A sgRNA guide sequence targeting RP1L1 gene and its application

Abstract

The present invention discloses an sgRNA guide sequence targeting RP1L1 gene and its application, which relates to the field of genetic engineering technology. The technical key points are as follows: the nucleotide sequence of the sgRNA is as shown in SEQ ID NO: 1, the sgRNA is added with a backbone sequence and sgRNA1 is prepared by 2'-O-methylation modification and thiolation modification, the nucleotide sequence of the sgRNA1 is as shown in SEQ ID NO: 2, and the backbone nucleotide sequence is as shown in SEQ ID NO: 3. The sgRNA targeting the hotspot mutation c.133C>T of the RP1L1 gene provided by the present invention can not only accurately target and edit the mutation sequence, but also mediate homologous recombination to correct the mutation sequence to a normal sequence. This sgRNA, as an efficient guide sequence, can be applied in multiple fields such as the study of pathogenic mechanisms related to the RP1L1 gene, the construction of cell and animal models, and drug development.

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology, and more specifically, to an sgRNA guide sequence targeting the RP1L1 gene and an application thereof. Background Art

[0002] Occult Macular Dystrophy (OMD) is a type of macular dystrophy associated with cone cell damage, usually inherited in an autosomal dominant manner. The typical feature of OMD is the progressive decline in binocular vision, which mostly occurs in young and middle-aged people. Vision declines rapidly within 10-15 years, reaching the level of low vision. Funduscopy examination showed no obvious abnormalities, the full-field electroretinogram was within the normal range, the ellipsoidal band and mosaic band in the macular area of ​​optical coherence tomography were blurred or disappeared, the central scotoma appeared in the visual field, and the amplitude density of the central area of ​​the retinal electroretinogram was reduced, and the visual function of the macular area was impaired.

[0003] Retinitis pigmentosa 1-like 1 (RP1L1) is the main pathogenic gene of autosomal dominant OMD. RP1L1-related OMD is also known as Miyake disease. RP1L1 is located at 8p23.1 and consists of 4 exons, forming the shortest and most common mRNA that encodes a 2,400-amino acid photoreceptor-specific protein RP1L1. The N-terminal 350 amino acids are highly homologous to RP1, and contain two doublecortin (DCX) domains at amino acids 33-133 and 147-228, respectively, and an RP1 domain at amino acids 307-340. The C-terminal amino acid sequence is quite different from other proteins.

[0004] The main pathogenic site of OMD is: RP1L1 c.133C>T, p.R45W, which accounts for nearly 70% of Miyake disease patients. Through genotype-phenotype association analysis, it was found that patients carrying the hotspot mutation RP1L1 c.133C>T, p.R45W had an earlier onset and a more severe phenotype than patients with mutations in the second hotspot mutation region or other sites. The median age of onset of R45W_OMD patients is 14 years old, which is significantly earlier than the overall median age of onset of OMD patients (30 years old), and the visual impairment is more severe, and central dark spots usually appear in the visual field. Imaging examinations found that photoreceptor cell destruction often appears symmetrically in both eyes and is prone to involving the external membrane, and the disease progression of such patients is more significant.

[0005] In summary, the hotspot missense mutation site RP1L1 c.133C>T, p.R45W is the main cause of autosomal dominant OMD, with the highest morbidity and more severe phenotype. As an important target for OMD disease treatment and disease pathogenesis research, there is currently no research on OMD disease-related treatment or gene editing related to the RP1L1 gene. Therefore, the present invention aims to provide a sgRNA guide sequence targeting the RP1L1 gene and its application to solve the above problems. Summary of the invention

[0006] The purpose of the present invention is to solve the above problems, and to provide a sgRNA guide sequence targeting the RP1L1 gene and its application. The present invention designs a sgRNA targeting the hotspot mutation c.133C>T, and the CRISPR / Cas9 system formed can target and edit the mutant sequence, and can mediate homologous recombination to correct the mutant sequence to a normal sequence. This sgRNA can be used as an efficient guide sequence for subsequent gene editing, and can be applied to multiple fields such as the study of pathogenic mechanisms related to the RP1L1 gene, the construction of cell and animal models, and the development of drugs for diseases.

[0007] In order to achieve the above object, the technical solution of the present invention is as follows: the nucleotide sequence of the sgRNA is shown in SEQ ID NO: 1.

[0008] The present invention is further configured as follows: the sgRNA is added with a backbone sequence and sgRNA1 is prepared by 2'-O-methylation modification and thiolation modification, the nucleotide sequence of the sgRNA1 is shown in SEQ ID NO: 2, and the backbone nucleotide sequence is shown in SEQ ID NO: 3.

[0009] The present invention also provides an application of an sgRNA guide sequence targeting the RP1L1 gene in gene editing.

[0010] The following are the sequences involved in the scheme of the present invention:

[0011] SEQ ID NO: 1 (nucleotide sequence of sgRNA):

[0012] 5′-accaaacgaccccaggcgga-3′.

[0013] SEQ ID NO: 2 (nucleotide sequence of sgRNA1):

[0014] mA*mG*mG*CGGACCCCAGCAAACCAGUUUUAGAmGmCm UmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCC GUUAUCAmAmCmUmUmGmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU.

[0015] SEQ ID NO: 3 (nucleotide sequence of the backbone):

[0016] GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAG UCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUU U.

[0017] SEQ ID NO: 4 (nucleotide sequence of mRNA):

[0018]

[0019] SEQ ID NO: 5:

[0020] RP1L1-F:CAGGCCCCGAGCCACCGTGAGT.

[0021] SEQ ID NO: 6:

[0022] RP1L1-R: AGGCTATGCAGGCCCCGGGGTG.

[0023] Compared with the prior art, this solution has the following beneficial effects:

[0024] The CRISPR / Cas9 composed of the sgRNA designed in the present invention has an editing rate of up to 98.26±0.44% for mutant sequences, and in the absence of an exogenous repair template, using the wild-type normal sequence as a template, about 40% of the mutant sequences are successfully edited and repaired into normal sequences through homologous recombination, increasing the proportion of normal wild-type sequences from the original 50% to 71.17±5.44%; at the same time, the present invention takes hotspot mutations as targets and designs sgRNAs targeting hotspot mutations. By using sgRNA as an efficient guide sequence for subsequent gene editing, it can be applied in multiple fields such as research on pathogenic mechanisms related to the RP1L1 gene, construction of cell and animal models, and drug development for diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 It is a sequence diagram of SgRNA and SgRNA1 and their specific targeted hotspot mutant RP1L1 genes in the embodiments of the present invention;

[0026] Figure 2 This is an original result diagram of the composition and proportion of the mutant and wild-type sequences obtained by sequencing after editing the c.133C>T site of the RP1L1 gene by SgRNA1 and spCas9 in an embodiment of the present invention;

[0027] Figure 3 It is a statistical graph of the composition and proportion of the mutant and wild-type sequences of the RP1L1 gene edited by SgRNA1 and spCas9 in the embodiment of the present invention. DETAILED DESCRIPTION

[0028] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments of the present invention and the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0029] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present invention can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0030] Example:

[0031] like Figure 1-3 As shown, a sgRNA guide sequence targeting the RP1L1 gene and its application, the implementation process of the scheme of the present invention is as follows:

[0032] (1) sgRNA design

[0033] The genomic sequence of the human RP1L1 gene (transcript ID: NM_178857.5) was obtained using the USCS (https: / / genome.ucsc.edu / ) website, and the sgRNA targeting the c.133C>T site was designed. The guide sequence with a length of 20 nt (nucleotides) was: sgRNA: 5′-accaaacgaccccaggcgga-3′, e.g. Figure 1 As shown, it can mediate targeted complementation with the RP1L1 gene sequence with c.133C>T mutation. The PAM sequence (PAM: Protospacer Adjacent Motif) recognized by the spCas9 (Streptococcus pyogenes Cas9) protein is tgg.

[0034] (2) Synthesis of sgRNA1 and mRNA expressing spCas9 protein

[0035] In addition to the 20nt targeting sequence, sgRNA1 also contains the backbone nucleotide sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU. At the same time, in order to increase the stability and editing efficiency of the prepared RNA sequence, some bases were phosphorothioate modified or 2'-O-methylated.

[0036] The final prepared sgRNA1 sequence is:

[0037] mA*mG*mG*CGGACCCCAGCAAACCAGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU. m indicates 2'-O-methylation modification of RNA bases, * indicates thiolation modification between two bases, and the sequence is as follows: Figure 1 shown.

[0038] Synthesize mRNA expressing spCas9 protein, and prepare the sequence as follows:

[0039]

[0040] (3) Cultivation of skin fibroblasts from patients carrying RP1L1 c.133C>T, p.R45W mutations

[0041] Primary culture of skin fibroblasts: After confirming that the OMD patient carries the mutation, communicate and sign the informed consent form. After disinfection and anesthesia, aseptically obtain skin tissue with a diameter of about 3 cm from the inner side of the patient's forearm, wash it with PBS containing double antibodies, add it to an adherent cell culture dish containing DMEM / F-12 (10% FBS + 1% PS), and culture it in a cell culture incubator. Observe the morphology of cells around the skin and change the medium for 3-4 days. After 1-2 weeks, the fibroblasts around the skin crawl out and converge to 80-90% confluence, use 1 ml of 0.25% trypsin to digest and passage.

[0042] Culture of skin fibroblasts: The culture medium of skin fibroblasts is replaced every 2-3 days. When the cells in the culture well grow to a certain density of 80-90%, the cells are passaged: UV irradiation in the biosafety cabinet for 30 minutes, the culture medium is aspirated and 1 mL PBS is added. After gently shaking, the PBS is aspirated and 1 mL pancreatin is added for digestion for about 3-4 minutes; when the cells begin to become round and some cells fall off under the microscope, 1 mL culture medium is added to terminate the digestion. Blow the cells off with a 1 mL pipette tip, transfer to a 15 mL centrifuge tube, and centrifuge at 1000 rpm for 5 minutes. Discard the supernatant, add 1 mL culture medium to resuspend and mix, and passage to 3 wells in a six-well plate at a ratio of 1:3, and place in a 37°C incubator.

[0043] (4) Using nuclear transfection method to co-transfect sgRNA and spCas9 mRNA into skin fibroblasts derived from OMD patients

[0044] The main instruments and reagents for nuclear transfer are: LONZA4D-Nucleofector TM X system and P2Primary Cell 4D-Nucleofector"X KitV4XP-3024 electroporation solution.

[0045] The main steps include:

[0046] 1) Add 2 ml of DMEM / F-12 (10% FBS + 1% PS) medium to a six-well plate in advance and place it at 37°C to preheat;

[0047] 2) Prepare 100 μl electroporation solution (Nucleofector Solution 82 μl + Supplement 18 μl) in advance and mix well;

[0048] 3) Subculture the skin fibroblasts until the cell confluence reaches 80-90%, remove the culture medium, wash once with PBS, add 0.5 ml of trypsin for digestion, and add 1 ml of serum-containing culture medium to terminate the digestion;

[0049] 4) Take 1-2*106 cells and continue to centrifuge the cells at 90g for 10 minutes at room temperature, discard the supernatant. Resuspend the cells with 100μl of the prepared electroporation solution, and mix by gentle pipetting;

[0050] 5) Add sgRNA and mRNA to be transfected (2 μg sgRNA + 2.5 μg spCas9mRNA);

[0051] 6) Transfer 100 μl of the sample obtained in 5) to the bottom of the electrode cup. Be careful to move gently and ensure that there are no bubbles at the bottom of the cup. Close the cup lid tightly.

[0052] 7) Place the electrode cup into the electrode cup position in the instrument X Unit and start program CM-167;

[0053] 8) After the electric shock, remove the electroporation cup and incubate at room temperature for 10 minutes;

[0054] 9) Add 500 μl of pre-heated culture medium to the electroporation cup, then mix it with the small pipette in the kit and transfer it to the pre-heated six-well plate. After adding the 6-well plate completely, place it in a 37°C incubator for culture;

[0055] 10) After 24 hours of culture, observe the cell survival status, and after 72 hours, treat the cells.

[0056] (5) Extraction of edited fibroblast genomic DNA

[0057] 72 hours after nuclear transfection, use 0.5 ml of 0.25% trypsin to digest the cells, add 1 ml of serum-containing culture medium to terminate the digestion, blow off the cells, transfer to a 15 ml centrifuge tube, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, wash with 2 ml of PBS, centrifuge again, repeat twice to obtain the cell pellet in the centrifuge tube.

[0058] Use the Thermo Scientific KingFisher Duo magnetic bead extraction system to extract cell DNA: add 400 μL of diluted lysis buffer BL (lysis buffer BL is diluted 1:1 with ultrapure water) to the centrifuge tube containing the cell pellet, pipette and mix to blend the solid cells into the lysis buffer, add 20 μL of proteinase K, and vortex to mix. Lyse in a water bath at 56°C for 30 minutes. Add the corresponding reagents to the 96-well plate (Table 1). After the lysis is completed, transfer the liquid to the H row wells (Binding wells) of the 96-well plate and add 380 μL of anhydrous ethanol. Put the magnetic rod cover into the G row wells and run the program GO_celIDNA_BTCD_20200916-xiche. After the run is completed, the A row wells are DNA solutions, which are taken out and transferred to DNA cryopreservation tubes and stored in a refrigerator at 4 or -20°C.

[0059] The distribution of orifice plates is shown in Table 1:

[0060] Table 1 Reagent names and dosages in 96 deep space plates

[0061]

[0062] 6) Perform targeted sequence amplicon sequencing on the edited genomic DNA

[0063] The cell genome obtained after transfection was subjected to 2 rounds of PCR to construct an amplicon library. The primers designed for the RP1L1 target sequence were as follows:

[0064] RP1L1-F:CAGGCCCCGAGCCACCGTGAGT;

[0065] RP1L1-R: AGGCTATGCAGGCCCCGGGGTG.

[0066] After the second round of PCR amplification and purification, agarose gel electrophoresis was performed to confirm that the bands were correct and the concentration was greater than 1 ng / μl. High-throughput sequencing was performed. The results after sequencing were analyzed using sgRNA as the reference sequence. The results of the CRISPR / Cas9 edited group and the unedited group were compared to analyze the occurrence of nucleotide insertions, deletions, and base substitutions in the target sequence, and the editing efficiency was analyzed. Figure 2 and Figure 3As shown in (A, percentage of mutant type. B, percentage of wild type), sequencing shows that there is spontaneous non-homologous end joining (NHEJ) repair after DNA breakage in the target sequence editing results. NHEJ includes base deletion, insertion, base substitution, etc. In addition, there is homologous recombination repair (HDR). Due to the high proportion of HDR sequences in the results, the editing efficiency is not simply calculated based on the proportion of Indel (insertion and / or deletion), but the editing rate of the mutant sequence is calculated based on the change in sequence proportion, as shown in Table 2:

[0067] Table 2 Statistics of mutation and wild-type sequence composition, proportion and editing rate in control group and edited group

[0068]

[0069] As shown in Table 2, the CRISPR / Cas9 composed of the sgRNA designed in the present invention has an editing rate of up to 98.26±0.44% for mutant sequences, and in the absence of an exogenous repair template, using the wild-type normal sequence as a template, about 40% of the mutant sequences are successfully edited and repaired into normal sequences through homologous recombination, increasing the proportion of normal wild-type sequences from the original 50% to 71.17±5.44%.

[0070] The RP1L1 gene c.133C>T, p.R45W hotspot mutation is the main cause of OMD. The patient's visual function is severely impaired and the quality of life is affected. There is no clinically available treatment. The present invention takes the hotspot mutation as a target and designs sgRNA targeting the hotspot mutation. The sgRNA in the present invention can be subsequently used as an efficient guide sequence for gene editing and is applied in multiple fields such as RP1L1 gene-related pathogenic mechanism research, cell and animal model construction, and disease drug development.

[0071] The above specific embodiments are merely explanations of the present invention and are not limitations of the present invention. After reading this specification, those skilled in the art may make modifications to the embodiments without any creative contribution as needed. However, such modifications are protected by the patent law as long as they are within the scope of the claims of the present invention.

Claims

1. A sgRNA targeting the RP1L1 gene, characterized by: The guide sequence in the sgRNA is shown in SEQ ID NO:

1.

2. The sgRNA targeting the RP1L1 gene according to claim 1, characterized in that: The guide sequence is added with the backbone sequence and sgRNA is prepared by 2'-O-methylation modification and thiolation modification. The nucleotide sequence of the sgRNA is shown in SEQ ID NO: 2, and the nucleotide sequence of the backbone sequence is shown in SEQ ID NO:

3.

3. Use of the sgRNA targeting the RP1L1 gene as claimed in claim 1 or 2 in the preparation of a reagent for repairing the c.133C>T mutation of the RP1L1 gene.

Images