, and ultrapure water was used for blue returning for 5 min, and then the blow dryer was used for drying, and neutral gum was used for mounting; the glass slide was imaged by an intelligent automatic optical microscope at 400 times, 6 fields of view were randomly selected for each sample, and then the protein expression of each group was analyzed by ImageJ software and statistically analyzed.

[0094] The data were statistically analyzed using SPSS 26.0 software (SPSS / PC+). Shapiro-Wilk test was used to test the normality of the data. The data were represented as mean ± standard deviation. When comparing the differences between two groups of data, for the data that met the normal distribution and homogeneity of variance, P<0.05 was considered to be statistically different. All data analysis was performed in SPSS 26.0.

[0095] 1.4, Expression of PNO1 in the abdominal aorta of mice

[0096] The detection results of the expression of PNO1 in the abdominal aorta of mice in each group are shown in Figure 1 .

[0097] It can be seen from Figure 1 that by detecting the expression of PNO1 in the abdominal aorta of AngII-induced hypertensive mice by immunohistochemistry, the expression of PNO1 in the WT+AngII group of mice was significantly increased, and the difference was statistically significant (*P<0.05).

[0098] Example 2 Construction of PNO1 hypertensive mouse model

[0099] On the basis of Example 1, further according to the mouse model construction strategy of Figure 2A , a PNO1 hypertensive mouse model was constructed, and the process was as follows: the constructed targeting vector was electroporated into embryonic stem cells to form an ES clone, and the ES clone was screened by PCR. The correct clone was injected into a blastocyst and finally a homozygous mouse with PNO1 gene knock-in was constructed. It includes the following:

[0100] 2.1, Construction of the vector

[0101] The Rosa26 gene, with the accession number NR_027008.1 in the NCBI database, is located on chromosome 6 of the mouse. The Rosa26 gene can encode a non-essential nuclear RNA in almost all tissues, and can enable the whole-body expression of inserted foreign genes without affecting the expression of other genes.

[0102] 1) The left and right homologous arms were amplified from the C57BL / 6N mouse library BAC clone using high-fidelity Taq DNA polymerase;

[0103] 2) The mouse Pno1 CDS was inserted into the plasmid VB009-fv (the plasmid map is shown in Figure 2B ) by homologous recombination arms to obtain a recombinant expression vector, which comprises the following expression frame:

[0104] DTA-5'arm-CAG Promoter-Loxp-3*SV40-Loxp-Pno1 CDS-polyA-SDA-Neo-SDA-3'arm

[0105] Wherein: Neo is a neomycin resistance gene, serving as a positive selection marker; SDA is a self-deletion anchor point; DTA is a toxin gene, serving as a negative selection marker.

[0106] The sequence of the mouse Pno1 CDS is shown in SEQ ID NO. 1, the sequence of the 5' homologous arm is shown in SEQ ID NO. 8, the sequence of the 3' homologous arm is shown in SEQ ID NO. 9, and the sequence of the targeting vector is shown in SEQ ID No. 10 and SEQ ID NO. 20.

[0107] The targeting vector was linearized using Notl enzyme, and the schematic diagram of the linearized targeting vector is shown in Figure 2C .

[0108] The targeting vector was subjected to enzyme digestion verification, and the enzyme digestion results are shown in Figure 2D . It can be seen from Figure 2D that the electrophoresis bands after enzyme digestion all meet the expectations.

[0109] 2.2, ES electroporation and positive clone screening

[0110] 2.2.1, ES electroporation, G418 resistance screening

[0111] The linearized targeting vector was then extracted with phenol / chloroform and precipitated with ethanol. The linearized targeting vector was electroporated into C57BL / 6 ES (Embryonic Stem) cells according to the standard electroporation procedure of cyagen. The electroporation parameters were set as 240V, 500μF.

[0112] G418 (200μg / mL) selection was performed 24 hours after electroporation of ES cells. 185 G418 resistant clones were selected and expanded in 96-well plates for PCR screening of homologous recombination. 30 potential target clones were obtained by PCR screening, and 6 of them were further identified by Southern blot analysis, all of which were identified as correct positive clones.

[0113] 30 cell clones were identified, and the primer design strategy for positive cell monoclonal PCR identification is shown in Figure 3A , in which the right homologous arm fragment primer pair, KI1 fragment primer pair and KI2 fragment primer pair were designed respectively.

[0114] (1) PCR of the right homologous arm (3-arm)

[0115] The primers for PCR are as follows:

[0116] Neo-F (P1): 5'-TCGACTAGAGCTTGCGGAACCCT-3' (SEQ ID No. 11)

[0117] 3arm-R (P2): 5'-AAGACACCAGTTTCAGCCCAAGTTC-3' (SEQ ID No. 12)

[0118] The reaction system is shown in Table 1, and the reaction procedure is shown in Table 2.

[0119] Table 1

[0120] Ingredients Volume (μL) ES cell genomic DNA 2.0 Upstream primer F 0.8 Downstream primer R 0.8 dNTPs (2.5 mM) 2.4 5x LongAmp Taq Reaction 4.0 LongAmp Taq DNA Polymerase 1.2 ddH2O 8.8 Total volume 20.0

[0121] Table 2

[0122]

[0123] The results of PCR are shown in Figure 3B .

[0124] As can be seen from Figure 3B , the PCR amplification products of the 30 clones are as expected, with a length of 4.5kb.

[0125] (2) PCR of KI1

[0126] The primers for PCR are as follows:

[0127] Kl 1-F (P3): 5'-CAAAGCTGAAAGCTAAGTCTGCAG-3' (SEQ ID No. 13)

[0128] Kl 1-R (P4): 5'-GGGCCATTTACCGTAAGTTATGTAACG-3' (SEQ ID No. 14)

[0129] The reaction system is shown in Table 3, and the reaction procedure is shown in Table 4.

[0130] Table 3

[0131] Ingredients Volume (μL) ES cell genomic DNA 1.5 Upstream primer F 1.0 Downstream primer R 1.0 P112 Taq DNA Polymerase 12.5 ddH2O 9.0 Total volume 25.0

[0132] Table 4

[0133]

[0134] The PCR results are shown in Figure 3C .

[0135] It can be seen from Figure 3C that the PCR amplification products of the 30 clones are as expected, with a length of 399 bp.

[0136] (3) PCR of KI2

[0137] Kl 1-F (P5): 5'-CAACGTGCTGGTTATTGTGCTGTCT-3' (SEQ ID No. 15)

[0138] Kl 1-R (P6): 5'-TGGTGGCCACGTGTAGTGGATCC--3' (SEQ ID No. 16)

[0139] The reaction system is shown in Table 5, and the reaction procedure is shown in Table 6.

[0140] Table 5

[0141] Ingredients Volume (μL) ES cell genomic DNA 2 Upstream primer F 0.8 Downstream primer R 0.8 dNTPs (2.5 mM) 2.4 5x LongAmp Taq Reaction 4.0 LongAmp Taq DNA Polymerase 1.2 ddH2O 8.8 Total volume 20.0

[0142] Table 6

[0143]

[0144] The PCR results are shown in Figure 3D .

[0145] It can be seen from Figure 3D that the PCR amplification products of the 30 clones are as expected, with a length of 1.2 kb.

[0146] From (1), (2) and (3), it can be seen that 30 clones, 1A2, 1D1, 1B3, 1A6, 1E5, 1F6, 1G6, 1H5, 1B7, 1A10, 1E9, 1A12, 1G12, 2D1, 2D3, 2B6, 2D6, 2F6, 2G5, 2D7, 2D8, 2E8, 2G7, 2A9, 2D9, 2E10, 2C11, 2C12, 2D11 and 2G11, have been identified as potential ES targeting clones.

[0147] (4) further identified by Southern Blot

[0148] The 6 positive clones (1A10, 1B7, 2D3, 2D7, 2E8 and 2G5) screened from the 30 clones of step 2.2.1 were subjected to Southern blot analysis.

[0149] The genomic DNA was digested with EcoNI or EcoRV and hybridized with Neo probe, and the results are shown in Figure 3E .

[0150] From Figure 3E it can be seen that the fragment length is consistent with the expected value: -11.54 kb (digested with EcoNI) and ~10.95 kb (digested with EcoRV) by Southern blot analysis.

[0151] The positive clone 2G5 selected in step 1.2 was subsequently injected into the blastocyst of C57BL / 6 mice to obtain chimeric blastocysts.

[0152] 2.2.2, ES microinjection and chimeric preparation

[0153] The positive clone 2G5 screened in step 1.2 was subsequently injected into the blastocyst of C57BL / 6 mice to obtain chimeric blastocysts.

[0154] The chimeric blastocysts were transplanted into the uterus of CD-1 surrogate pregnant mice to obtain F0 chimeric mice with genotype PNO1flox / wt. The chimeric mice were identified by hair color.

[0155] 2.3, Construction of PNO1 knock-in mouse model

[0156] 2.3.1, The F0 chimeric mice obtained in step 1.3 were mated with wild-type C57 / BL6 mice, and the F1 heterozygous mice had genotype PNO1flox / flox.

[0157] From clone 2G5, 4 male (♂) heterozygous targeted mice and 6 female (♀) heterozygous targeted mice were produced. The 4 males were numbered 3, 4, 6 and 9, and the 6 females were numbered 7, 8, 11, 12, 13 and 14.

[0158] Mouse DNA was extracted and used as a template for PCR reaction with PCR primers. The PCR products were separated by agarose gel electrophoresis, and the band position was observed to determine whether the F1 hybrid mice contained the targeted allele; Neo was self-deleted in the germ cells, so the F0 chimeric mice did not have Neo.

[0159] Ten F1 hybrid mice were identified, and the identification primer design strategy is shown in Figure 4A The KI1 fragment primer pair, KI2 fragment primer pair, and Neo fragment primer pair were designed, respectively.

[0160] Identification was performed:

[0161] (1) KI1 PCR

[0162] The primers for PCR were as follows:

[0163] Kl1-F (F1): 5'-CAAAGCTGAAAGCTAAGTCTGCAG-3' (SEQ ID No. 13)

[0164] Kl1-R (R1): 5'-GGGCCATTTACCGTAAGTTATGTAACG-3' (SEQ ID No. 14)

[0165] The reaction system is shown in Table 7.

[0166] Table 7

[0167] Ingredients Volume (μL) Mouse genomic DNA 1.5 Upstream primer F 1.0 Downstream primer R 1.0 Premix Taq Polymerase 12.5 ddH2O 9.0 Total volume 25.0

[0168] The reaction procedure is shown in Table 8.

[0169] Table 8

[0170]

[0171] (2) KI2 PCR:

[0172] Kl1-F (P5): 5'-CAACGTGCTGGTTATTGTGCTGTCT-3' (SEQ ID No. 15)

[0173] Kl1-R (P6): 5'-TGGTGGCCACGTGTAGTGGATCC-3' (SEQ ID No. 16)

[0174] The reaction system is shown in Table 9, and the reaction procedure is the same as Table 8.

[0175] Table 9

[0176] Ingredients Volume (μL) Mouse genomic DNA 1.5 Upstream primer F (10 μM) 1.0 Downstream primer R (10 μM) 1.0 Premix Taq Polymerase 12.5 ddH2O 9.0 Total volume 25.0

[0177] (3) PCR of Neo:

[0178] Neo-del-F (F3): 5'-CAAAGGTGTATGGCAATATCCGAG-3' (SEQ ID No. 17)

[0179] Neo-del-R (R3): 5'-TTAGTAGCAAACAAGAGACCACATGG-3' (SEQ ID No. 18)

[0180] WT-F (F4): 5'-TTGAAGCATTCCCTAATGAGCCAC-3' (SEQ ID No. 19)

[0181] The reaction system is shown in Table 10, and the reaction procedure is the same as that in Table 8.

[0182] Table 10

[0183]

[0184]

[0185] The identification results are shown in Figure 4B and 4C . Figure 4A The control of ESC in the PNO1-KI mice.

[0186] From Figure 4B and 4C , it can be seen that the lengths of the PCR amplification products are 399 bp, 1173 bp and 555 bp, respectively, which are consistent with the expectations.

[0187] 2.3.2, Cross with Cre tool mice

[0188] The F1 hybrid mice were self-crossed to produce F2 homozygous mice, and the genotype was PNO1 + / - .

[0189] The F2 homozygous mice were mated with mice expressing EIIa Cre recombinase throughout the body to produce F3 mice, and the genotype was PNO1 + / - Cre-positive mice.

[0190] The F3 mice were self-crossed to obtain the PNO1 hypertensive mouse model PNO1-KI, and the genotype was PNO1 + / + . Cre recombinase functions to excise the transcription termination signal with loxP on both sides.

[0191] 2.4, Western-Blot detection

[0192] The PNO1 expression levels in different tissue organs of the knock-in PNO1 mice in step 2.3 were detected by Western-Blot, including heart, liver, spleen, lung, brain, and vascular tissue. The results are shown in Figure 5 .

[0193] It can be seen from Figure 5 that the total PNO1 expression levels in the heart, liver, spleen, lung, brain, and vascular tissue of the adult systemic PNO1 knock-in mice were increased, as proved by Western-Blot.

[0194] Example 3 Cardiovascular function of PNO1 knock-in mouse model

[0195] In this example, the effects of the PNO1 gene knock-in mice constructed in Example 3 on heart function and vascular function were investigated. The following were included:

[0196] 3.1, Experimental materials and methods

[0197] 3.1.1, Experimental drugs and main reagents

[0198] Isoflurane (Shenzhen Ruivode Life Science and Technology Co., Ltd., 970-00026-00); paraformaldehyde (Fuzhou Feijing Biological Technology Co., Ltd., LA0427), anhydrous ethanol (Xilong Science and Technology Co., Ltd., 1280340101602), dimethylbenzene (Xilong Science and Technology Co., Ltd., 1430030101600), and other chemical reagents.

[0199] 3.1.2, Main experimental instruments

[0200] Electronic balance scale (Shanghai Ohaus Instrument Co., Ltd.); non-invasive mouse tail blood pressure meter (Kent Company, USA); small animal ultrasound imaging system Vevo2100 (Fuji Film Investment Co., Ltd.); inhalation small animal anesthetic machine (Shenzhen Ruivode Life Science and Technology Co., Ltd.); pathological section machine (Leica Company, Germany); paraffin embedding machine (Hubei Xiaogan Yaguang Medical Electronic Technology Co., Ltd.).

[0201] 3.1.3, Animal grouping

[0202] Four 70-week-old WT male mice and six 70-week-old PNO1 systemic knock-in male mice were divided into the following two groups: WT-♂ group and PNO1-♂ group.

[0203] Six 70-week-old WT female mice and six 70-week-old PNO1 systemic knock-in female mice were grouped as follows: WT-♀ group and PNO1-♀ group.

[0204] The experimental animals were bred in the SPF laboratory of the Medical Experimental Animal Center of Fujian University of Traditional Chinese Medicine, and were free to eat and drink. The room was well ventilated and well lit, the room temperature was controlled at (23±1) °C, the relative humidity was about 50-60%, and the feeding environment was quiet and undisturbed. Sufficient food and water were given. All experimental operations complied with the experimental animal ethics and the regulations of the Medical Experimental Animal Center of Fujian University of Traditional Chinese Medicine.

[0205] 3.1.4. Measurement of blood pressure in mice

[0206] The non-invasive rat tail artery cannula method was used to detect the blood pressure of mice. The instrument used was CODA TM Non-invasive blood pressure monitoring system. First, the mouse was bound to the fixator and placed on a 35°C heating plate. The mouse was placed in a dark, quiet environment and kept in a stable state. The pressure blocker and volume pressure sensor were placed about 0.5 cm from the root of the mouse, and CODA TM The non-invasive blood pressure system detected the blood pressure, recorded the systolic blood pressure (SBP), diastolic blood pressure (DBP) and mean arterial pressure (MAP) of the mouse and took the average value for statistical analysis.

[0207] 3.1.5. Detection of heart, abdominal aorta, mesenteric artery and renal artery function in mice

[0208] The Vevo2100 high-resolution ultrasound instrument was used to detect the heart, abdominal aorta, mesenteric artery and renal artery function in mice. Before detection, the mouse was shaved on the chest and abdomen, and the mouse was anesthetized with isoflurane (1.5% maintenance), and was placed in a supine position on a 37°C detection platform. The mouse's limbs were fixed to the electrode leads, and the mouse's heart rate was controlled at about 450bp. Coupling agent was applied to the mouse's chest and abdomen, and a 30MHz frequency ultrasound probe was used to read the M-mode ultrasound image to measure the left ventricular internal diameter, abdominal aorta, mesenteric artery and renal artery section.

[0209] The left ventricular ejection fraction and fractional shortening, abdominal aorta pulse wave propagation velocity and vascular wall thickness, mesenteric artery and renal artery resistance index and pulsation index of each group of mice were calculated.

[0210] 3.1.7. Statistical analysis

[0211] Statistical analysis was performed using SPSS 26.0 software (SPSS / PC+). The Shapiro-Wilk test was used to test the normality of the data. Data are expressed as mean ± standard deviation. When comparing differences between two groups, a p-value < 0.05 was considered statistically significant for data that are normally distributed and homogeneous in variance. All data analyses were performed in SPSS 26.0.

[0212] 3.2 Experimental Results

[0213] 3.2.1 Effects of PNO1 knock-in on blood pressure and weight

[0214] The blood pressure monitoring results of each group of mice are shown in the figure. Figure 6 .

[0215] from Figure 6 It can be seen that, compared with the WT-♂ group, the blood pressure of the PNO1-KI-♂ group mice, including systolic blood pressure (…), was significantly lower. Figure 6 (A) Diastolic blood pressure ( Figure 6 (B) and mean arterial pressure ( Figure 6 The blood pressure (including systolic blood pressure) of mice in the PNO1-KI-♀ group was significantly increased (*P<0.05); compared with the WT-♀ group, the blood pressure of mice in the PNO1-KI-♀ group was significantly increased (*P<0.05); Figure 6 (A) Diastolic blood pressure ( Figure 6 (B) and mean arterial pressure ( Figure 6 The C level was significantly elevated (#P < 0.05).

[0216] In summary, PNO1 knock-in can lead to increased blood pressure.

[0217] 3.2.2 Effects of PNO1 knock-in on cardiac function

[0218] The cardiac test results of each group of mice are shown below. Figure 7 .

[0219] from Figure 7 It can be seen that, compared with the WT-♂ group, the cardiac ejection fraction of the PNO1-KI-♂ group mice was significantly lower. Figure 7 (B) and cardiac short-axis shortening rate ( Figure 7 The cardiac ejection fraction (C) was significantly reduced (*P<0.05); compared with the WT-♀ group, the cardiac ejection fraction (C) of mice in the PNO1-KI-♀ group was significantly reduced (*P<0.05); Figure 7 (B) and cardiac short-axis shortening rate ( Figure 7 The C value was significantly reduced (#P<0.05).

[0220] In summary, systemic knock-in of PNO1 reduces cardiac function in mice.

[0221] 3.2.3 Effects of PNO1 knock-in on abdominal aortic vascular function

[0222] The results of abdominal aorta vascular function detection of mice in each group are shown in Figure 8 .

[0223] As can be seen from Figure 8 , compared with the WT-♂ group, the abdominal aorta vascular wall thickness (B in Figure 8 ), the abdominal aorta pulse wave propagation speed (C in Figure 8 ) of the PNO1-KI-♂ group mice were significantly increased (*P<0.05); compared with the WT-♀ group, the abdominal aorta vascular wall thickness (B in Figure 8 ), the abdominal aorta pulse wave propagation speed (C in Figure 8 ) of the PNO1-KI-♀ group mice were significantly increased (#P<0.05).

[0224] In summary, PNO1 knock-in reduces the abdominal aorta vascular function of mice.

[0225] 3.2.4, Effect of PNO1 knock-in on mesenteric artery vascular function

[0226] The results of mesenteric artery vascular function detection of mice in each group are shown in Figure 9 .

[0227] As can be seen from Figure 9 , compared with the WT-♂ group, the resistance index (C in Figure 9 ) and the pulsatility index (B in Figure 9 ) of the mesenteric artery of the PNO1-KI-♂ group mice were significantly increased (*P<0.05); compared with the WT-♀ group, the resistance index (C in Figure 9 ) and the pulsatility index (B in Figure 9 ) of the mesenteric artery of the PNO1-KI-♀ group mice were significantly increased (#P<0.05).

[0228] In summary, PNO1 knock-in reduces the mesenteric artery vascular function of mice.

[0229] 3.2.5, Effect of PNO1 knock-in on renal artery vascular function

[0230] The results of renal artery vascular function detection of mice in each group are shown in Figure 10 .

[0231] As can be seen from Figure 10 , compared with the WT-♂ group, the resistance index (C in Figure 10 ) and the pulsatility index (B in Figure 10 ) of the renal artery of the PNO1-KI-♂ group mice were significantly increased; compared with the WT-♀ group, the resistance index (C in Figure 10 ) and the pulsatility index (B in Figure 10 ) of the renal artery of the PNO1-KI-♀ group mice were significantly increased.

[0232] In summary, PNO1 knock-in reduces the function of mouse renal artery.

[0233] Example 4 Comparison of PNO1 hypertensive mouse model and Ang II-induced hypertensive mouse model

[0234] In this Example 4, the effects of PNO1 hypertensive mice and Ang II-induced hypertensive mice on blood pressure were investigated. This includes the following:

[0235] 4.1, Animal grouping

[0236] Twelve male 8-week-old WT and PNO1 systemic knock-in mice were randomly divided into four groups: WT+NS, WT+Ang II, PNO1-KI+NS, and PNO1-KI+Ang II.

[0237] The WT+Ang II group was a wild-type mouse with a 200 μL Ang II solution osmotic mini-pump.

[0238] The WT+NS group was a wild-type mouse with a 200 μL normal saline osmotic mini-pump.

[0239] The PNO1-KI+NS group was a PNO1 hypertensive mouse constructed in Example 2 reimplanted with a 200 μL normal saline osmotic mini-pump.

[0240] The PNO1-KI+Ang II group was a PNO1 hypertensive mouse constructed in Example 2 reimplanted with a 200 μL Ang II solution osmotic mini-pump.

[0241] The Ang II was configured according to the average body weight of the mice, with a dose of 500 ng / kg / min for a total of 4 weeks.

[0242] 4.2, Measurement of mouse blood pressure

[0243] The non-invasive mouse tail artery cannula method was used to detect the blood pressure of the mice. The instrument used was CODA TM Non-invasive blood pressure monitoring system. First, the mouse was bound to the fixator and placed on a 35°C heating plate. The mouse was placed in a dark, quiet environment and kept in a stable state of rest. The pressure disrupter and volume pressure sensor were placed about 0.5 cm from the root of the mouse, and CODA TM The non-invasive blood pressure system detected the blood pressure, recorded the systolic pressure, diastolic pressure, and mean arterial pressure of the mouse, and took the average value for statistical analysis.

[0244] 4.3, Experimental results

[0245] The results of blood pressure monitoring of the mice in each group are shown in Figure 11 .

[0246] From Figure 11 it can be known that the blood pressure of the PNOl-KI+NS group of mice, including systolic pressure (Fig. 1A), diastolic pressure (Fig. 1B) and mean arterial pressure (Fig. 1C), was significantly higher than that of the WT+NS group (*P<0.05); the blood pressure of the PNOl-KI+Ang II group of mice, including systolic pressure (Fig. 1A), diastolic pressure (Fig. 1B) and mean arterial pressure (Fig. 1C), was significantly higher than that of the WT+Ang II group (#P<0.05); the blood pressure of the PNOl-KI+Ang II group of mice, including systolic pressure (Fig. 1A), diastolic pressure (Fig. 1B) and mean arterial pressure (Fig. 1C), was significantly higher than that of the PNOl-KI+NS group (#P<0.05). Figure 11 Figure 11 Figure 11 Figure 11 Figure 11 Figure 11 Figure 11 Figure 11 Figure 11

[0247] In summary, PNOl knock-in results in elevated blood pressure, and PNOl knock-in also significantly increases the blood pressure of Ang II-induced hypertensive mice.

[0248] The above examples are intended to illustrate the embodiments disclosed in the present application and should not be understood as limiting the present application. In addition, various modifications listed herein and changes in the methods and compositions of the present application will be apparent to those skilled in the art without departing from the scope and spirit of the present application. Although the present application has been specifically described in connection with various specific preferred embodiments thereof, it will be understood that the present application should not be limited to these specific embodiments. In fact, various modifications such as those described above to obtain the present application will be apparent to those skilled in the art.​​​​​​​​​

Claims

1. Use of PNO1 in at least one of the following, 1) screening of drugs for prevention and / or treatment of hypertension; 2) preparation of a mouse model of hypertension.

2. A method for constructing a hypertensive mouse model, characterized by, The mouse model of hypertension is prepared by knocking in PNO1 into a mouse using a Cre-loxp system.

3. The construction method of claim 2, wherein, The Cre-loxp system comprises a targeting vector which recognizes and cleaves a friendly site, and the targeting vector comprises an expression cassette of: promoter-Loxp-3*SV40-Loxp-PNO1-polyA.

4. The construction method of claim 3, wherein, The friendly site is selected from the group consisting of Rosa26, Hprt and hipp11 gene sites; and / or, the promoter is a CAG promoter; and / or, the nucleotide sequence of PNO1 comprises the sequence shown in SEQ ID NO. 1; and / or, the targeting vector further comprises a DTA element, and the DTA is upstream of the promoter; and / or, the targeting vector further comprises a Neo element, and the Neo is downstream of the polyA; and / or, the targeting vector further comprises a left homology arm that is homologous to a sequence 5 ′ end of the friendly site and a right homology arm that is homologous to a sequence 3 ′ end of the friendly site.

5. The construction method of claim 4, wherein, The nucleotide sequence of the targeting vector comprises the sequences shown in SEQ ID NO. 10 and SEQ ID NO.

20.

6. The construction method of claim 3, wherein, The method comprises the following steps: 1) transfecting the targeting vector into embryonic stem cells and then transplanting into surrogate mice to obtain PNO1 knock-in mice; 2) crossing the PNO1 knock-in mice with Cre tool mice to obtain the mouse model of hypertension.

7. The construction method of claim 6, wherein, The method further comprises PCR identification of the transfected embryonic stem cells, and the primers for the PCR identification comprise the sequences shown in SEQ ID No. 11-SEQ ID No. 16; and / or, the method further comprises PCR identification of the PNO1 knock-in mice, and the primers for the PCR identification comprise the sequences shown in SEQ ID No. 17-SEQ ID No.

19.

8. Use of the mouse model of hypertension obtained by the construction method of any one of claims 2-7 in at least one of the following: A1) screening of drugs for prevention and / or treatment of hypertension; A2) research on the pathogenesis and etiology of hypertension.

9. A method of screening for a candidate drug for preventing and / or treating hypertension, characterized by, The method comprises the following steps: A drug is administered to the mouse model of hypertension obtained by the construction method of any one of claims 2-7, and candidate drugs are screened by comparing the changes in the mouse model of hypertension before and after administration of the drug.

10. Use of a PNO1 inhibitor in the preparation of a product for prevention and / or treatment of hypertension.

Citation Information

Patent Citations

  • Method for building novel hypertension mouse model based on MYPT1 (Myosin Phosphatase-Targeting Subunit 1) gene knockout and application thereof

    CN102586223A

  • Application of reagent for detecting miRNA expression quantity in preparation of reagent or kit for diagnosis or prognosis of Kazakh hypertension

    CN113943792A