Compositions and methods for detecting enzyme reaction pyrophosphate products using pyridyl azoamine dyes

Abstract

This document provides a composition comprising an enzyme that releases pyrophosphate from a substrate and a dye of Formula 1. A method for detecting pyrophosphate is also provided. A kit is also provided comprising a polymerase that releases pyrophosphate via the hydrolysis of nucleoside triphosphates during nucleic acid replication, a divalent manganese salt, and a dye. This composition, method, and kit provide a way to detect and / or quantify the products of substrates or enzyme reactions associated with pyrophosphate release (such as nucleic acid amplification reactions and other ATP-hydrolyzing reactions) by means of a noticeable color change without materially affecting the sensitivity and / or specificity of the reaction.

Description

Background Technology

[0001] In 2012, Zhang et al. and Tanner et al. made a surprising discovery: the amplification of target DNA in low-concentration buffer solutions can be detected by visual color changes of pH-sensitive dyes (see US9,034,606, US9,580,148, and US11,162,133). The color change caused by pH variation is due to the release of hydrogen ions (H+) when deoxyribonucleoside triphosphates (dNTPs) bind to DNA during amplification. + The results showed that the selected dye did not appear to adversely affect the activity of the polymerase required for amplification; the amplification conditions themselves did not adversely affect the color change; the observable color change occurred as a direct result of amplification; the color change of the dye was easily detectable to the naked eye; and the detection method was sensitive enough to detect low amounts of amplified DNA product, where the relatively low DNA concentration was due to the concentration of the starting material or the number of amplification cycles required to reach the detectable endpoint.

[0002] Prior to these discoveries, colored dyes such as calcein or hydroxynaphthol blue (HNB) were added to amplification reactions, but the color changes were, at best, indistinct. Goto et al., in Biotechniques, Vol. 46, No. 3, pp. 167-172 (2009), described the use of HNB as a colorimetric reagent for alkaline earth metal ions in loop-mediated isothermal amplification (LAMP). The color of HNB is pH-dependent, appearing magenta at pH 8.6 to 9.0 and purple at pH 8.4. Furthermore, changes in magnesium ion concentration caused color changes regardless of pH. In the absence of magnesium, the maximum absorbance peak was observed at 650 nm, decreasing with increasing magnesium content. Because the color changes of HNB due to amplification are not readily apparent to the naked eye, it is necessary to use other methods to detect the occurrence of LAMP.

[0003] Optionally, a colored dye is added after amplification to detect DNA amplicones. The dye binds to DNA directly or through intercalation, so the more DNA product produced, the greater the increase in dye color intensity. Since DNA detection methods are relatively insensitive, a carrier, such as a gel, is needed to increase the local concentration of DNA, thereby increasing the color signal. Optionally or additionally, additional reagents can be added to the dye to alter the color of the post-amplification mixture, distinguishing solutions containing amplified nucleic acids from those not. Dyes described by Miyamoto et al. in US2011 / 0117549 include triphenylmethane dyes, thiazine dyes, oxazine dyes, azazine dyes, xanthan dyes, and phenanthrene dyes, such as crystal violet, gentian violet B, Victoria blue B, methyl violet, night blue, methyl green, toluidine blue O, azure B, methylene blue, brilliant cresol blue, methyl orange, pyronin Y, ethidium bromide, and neutral red.

[0004] Since 2012, other literature has reported the use of a wider range of pH-sensitive dyes and buffers (see US10,253,357) for pH-dependent colorimetric detection of nucleic acids, repeating and extending the earlier work described in US 9,034,606 and US 9,580,148. While visually detectable dyes are mentioned, these references focus on measuring hue, which relies on spectrophotometer readout and various statistical processing of the data. This reference cites examples of phenol red, bromocresol purple, bromothymol blue, neutral red, naphtholphthalein, cresol red, cresolphthalein, phenolphthalein, methyl red, and thymolphthalein as pH-sensitive dyes. Dye mixtures of phenol red and bromothymol blue, and cresol red and bromothymol blue, with buffers having buffering capacities across different pH ranges, such as pH 6–pH 9 or pH 6.5–pH 8.8, are also described.

[0005] While pH-dependent colorimetric amplification (PDA) assays using phenol red are highly effective, further improvements are expected. Limitations of PDA assays include buffer concentration and the pH range required to differentiate between positive and negative samples. The use of dry ice in transport containers can cause undesirable pH changes. Certain biofluid components, such as saliva samples or subsets of certain types of environmental samples, may have less than ideal pH values; in such cases, avoiding or correcting undesirable pH values ​​is limited by acceptable buffer volumes (e.g., less than 5 mM Tris buffer for phenol red).

[0006] Therefore, alternative dyes or families of dyes that are compatible with polymerase, do not interfere with the amplification reaction, and provide a strong binary colorimetric signal would be a valuable addition to diagnostic testing options. This binary colorimetric signal is converted into a positive endpoint peak that is distinctly different from the peak at the negative endpoint in the spectrum at a different wavelength and can be detected by the naked eye in a variety of amplification reactions, not limited to LAMP. Summary of the Invention

[0007] This article provides a composition comprising an enzyme that releases pyrophosphate from a substrate and a dye of formula 1:

[0008]

[0009] in:

[0010] R1 and R5 are each independently selected from H, halogen, nitro, cyano, sulfonic acid, carboxyl, trifluoromethyl, trichloromethyl and tribromomethyl;

[0011] R2 and R3 are each independently selected from lower alkyl groups, which optionally contain terminal sulfonic acid groups; and

[0012] R4 is H, hydroxyl, or carboxyl.

[0013] In some embodiments, at least one of R1 and R5 is a halogen (e.g., Br) selected from F, Cl, Br, or I; R2 and R3 are each independently selected from n-butyl, sec-butyl, isobutyl, tert-butyl, propyl, n-propyl, isopropyl, ethyl, or methyl; and at least one of R2 and R3 contains a terminal sulfonic acid group. In some embodiments, R4 is a hydroxyl or carboxyl group; preferably a hydroxyl group. In other embodiments, R4 is H.

[0014] Embodiments of Formula 1 include 2-(5-bromo-2-pyridiniazo)-5-(N-propyl-N-sulfopropylamino)phenol (5-Br-PAPS), 2-(5-nitro-2-pyridiniazo)-5-(N-propyl-N-sulfopropylamino)phenol (5-nitro-PAPS), or 2-(3,5-dibromo-2-pyridiniazo)-5-(N-ethyl-N-sulfopropylamino)benzene (3,5-dibromo-PAESA).

[0015] A method for detecting pyrophosphate is also provided. This method may include combining: an enzyme (e.g., a polymerase, such as DNA polymerase or RNA polymerase; or another enzyme involved in hydrolysis or hydrolyzing a substrate such as nucleoside triphosphates (NTPs) to release pyrophosphate, such as reverse transcriptase, primase, ligase, helicase, nucleotide pyrophosphatase (Ppase) / phosphodiesterase, RNA uncapping enzyme (RNA 5' pyrophosphate hydrolase), and geranyyl pyrophosphate synthase); a substrate of said enzyme (e.g., an NTP), which releases pyrophosphate upon hydrolysis; a metal salt (preferably a manganese salt); and a pyridinium azoaniline dye (preferably a dye of formula 1) to generate a reaction mixture; incubating the reaction mixture under conditions where the enzyme cleaves the substrate to generate pyrophosphate; and observing a color change in the reaction mixture, wherein the color change indicates that pyrophosphate has been generated.

[0016] In some embodiments, the enzyme is a polymerase, and the substrate is an NTP (dNTP or rNTP). For example, the reaction mixture may include a polymerase, rNTPs or dNTPs, a dye, a metal salt (such as a manganese salt), and a template nucleic acid; the reaction mixture is incubated under conditions suitable for nucleic acid amplification, and a color change indicates that the product has been amplified. Amplification methods may include any of the following: loop-mediated isothermal amplification (LAMP), polymerase chain reaction (PCR), strand displacement amplification (SDA), helicase-dependent amplification (HDA), multiple displacement amplification (MDA), rolling circle amplification, ligation-mediated amplification, whole genome amplification (WGA), nucleic acid sequence-based amplification (NASBA), or a mixture of recombinase polymerase amplification (RPA).

[0017] A kit is also provided, comprising an enzyme (such as a polymerase) that releases pyrophosphate from a substrate, a metal salt (such as a manganese salt), and a pyridine azo aniline dye (preferably a dye of formula 1).

[0018] This composition, method, and kit are considered a significant advancement in the art because they provide a method for measuring the progress of reactions that release pyrophosphate (such as nucleic acid amplification reactions and other reactions that hydrolyze NTPs, such as ATP) by means of color changes. The pyridine azoaniline dye used in this disclosure reacts with divalent metal cations (such as Mn) 2+The dye exhibits one color when bound to a divalent metal cation (e.g., red) and another color (e.g., yellow) when not bound to a divalent metal cation. Without adhering to any specific theory, it is assumed that during these reactions, the released pyrophosphate competes with the dye for binding to the metal ions. This competition causes the metal ions to be released from the dye and isolated by the pyrophosphate. The release of the metal ions from the dye restores the dye to its original color. In one embodiment, the reaction mixture changes from red to yellow during the reaction due to the formation of pyrophosphate. This color change can be readily detected by spectrophotometry, image analysis, or the naked eye. By selecting an appropriate detection method, changes in hue or peak wavelength can be measured. Attached Figure Description

[0019] Those skilled in the art will understand that the accompanying drawings described below are for illustrative purposes only. The drawings are not intended to limit the scope of this teaching in any way.

[0020] Figure 1A-1B This shows a dye called 4-(2-pyridineazo)aniline (also referred to herein as pyridineazoaniline dye) and is derived from formula 1 ( Figure 1A The structure of this dye family is represented by ) . Examples of this dye family illustrate that these dyes outperform other azo dyes that do not belong to the 4-(2-pyridineazo)aniline dye family in colorimetric LAMP. Figure 1C-1G ).

[0021] Figure 1A The structure of the 4-(2-pyridineazo)aniline dye is shown, wherein:

[0022] R1 and R5 are each independently selected from H, halogen, nitro, cyano, sulfonic acid, carboxyl, trifluoromethyl, trichloromethyl, and tribromomethyl; and

[0023] R2 and R3 are each independently selected from lower alkyl groups, which optionally contain terminal sulfonic acid groups; and

[0024] R4 is H, OH, or COOH.

[0025] In some embodiments, at least one of R1 and R5 is a halogen selected from F, Cl, Br or I; R2 and R3 are each independently selected from n-butyl, sec-butyl, isobutyl, tert-butyl, propyl, n-propyl, isopropyl, ethyl or methyl; and at least one of R2 and R3 contains a terminal sulfonic acid group.

[0026] Figure 1B 5-bromo-PAPs, 5-nitro-PAPS and 3,5-dibromo-PAESA are shown.

[0027] Figure 1C-1GTwo 4-(2-pyridineazo)aniline metal transfer agents, 5-bromo-PAPS and 5-nitro-PAPS (2-(2-pyridineazo)-5-(N-propyl-N-sulfopropylamino)phenol, were shown to perform significantly better than other non-aniline azo metal transfer agents, 4-(2-pyridineazo)resorcinol (PAR), hydroxynaphthol blue (HNB), and chrome black T (EBT), as positive indicators of LAMP reaction under the same conditions.

[0028] For each dye, the left 18-well plate (before LAMP) and the right 18-well plate (after LAMP) show the colors (grayscale) of triplicate LAMP reactions with or without λDNA (1 ng) and λDNA (NTC). Each dye was applied using 0 μM Mn. 2+ (None), 100μMn 2+ and 800μM Mn 2+ Tests were conducted. The corresponding real-time curves on the right side of the figure confirm that LAMP occurred. The dashed rectangles around the six samples in the right panel highlight the optimal visual detection conditions for each dye after LAMP.

[0029] Figure 1C The results for 75 μM 5-bromo-PAPS are shown.

[0030] Figure 1D Results for 75 μM 5-nitro-PAPS are shown.

[0031] Figure 1E The results for 200 μM PAR are shown.

[0032] Figure 1F The results for 80 μM HNB are shown.

[0033] Figure 1G The results for 100 μM EBT are shown.

[0034] Figure 2A-2D The results showed that among the nine different metal salts tested, manganese ions gave the clearest color changes for 5-bromo-PAPS and 5-nitro-PAPS.

[0035] exist Figure 2A (before LAMP) and Figure 2B (Post-LAMP) In response to triplicate LAMP amplification using 100 μM metal ions and 75 μM 5-bromo-PAPS or 5-nitro-PAPS, with or without 1 ng λDNA, Mn 2+ It provides the best signal when used with PAPS dyes. (And with Mn) 2+ The reactions of the ion (MnCl2) are indicated by dashed rectangles.

[0036] Figure 2C and Figure 2D Showing Figure 2A and Figure 2B The corresponding real-time curve of the sample.

[0037] Figures 3A-3C The results show that pyrophosphate released during DNA amplification passes through Mn 2+ PAPS dye color change was induced by chelation from the dye:Mn complex. This confirms that the addition of pyrophosphatase (Ppase) can prevent color change. Furthermore, in the absence of an amplification reaction that would cause a color change, EDTA mimics the amplification reaction by binding manganese with a greater affinity than PAPS.

[0038] Figure 3A The chemical structures of 5-bromo-PAPS and 5-nitro-PAPS are shown.

[0039] Figure 3B Demonstrated degradation of pyrophosphate via PPase or chelation of Mn via EDTA 2+ The effect.

[0040] Figure 3C The proposed mechanism of color change of PAPS dye during LAMP amplification is shown.

[0041] Figures 4A-4C The results showed that when testing for 0 μM, 50 μM, 75 μM, 100 μM, or 150 μM manganese ions in the LAMP amplification reaction mixture, 50 μM, 75 μM, and 100 μM 5-bromo-PAPS provided similar results.

[0042] The color change and real-time curves of each of the three concentrations of PAPS dyes in the post-LAMP reaction are provided.

[0043] Figure 4A The results for 50 μM 5-bromo-PAPS are shown.

[0044] Figure 4B The results for 75 μM 5-bromo-PAPS are shown.

[0045] Figure 4C The results for 100 μM 5-bromo-PAPS are shown.

[0046] Figures 5A-5DThe results show that color changes in PAPS dyes can be easily detected using the absorbance spectra with maximum peaks observed at 450 nm and 570 nm. The curves also demonstrate that positive results can be detected using the spectral ranges flanking the peak values. For example, wavelengths of 420 nm–50 nm can be used instead of 450 nm, and 520 nm–600 nm can be used instead of 550 nm.

[0047] Figure 5A The results showed that the reaction with 75 μM 5-bromo-PAPS and 100 μM Mn 2+ The absorbance was measured at wavelengths from 360 nm to 750 nm during the reaction.

[0048] Figure 5B It was shown that with 75 μM 5-nitro-PAPS and 100 μM Mn 2+ The absorbance was measured at wavelengths from 360 nm to 750 nm during the reaction.

[0049] Figure 5C It showed compatibility with 75 μM 5-bromo-PAPS and 75 μM-150 μM Mn 2+ The relative gain of absorbance at 450 nm and 550 nm during the reaction.

[0050] Figure 5D It showed 75 μM 5-nitro-PAPS and 75-150 μM Mn 2+ The ratio of absorbance at 450 nm to absorbance at 550 nm.

[0051] Figures 6A-6B The results show that PAPS dye LAMP tolerates a wider range of carrier solutions compared to pH-based colorimetric LAMP. The carrier solutions shown here were derived from standard DNA purification column elution buffer (EB) or viral transport medium (VTM). Similar results are expected from carrier solutions in bodily fluids such as saliva and nasal mucosa.

[0052] Figure 6A As shown, in samples 1-7 containing progressively increasing volumes of carrier buffer, the dashed rectangles indicate the use of different color detection methods (PAPs dye using Mn). 2+ The maximum tolerance difference in EB carryover (compared to pH-based detection methods) is shown below the colored wells for the real-time curves of the LAMP reaction (showing different amounts of carryover solution) (0-7 refers to 0-7 μL (0-28% v / v) of typical EB (QiagenEB, 10 mM Tris pH 8.5) in a 25 μL LAMP reaction containing the PAPS reporter system).

[0053] Figure 6BAs shown, with samples 1-7 containing progressively increasing volumes of carry buffer, the dashed rectangles represent the maximum tolerance differences to VTM carry amounts using different colorimetric detection methods. Real-time curves of the LAMP reaction (showing different amounts of carry buffer) are provided below the colored wells.

[0054] Figures 7A-7D The results showed that PAPS dye is a sensitive reporter for amplification using reverse transcription-LAMP (RT-LAMP), E1 primer set, and as few as 10 copies of SARS-CoV-2 RNA.

[0055] At 75 μM 5-bromo-PAPS and 100 μM Mn 2+ The results of 24 reactions (each reaction containing approximately 10 copies of the target RNA (A1-H3) and 8 NTC reactions (A4-H4)) were obtained in the presence of [the substance].

[0056] Figure 7A The color of the reaction mixture before amplification is shown (white circles represent red).

[0057] Figure 7B The colors of the reaction mixtures after amplification are shown (black circles represent yellow). The template-free control (NTC) reaction remains red. Color changes (turning to yellow) were observed in reactions A1, B1, C1, D2, D3, E2, E3, F2, F3, G1, G2, and H3.

[0058] Figure 7C The relative gain of absorbance at 450 nm and 550 nm is shown.

[0059] Figure 7D The ratio of absorbance at 450 nm to that at 550 nm is shown.

[0060] Figures 8A-8D The results show that the PAPS colorimetric assay is effective for PCR of λDNA fragments ranging in size from 0.5kb to 5.0kb and is tolerant to various buffers used in different PCR formulations. Results were shown using 50 μM bromo-PAPS and 50 μM methyl methacrylate (MMP) buffers. 2+ In the presence of three samples ( and (New England Biolabs, Ipswich, MA) or two copies of the sample. The test results (New England Biolabs, Ipswich, MA) are as follows.

[0061] Figure 8AThe images show the different endpoint dye colors for positive and negative samples (with or without 1 ng DNA template) after PCR using a mixture of LongAmp Taq, OneTaq, and Q5 stock solutions or a non-template control (NTC). All positive samples showed a yellow endpoint dye color (indicated by a black circle). All negative samples showed a red endpoint dye color (indicated by a yellow circle).

[0062] Figure 8B Showing Figure 8A The results of the Q5 PCR products electrophoresed in the presence of dye on agarose gels, with DNA sizes ranging from 0.5kb, 1.0kb, 2.0kb, and 5.0kb.

[0063] Figure 8C The diagram shows the number of PCR cycles required for the color to change from red to yellow when amplifying DNA fragments from the *E. coli* and human genomes using OneTaq PCR mix. The color change is shown above the agarose gel containing the electrophoretic sample DNA, with yellow represented by black reaction tubes and red by white reaction tubes.

[0064] Figure 8D The DNA yield (ug / μl) was determined based on the A450-A550 ratio of different sizes of λDNA and human DNA after PCR using OneTaq.

[0065] Figures 9A-9D The results show that the colorimetric assay using PAPS dyes can be directly applied to colony PCR to assess the presence of target inserts or the plasmid itself. The corresponding colorimetric PCR results for each E. coli colony are displayed on each agarose gel (black tubes represent yellow reaction color; white tubes represent red reaction color). Figures 9A-9B Plasmid I (1-4) containing specific inserts was detected in four colonies. Figure 9C Plasmid II (1-4) was detected in 4 colonies. Figure 9D Plasmids I and II were detected in 8 colonies.

[0066] Figure 9A The optimized annealing temperature is shown when amplifying a 1172 bp fragment of plasmid I using purified plasmid DNA. The annealing temperature is displayed above the reaction tube.

[0067] Figure 9B The results of PCR performed on bacterial cells using specific primers for the DNA insert (1172 bp) in the recognition plasmid (platinum I) in the presence of a colorimetric dye are shown and compared with the same DNA obtained on a gel.

[0068] Figure 9CThe results of PCR performed on bacterial cells with specific primers for different DNA inserts (1715 bp) in the recognition plasmid (platinum II) in the presence of a colorimetric dye are shown and compared with the same DNA obtained on the gel.

[0069] Figure 9D The PCR performed on bacterial cells using primers that recognize plasmids I (6136 bp) and II (5292 bp) is shown.

[0070] Figures 10A-10C The concentration of λDNA in the sample can be determined by determining the number of PCR cycles required to obtain the desired intensity of yellow change in the sample for a predetermined size of amplicon.

[0071] Figure 10A The results showed that an initial concentration of 1 ng λDNA (approximately 1.9 x 10⁻⁶) was used. 7 The time course of PAPS dye color change in triplicate PCR reactions of 0.5kb, 1.0kb and 2.0kb λDNA (copies) after 16, 20, 24, 28, 32 and 36 PCR cycles, and the NTC control reaction using primers with 0.5kb DNA in the absence of template DNA.

[0072] Figure 10B Showing Figure 10A Spectrophotometric scans of the sample at absorbances of 450 nm and 550 nm are plotted against the PCR cycle number. An arbitrary threshold of 0.10 (dashed line) is shown in the figure to represent color changes visible to the naked eye.

[0073] Figure 10C Showing Figure 10A DNA yield during the reaction. The visual color change threshold (dashed line) corresponds to approximately 60 ng / μl of amplicon yield in the PCR reaction.

[0074] Figure 11A-11C The study demonstrated that the concentration yield of human DNA in a sample could be determined by the color of PAPS dye, and correlated it with the PCR time required to obtain the desired intensity of yellowing in the sample.

[0075] Figure 11AThe time progression of PAPS dye color change after 24, 28, 32, 36, 40, and 44 cycles of triplicate PCR reactions using 0.5 kb, 1.0 kb, and 2.0 kb of human DNA at an initial concentration of 10 ng of human DNA (approximately 2,900 copies) is shown, along with an NTC control reaction using primers with 0.5 kb of DNA in the absence of template DNA. Due to the reduced template copy number, human DNA required more PCR cycles than λ DNA.

[0076] Figure 11B yes Figure 11A Spectrophotometric scans of the sample at absorbances of 450 nm and 550 nm are plotted against the PCR cycle number. An arbitrary threshold of 0.10 (dashed line) is shown in the figure to represent color changes visible to the naked eye.

[0077] Figure 11C Showing Figure 11A DNA yield during the reaction. The visual color change threshold (dashed line) corresponds to approximately 50 ng / μl of amplicon yield in the PCR reaction.

[0078] Figure 12A-12F The useful correlation between color change and DNA yield in PCR reactions is shown. The average absorbance gain (A450–A550) (Y-axis) of the PCR reaction was plotted against the DNA yield (X-axis) of the λ amplicon (A, B, C) and human (D, E, F) amplicon at five sampling points (16, 20, 24, 28, 32, and 36 cycles for λ amplicon) and human (D, E, F) amplicon. The horizontal red dashed line corresponds to A450–A550 at 0.10, i.e., the point where the color change is perceptible to the naked eye. The DNA concentration cut off from this threshold was obtained as the DNA yield required to see the color change, such as… Figure 8D As shown in the image.

[0079] Figures 13A-13B The results showed that, under the same reaction conditions using Jurkat RNA, the lyophilized PAPS dye RT-LAMP reaction yielded similar results to both the lyophilized fluorescent dye LAMP and the undyophilized Lyo-compatible fluorescent dye LAMP. However, when HNB dye was used in the lyophilized mixture, it did not show any color change after the amplification reaction was complete. Detailed Implementation

[0080] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. For clarity and ease of reference, certain terms are still defined herein in relation to embodiments of this disclosure.

[0081] Commonly understood sources of terminology and symbols may include: standard papers and texts such as Kornberg and Baker, DNA Replication, 2nd ed. (WH Freeman, New York, 1992); Lehninger, Biochemistry, 2nd ed. (Worth Press, New York, 1975); Strachan and Read, Human Molecular Genetics, 2nd ed. (Wiley-Liss, New York, 1999); Eckstein, ed., Oligonucleotides and Analogs: A Practical Approach (Oxford University Press, New York, 1991); Gait, ed., Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); Singleton et al., Dictionary of Microbiology and Molecular Biology, 2nd ed., John Wiley and Sons, New York (1994); and Hale & Markham, the Harper Collins Dictionary of Biology, Harper Perennial, New York (1991), etc.

[0082] As used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural references unless the context clearly specifies otherwise. For example, the term “a protein” refers to one or more proteins, i.e., a single protein and multiple proteins. When exclusive terms, such as “only,” “unique,” ​​or other terms relating to the recitation of a claim element, are used, or when a negative limitation is specified, the claim may be drafted to exclude any optional element.

[0083] Various aspects of this disclosure can be further understood from the implementation methods, section headings, figures, descriptions, and embodiments, and none of them should be construed as limiting the entire scope of this disclosure in any way. Therefore, the claims should be interpreted in accordance with the full breadth and spirit of this disclosure.

[0084] Each individual embodiment described and illustrated herein has independent components and features that can be readily separated from or combined with features of any other several embodiments without departing from the scope or spirit of this teaching. Any described method may be performed in the order of the described events or in any other logically possible order.

[0085] The range of numbers includes the numbers within the defined range. All numbers should be understood as including the midpoint of the integers above and below the integers; that is, the number 2 includes 1.5-2.5. The number 2.5 includes 2.45-2.55, and so on. When providing sample values, unless otherwise specified, each value individually represents the middle value in the range, and together they represent the extreme values ​​of the range.

[0086] In the context of this disclosure, "non-naturally occurring" means a polynucleotide, polypeptide, carbohydrate, lipid, or composition that does not exist in nature. Such a polynucleotide, polypeptide, carbohydrate, lipid, or composition may differ from naturally occurring polynucleotides, polypeptides, carbohydrates, lipids, or compositions in one or more respects. For example, polymers (such as polynucleotides, polypeptides, or carbohydrates) may differ in the type and arrangement of their component building blocks (such as nucleotide sequences, amino acid sequences, or sugar molecules). Polymers may differ from naturally occurring polymers in terms of the molecules they link. For example, "non-naturally occurring" proteins may differ from naturally occurring proteins in their secondary, tertiary, or quaternary structures because they are chemically bonded to polypeptides (e.g., fusion proteins), lipids, carbohydrates, or any other molecules (e.g., covalent bonds, including peptide bonds, phosphate bonds, disulfide bonds, ester bonds, and ether bonds, etc.). Similarly, "non-naturally occurring" polynucleotides or nucleic acids may contain one or more other modifications (such as tagging or other molecules) at the 5' end, 3' end, and / or between the 5' and 3' ends (e.g., methylation) of the nucleic acid. A “non-natural” composition may differ from a naturally occurring composition in one or more of the following ways: (a) it has a component that is not found in nature; (b) it has a component that is not found in concentration in nature; (c) it omits one or more components that would normally be found in a naturally occurring composition; (d) it has a form that is not found in nature, such as: dried, freeze-dried, crystalline, or aqueous; and (e) it has additional components other than one or more natural components (such as buffers, detergents, dyes, solvents, or preservatives).

[0087] According to Formula 1 dye

[0088] The dyes used in various aspects of this invention have the structure of Formula 1 (also known as 4-(2-pyridiniazo)aniline), which has the structure shown in the figure below:

[0089]

[0090] in:

[0091] R1 and R5 are each independently selected from H, halogen, nitro, cyano, sulfonic acid, carboxyl, trifluoromethyl, trichloromethyl and tribromomethyl;

[0092] R2 and R3 are each independently selected from lower alkyl groups, which optionally contain a terminal sulfonic acid group; and

[0093] R4 is H, hydroxyl, or carboxyl.

[0094] The dyes of Formula 1 are from the commercially available 4-(2-pyridineazo)aniline dye family (also referred to as pyridineazoaniline dyes in this article).

[0095] According to the preferred compounds of structural formula (I), which include any associated counterion, they are water-soluble azo dyes. Particularly preferred water-soluble azo dyes contain a sulfonic acid group. Most preferred azo dyes are pyridine azo dyes, which have an electron-withdrawing substituent at the R1 position, such as halogen, nitro, cyano, sulfonic acid, trifluoromethyl, and trichloromethyl, most preferably bromo or nitro.

[0096] In some embodiments, at least one of R1 and R5 is a nitro group. In one embodiment, R1 is a nitro group.

[0097] In some embodiments, at least one of R1 and R5 is a halogen independently selected from F, Cl, Br, and I. For example, at least one of R1 and R5 may be independently selected from F, Cl, and Br. In some embodiments, at least one of R1 and R5 is Br (e.g., R1 is Br).

[0098] In some embodiments, R1 and R5 are each independently selected from F, Cl, Br, and I. For example, R1 and R5 may each be independently selected from F, Cl, and Br. In one embodiment, both R1 and R5 are Br.

[0099] In other embodiments, one of R1 and R5 is a halogen selected from F, Cl, Br and I, and the other is selected from H, nitro, sulfonic acid and carboxyl. For example, one of R1 and R5 may be selected from F, Cl and Br (such as Br), and the other may be selected from H and nitro (such as H).

[0100] In some embodiments, R1 is a halogen selected from F, Cl, Br, and I. For example, R1 may be selected from F, Cl, and Br (e.g., Br). In some embodiments where R1 is a halogen, R5 is independently selected from F, Cl, Br, and I. For example, when R1 is a halogen, R5 may be independently selected from F, Cl, and Br (e.g., Br). In other embodiments where R1 is a halogen, R5 is selected from H, nitro, cyano, sulfonic acid, carboxyl, trifluoromethyl, trichloromethyl, and tribromomethyl. For example, when R1 is a halogen, R5 may be selected from H, nitro, sulfonic acid, and carboxyl (e.g., H or nitro). In one embodiment where R1 is a halogen, R5 may be H. In one embodiment, R1 is Br and R5 is H. In another embodiment, R1 is Br and R5 is Br. In yet another embodiment, R1 is Br and R5 is nitro.

[0101] In some embodiments, R5 is a halogen selected from F, Cl, Br, and I. For example, R5 may be selected from F, Cl, and Br (e.g., Br). In some embodiments where R5 is a halogen, R1 is independently selected from F, Cl, Br, and I. For example, when R5 is a halogen, R1 may be independently selected from F, Cl, and Br (e.g., Br). In other embodiments where R5 is a halogen, R1 is selected from H, nitro, cyano, sulfonic acid, carboxyl, trifluoromethyl, trichloromethyl, and tribromomethyl. For example, when R5 is a halogen, R1 may be selected from H, nitro, sulfonic acid, and carboxyl (e.g., H or nitro). In one embodiment where R5 is a halogen, R1 may be H. In one embodiment, R5 is Br and R1 is H. In another embodiment, R5 is Br and R1 is Br. In yet another embodiment, R5 is Br and R1 is nitro.

[0102] In some embodiments, R2 and R3 are each independently a lower alkyl group having 1 to 10 carbon atoms (C10, C20, C3 ... 1-10 -alkyl), preferably 1 to 4 carbon atoms (C 1-4 -alkyl), which may be straight or branched, and may optionally have a terminal sulfonic acid group. For example, in some embodiments, the R2 and R3 groups are each independently selected from: butyl, such as n-butyl, sec-butyl, isobutyl or tert-butyl; propyl, such as n-propyl or isopropyl; ethyl; or methyl; wherein each group is optionally and independently substituted with a terminal sulfonic acid group.

[0103] In some embodiments, R2 and R3 groups are each independently n-butyl, sec-butyl, isobutyl, tert-butyl, propyl, n-propyl, isopropyl, ethyl, or methyl, wherein each group is optionally and independently substituted with a terminal sulfonic acid group. Preferably, R2 and R3 are each independently selected from ethyl and methyl, and they are each optionally and independently substituted with a terminal sulfonic acid group. In one embodiment, R2 and R3 are both ethyl, each optionally and independently substituted with a terminal sulfonic acid group. In another embodiment, one of R2 and R3 is ethyl and the other is methyl, each optionally and independently substituted with a terminal sulfonic acid group. In a further embodiment, R2 and R3 are both methyl, each optionally and independently substituted with a terminal sulfonic acid group.

[0104] In some embodiments, at least one of R2 and R3 contains a terminal sulfonic acid group. In other embodiments, only one of R2 and R3 contains a terminal sulfonic acid group. In a further embodiment, neither R2 nor R3 contains a terminal sulfonic acid group.

[0105] Preferably, R2 and R3 are each independently selected from: butyl, such as n-butyl, sec-butyl, isobutyl, or tert-butyl; propyl, such as n-propyl or isopropyl; ethyl; or methyl, wherein one of R2 and R3 is substituted with a terminal sulfonic acid group. Most preferably, R2 and R3 are each independently selected from methyl and ethyl, wherein one of R2 and R3 (such as R2) is substituted with a terminal sulfonic acid group. In one embodiment, one of R2 and R3 is ethyl, and the other is an ethyl substituted with a terminal sulfonic acid group. In another embodiment, one of R2 and R3 is methyl, and the other is an ethyl substituted with a terminal sulfonic acid group.

[0106] In some embodiments, R4 is a hydroxyl or carboxyl group. In other embodiments, R4 is H. Preferably, R4 is a hydroxyl group.

[0107] The monocyclic or bicyclic heteroaromatic group may be selected from 2H-pyrrolyl, pyrrolyl, imidazolyl, benzimidazolyl, pyrazolyl, indazolyl, purinyl, 8-azapurinyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, 4H-quinazinyl, isoquinolyl, quinolyl, phthalazinyl, naphridyl, quinoxalinyl, quinazolinyl, quinolinyl, pteridinyl, indoleyl, 3H-indolyl, indolyl, isoindolyl, oxazolyl, isoxazolyl, thiazolyl, isothiazolyl, tetrazolyl, furazanyl, thiophene, furanyl, or benzo[d]pyrazolyl. More preferably, the monocyclic or bicyclic heteroaromatic group is selected from pyridyl, such as 2-, 3-, or 4-pyridyl, and thiazolyl, such as 2-thiazolyl.

[0108] The acyl group can be a lower alkyl carbonyl group containing 1 to 5 carbon atoms (C1-C5), such as acetyl, propionyl, n-propyl or isopropyl carbonyl, or n-butyl, isobutyl or tert-butyl carbonyl, or aryl carbonyl, such as benzoyl.

[0109] Preferred examples of compounds according to Formula 1 include: 2-(5-bromo-2-pyridiniazo)-5-[N-propyl-N-(3-sulfopropyl)amino]phenol disodium salt dihydrate (abbreviated as 5-bromo-PAPS) and 2-(5-nitro-2-pyridiniazo)-5-[N-propyl-N-(3-sulfopropyl)amino]phenol disodium salt dihydrate (abbreviated as 5-nitro-PAPS). The dye of Formula 1 may be 3,5-dibromo-PAESA.

[0110] This article provides the pyridine azo aniline compound of formula 1 ( Figure 1A ) working examples, more specifically Figure 1B The dyes used for PCR and LAMP described in [the document].

[0111] According to Formula 1, dyes combine with metal ions to form dye-metal complexes, and selections are made from a wide range of structures to provide improvements to existing molecular biological reaction colorimetric detection methods.

[0112] Pyridine azo aniline compounds of formula 1 ( Figure 1A More specifically, Figure 1B The dyes described herein have phenolic and pyridine azo moieties and sulfonic acid groups that enhance water solubility. These dyes can form complexes with various metal ions such as Mn(II), Ca(II), Fe(II), Re(II), Co(III), Cr(III), Cu(II), Ni(II), Mn(II), and Zn(II) by coordinating with the oxygen and azo groups of the phenolic group and the nitrogen group of the pyridine group. In all aspects of the invention, the metal ion is (including the metal salt) any metal ion that (i) can form a complex with the dye of Formula 1 and (ii) can be removed from the dye-metal complex in the presence of pyrophosphate. The metal ion is preferably a divalent manganese ion (Mn... 2+ ).

[0113] In some embodiments, the dye according to Formula 1 is combined with one or more divalent metal ions selected from the group consisting of Mg(II), Mn(II), Fe(II), Co(II), Ni(II), Cu(II), and Zn(II), preferably Mn(II). The dye may be combined with selected divalent metal ions in salt form such as Mn(II) (e.g., MnCl2, MnSO4, MnCO3, or Mn(NO3)2; preferably MnCl2). In some embodiments of the invention, the dye according to Formula 1 is complexed with one or more divalent metal ions selected from Mg(II), Mn(II), Fe(II), Co(II), Ni(II), Cu(II), and Zn(II), preferably Mn(II), to form a dye:metal complex, wherein the divalent metal ions can be removed from the dye:metal complex in the presence of pyrophosphate.

[0114] This demonstrates the color change of this dye family in the presence of pyrophosphate. Pyrophosphate is a product of many enzymatic reactions. For example, when NTPs (nucleoside triphosphates) are hydrolyzed to nucleoside monophosphates (NMPs), such as during nucleic acid amplification, pyrophosphate is released from nucleoside triphosphates (NTPs) (NTPs, such as dNTPs or rNTPs, including ATP (an energy source)).

[0115] Under the action of enzymes, pyrophosphate released from the substrate (such as NTP) competes with pyridinium azoaniline dye for binding to metal ions. As a result, metal ions are released from the dye and bind to pyrophosphate, forming an insoluble precipitate (e.g., Mn). 2+ The dye combines with pyrophosphate to form insoluble manganese pyrophosphate (II). Without being bound by theory, pyrophosphate chelates the metal ion from the dye-metal complex, resulting in a detectable hypochromic shift. Preferably, the dye changes its absorbance characteristics (color) in response to the loss of metal ions from the pyridinium azoaniline-metal ion complex, such that the dye-metal ion complex exhibits absorbance characteristics at one wavelength, while the dye alone exhibits absorbance characteristics at a second wavelength distinct from the first wavelength after the metal ion release. Therefore, the dye-metal ion complex has a modified absorption signal compared to the uncomplexed dye.

[0116] Therefore, a dye-metal ion complex is a color, while the color of a dye alone is distinctly different from the color of a dye-metal ion complex (e.g., when combined with Mn). 2+When complexed, 5-bromo-PAPS is red and 5-nitro-PAPS is purplish-brown; when not complexed, both dyes are yellow. Releasing metal ions from the dye and binding them with pyrophosphate restores the original absorption signal, thus restoring the color (e.g., 5-bromo-PAPS and 5-nitro-PAPS turn yellow).

[0117] Therefore, this family of dyes can be used as indicators of specific enzymatic reactions. In one embodiment, the dyes of Formula 1 are used to determine the reverse transcription of target RNA, or to detect RNA and / or DNA generated by isothermal DNA amplification or PCR DNA amplification methods. It is desirable that the color change of the dye relying on the metal salt does not interfere with the activity of the enzyme reaction.

[0118] The observed improvements achieved using the dye of Formula 1 include a significant difference in visible color between samples in the presence of pyrophosphate (e.g., yellow) and samples in the absence of pyrophosphate (e.g., red or purplish-brown), which also corresponds to a significant difference in the wavelength of the spectral analysis.

[0119] In a preferred embodiment, divalent manganese ions are chosen to improve sensitivity and binary color change (see...). Figure 2A-2D ). Figure 2A-2B The image shows 5-bromo-PAPS and 5-nitro-PAPS in Mn 2+ In the presence of ions, it provides the desired visually detectable binary color change (from red to yellow). Figure 2A-2B In this study, manganese chloride was tested. However, manganese sulfate, manganese nitrate, manganese chloride, manganese carbonate, or any other manganese salt were expected to effectively induce the dye-manganese complex to form the observed red or purplish-brown color and displace manganese by pyrophosphate, thereby changing the dye color to yellow. The dye of Formula 1, more specifically, is Figure 1B The dye in the absence of Mn 2+ The color of manganese ions after chelation is yellow. At the pH value of the amplification reaction, the metal ion-dye complexes of 5-bromo-PAPS and 5-nitro-PAPS are red and purplish-brown, respectively.

[0120] Figure 1B The dyes of Formula 1 shown herein are sensitive to pyrophosphate generated by NTP hydrolysis, for example, during nucleic acid amplification. This sensitivity is determined using any of a variety of amplification methods. These dyes are capable of detecting relatively low concentrations of nucleic acid substrates and thus demonstrate suitability for diagnostic detection in environments with low concentrations of nucleic acids. Figure 1BThe dyes of Formula 1 shown can also quantify the yield of target nucleic acids and amplicones in purified or crude samples. These dyes are unaffected by pH changes or the presence of various contaminants, such as those from chromatographic columns, viral transport media (VTMs), nucleic acid-containing bodily fluids (e.g., saliva or nasal mucosa), cell lysates, or carrier buffers from in vitro translation mixtures. Other advantages include the dyes' ability to be lyophilized with or without other reagents.

[0121] Enzymes that release pyrophosphate from substrates

[0122] In various aspects of the invention, the enzyme that releases pyrophosphate from the substrate can be any enzyme that cleaves the substrate, wherein enzyme cleavage of the substrate results in the production of pyrophosphate. For example, the enzyme can hydrolyze nucleoside triphosphate (NTP) substrates, which can be dNTPs or rNTPs (such as ATP), wherein hydrolysis of NTPs releases pyrophosphate.

[0123] Examples of enzymes that release pyrophosphate by hydrolyzing NTPs include DNA polymerases, RNA polymerases, reverse transcriptases, primases, ligases, helicases, nucleotide pyrophosphatases (Ppases) / phosphodiesterases, RNA uncapping enzymes (RNA 5' pyrophosphate hydrolases), or geranyl pyrophosphate synthases. The enzyme is preferably a DNA polymerase, which may be a thermostable DNA polymerase or a strand-displacement DNA polymerase; an RNA polymerase; or a reverse transcriptase. In some embodiments, the enzyme is a DNA polymerase. For example, the DNA polymerase may be Bst polymerase, Bsu polymerase, archaea DNA polymerase, Taq polymerase, or variants thereof.

[0124] Composition

[0125] This invention provides a composition comprising an enzyme that releases pyrophosphate from a substrate and a pyridine azoaniline dye; preferably a dye of Formula 1. The enzyme may be any enzyme as defined above, preferably a DNA polymerase, RNA polymerase, or reverse transcriptase. The dye may be any dye of Formula 1 as defined above, most preferably 5-bromo-PAPS or 5-nitro-PAPS.

[0126] In some embodiments, the composition further comprises a metal salt, such as a Mn(II), Mg(II), Ca(II), Fe(II), Re(II), Co(III), Cr(III), Cu(II), Ni(II), or Zn(II) salt; preferably divalent manganese (Mn) 2+ Salts, such as MnCl2, MnSO4, MnCO3, or Mn(NO3)2. In some embodiments, the composition includes a metal ion, preferably a divalent manganese ion (such as Mn2). 2+A complex dye in which metal ions can be removed from the dye-metal complex in the presence of pyrophosphate.

[0127] The dye of Formula 1, more specifically Figure 1B The dyes in these compounds are yellow when they do not contain metal ions or when they have chelated metal ions. When they complex with metal ions, the dyes exhibit different colors. For example, at the pH of the amplification reaction, the Mn of 5-bromo-PAPS and 5-nitro-PAPS... 2+ The dye complexes are red and purplish-brown, respectively. Metal ions (such as Mn) are released from the dye. 2+ (Ions) will cause the color to turn yellow.

[0128] In some embodiments, the composition may comprise two or more different pyridine azo aniline dyes, preferably at least one of which is a dye of Formula 1, which produces the same or different visual colors in the presence of divalent metal ions to provide further contrast in colorimetric detection. In other embodiments, two or more divalent metal ions are combined with one or more pyridine azo aniline dyes, preferably dyes of Formula 1, to provide further contrast in colorimetric detection.

[0129] Figures 3A-3C and Figures 4A-4C This indicates that the concentration of divalent manganese ions is not important for achieving the desired effect. This was observed at all tested manganese salt concentrations, i.e., when used in combination with 50 μM–100 μM 5-bromo-PAPS or 5-nitro-PAPS, with manganese chloride concentrations ranging from 50 μM to 150 μM. Therefore, in some embodiments, the composition contains any concentration of Mn in the range of 10 μM–500 μM. 2+ Such as in the range of 25 μM-250 μM or 50 μM-150 μM; and / or containing any concentration of dye in the range of 10 μM-350 μM, such as in the range of 25 μM-150 μM or 50 μM-100 μM. For example, the composition may contain about 25 μM, 50 μM, 75 μM or 100 μM Mn. 2+ And 50μM or 75μM dyes; such as 100μM Mn 2+ and 75 μM dye, or 50 μM Mn 2+ And 50μM dye.

[0130] The concentration ratio between the preferred dye and divalent metal ions in the composition can be varied to provide further contrast in colorimetric detection. For example... Figures 4A-4C As shown, suitable dye-to-metal ratios were determined for 5-bromo-PAPS and 5-nitro-PAPS. The examples used... Figure 1BThe manganese chloride to dye ratio in the composition ranges from 1:2 to 3:1. However, this range is expected to extend to manganese salt ratios as high as 5:1 to 1:5. Therefore, the ratio of manganese salt to dye in the composition can be any ratio between 5:1 and 1:5. In some embodiments, the molar ratio of manganese salt to dye is greater than 1.

[0131] The composition may further comprise an enzyme substrate, wherein enzymatic cleavage of the substrate results in the production of pyrophosphate. In some preferred embodiments, the dye-metal complex is substantially unaffected by the NTPs and any other phosphorylation that may be present in the composition. Therefore, the composition may further comprise one or more NTPs selected from rNTPs and dNTPs (such as ATP). In some embodiments, the molar ratio of NTP to manganese salt is greater than 1.

[0132] The composition may include a nucleic acid sample containing, for example, a target DNA or RNA. The nucleic acid (e.g., the target DNA or RNA of interest) may be derived from, for example, human or animal subjects (e.g., human genomic DNA) or from prokaryotes (e.g., plasmid DNA), and / or may contain nucleic acids from pathogens such as bacteria or viruses (e.g., viral RNA, such as SARS-CoV-2 RNA). The nucleic acid sample may be a clinical sample selected from: saliva, nasal mucosa, blood, urine, tissue biopsy, and cell scrapings, or an environmental sample selected from water, sewage, soil, and plant or animal material used as food.

[0133] The composition may also contain one or more primers.

[0134] The composition may further contain a buffer, such as an amplification buffer. As shown herein, PAPS-based detection allows for the use of larger amounts of buffer and thus overcomes key limitations associated with pH-based colorimetric LAMP.

[0135] The composition may further comprise one or more detergents, particularly cationic detergents such as hexadecylpyridine chloride (CPC), hexadecyltrimethylammonium bromide (CTAB), dodecyltrimethylammonium bromide (DTAB), polydiallyldimethylammonium chloride (PDADMAC), or hexadecyltrimethylammonium (CP). The presence of detergents can enhance the reaction of colorimetric dyes; for example, detergents can enhance the signal intensity of samples containing very small amounts of amplified nucleic acids.

[0136] The composition may be lyophilized. Alternatively, the composition may be an aqueous solution.

[0137] In some embodiments, the composition is a mother liquor mixture for, for example, an amplification reaction. In other embodiments, the composition may be combined with other reagents to form a mother liquor mixture for, for example, an amplification reaction.

[0138] Mother liquor mixture

[0139] Pyridinium azoaniline dyes (such as preferred formula 1) and / or metal salts (or dye-metal complexes) can be bound to one or more reagents to detect reactions that produce pyrophosphate. Examples of such reactions include: amplifying nucleic acids to detect the presence of target nucleic acids; ligating adaptors in NGS libraries; removing pyrophosphate from capped RNA used in various RNA workflows; measuring RNA synthesis by RNA polymerase under selected promoters, etc. Reagents, which may include enzymes that release pyrophosphate from substrates, can be added to the mother liquor mixture of the reaction.

[0140] A mother liquor mixture is a reagent mixture used to add to a substrate to perform a reaction or series of reactions. A mother liquor mixture may include all the reagents required for the reaction except for the substrate (such as a target nucleic acid). Optionally, a mother liquor mixture may contain only the essential or "core" reagents required for the reaction, but not all the reagents used in the reaction. For example, a mother liquor mixture for an amplification reaction may include polymerase and dNTPs in a suitable buffer. A mother liquor mixture for an amplification reaction may include DNA polymerase, dNTPs, and oligonucleotide primers for a specific target. Another type of mother liquor mixture may include reverse transcriptase, DNA polymerase, dNTPs, and optional oligonucleotide primers. If the mother liquor mixture is for PCR, it may contain reagents, such as aptamers or antibodies, to block the activity of the polymerase at room temperature.

[0141] Therefore, a reagent stock solution mixture for reactions, such as amplification reactions, is provided, the reagent stock solution mixture further comprising a pyridine azo aniline dye (as preferred formula 1) and a metal salt (such as a manganese salt, such as Mn). 2+ Optionally, it exists in the form of a dye:metal complex. Combinations of the following substances are also provided: (i) reagent stock solutions, such as those used for amplification reactions; and (ii) a dye of Formula 1 and a metal salt (such as a manganese salt, such as Mn). 2+ One or both of the following, such as in the form of a dye:metal complex. Therefore, the dye and / or metal salt (or dye:metal complex) can be included in the mother liquor mixture, or can be provided separately and used in combination with the mother liquor mixture. Although for workflow convenience, the dye and metal salt (or dye:metal complex) can be included in the amplification mother liquor mixture; however, depending on the design of the assay, for convenience, the dye, metal salt, or complex may optionally be combined with any single component of the mother liquor mixture rather than the entire mother liquor mixture.

[0142] The mother liquor mixture may further contain an enzyme that releases pyrophosphate from the substrate, as described above, preferably a DNA or RNA polymerase. The mother liquor mixture may further contain the enzyme's substrate (e.g., one or more NTPs) that releases pyrophosphate when cleaved by the enzyme. Optionally, the enzyme and / or its substrate may be provided separately to be combined with the mother liquor mixture.

[0143] The mother liquor mixture may include nucleoside triphosphates, primers, aptamers, ligases, nicking endonucleases, restriction endonucleases, DNA glycosylases, and / or exonucleases. Further optional additional reagents in the mother liquor mixture may include helicases, nicking endonucleases, guanidine hydrochloride, detergents, reducing agents, glycerol, hygroscopic sugars, buffers, uracil DNA glycosylases or any of the dUTPs carried by DNA between reaction samples, and / or magnesium salts, wherein the concentration of the magnesium salt should be carefully titrated to avoid inhibiting the removal of manganese from the dye in the presence of pyrophosphate, while the concentration of the magnesium salt should be sufficient to allow the enzyme reactions requiring magnesium ions to proceed.

[0144] In one embodiment, the provided mother liquor mixture is capable of amplifying nucleic acids when bound to a sample containing nucleic acids. Dyes and metal salts (such as dye:metal complexes) may be included in or bound to any mother liquor mixture intended to perform target DNA or RNA amplification (in the presence of reverse transcriptase), amplification methods such as LAMP, polymerase chain reaction (PCR), strand displacement amplification (SDA / NEAR), helicase-dependent amplification (HDA), multiple displacement amplification (MDA), rolling circle amplification (RCA), ligation-mediated amplification, whole genome amplification (WGA), nucleic acid sequence-based amplification (NASBA), recombinase polymerase amplification (RPA), Cas-CrispR-related nonspecific amplification (CRISPR-NAS), and transcription-mediated amplification (TMA).

[0145] The amplification mother liquor mixture typically includes one or more DNA and / or RNA polymerases. Examples of DNA polymerases include Taq polymerase or archaea polymerase or variants thereof. Variants of archaea polymerases include fusion proteins, where the fusion can be a fusion between the archaea polymerase and a DNA-binding domain, and may have specific or non-specific binding properties. The DNA polymerase can be a strand-displacement DNA polymerase, such as a bacterial polymerase, like Bst or Bsu polymerase, where variants include truncation at the N-terminus or C-terminus, or mutations therebetween. Examples of Bst variants are described in US8,993,298, US9,127,258, US9,157,073, EP2751264, US9,447,445, and US9,963,687. DNA polymerases, RNA polymerases, or reverse transcriptases can also be bacteriophage polymerases, such as Phi 29 DNA polymerase. Optionally, the polymerase can be a fusion protein, such as a fusion protein between two different polymerases, or a fusion protein between a polymerase and a DNA binding domain and / or binding affinity moiety. The polymerase can be immobilized on a solid substrate such as beads or pillars.

[0146] The mother liquor mixture may contain reverse transcriptase and DNA polymerase to enable the detection of RNA target sequences, wherein the RNA is first converted to cDNA by reverse transcriptase and then amplified by thermal cycling (PCR) or isothermal amplification. A mother liquor mixture using reverse transcriptase for the synthesis of first-strand cDNA may be provided. Mother liquor mixtures for NASBA or TMA may include reverse transcriptase and RNA polymerase. Optionally, the mother liquor mixture may include RNA polymerase but not DNA polymerase or reverse transcriptase for in vitro transcription.

[0147] Therefore, the present invention provides a mother liquor mixture comprising a dye of Formula 1 and / or a metal salt, wherein the metal ions form a complex with the dye (e.g., in the form of a dye:metal complex) and are used in combination with one or more polymerases and / or reverse transcriptases, such as DNA polymerase. Combinations of the following substances (such as kits comprising): (i) a dye of Formula 1 and / or a metal salt (e.g., a dye:metal complex); and (ii) a mother liquor mixture comprising one or more polymerases and / or reverse transcriptases, such as DNA polymerase.

[0148] The mother liquor mixture may also include NTPs, which may be dNTPs and / or rNTPs. In a preferred embodiment, the dye-metal complex is not substantially affected by the NTPs and any other phosphorylated substances that may be present in the amplification buffer prior to the amplification reaction. The mother liquor mixture may additionally include one or more primers, aptamers, ligases, nick endonucleases, restriction endonucleases, DNA glycosylases, and / or exonucleases.

[0149] The concentration of the reagent in the mother liquor mixture is at least 2×, 5×, or 10× of the concentration required for the reaction, so that the 2×, 5×, or 10× mother liquor mixture can be diluted (2×, 5×, or 10× respectively) into the sample to obtain a 1× solution.

[0150] The mother liquor mixture can be stored or formulated into a liquid formulation for storage as a liquid preparation at low temperatures, such as 4°C, -20°C, or -70°C, or in between. In these embodiments, the mother liquor mixture may contain one or more stabilizers, such as glycerol, such as at least 10% glycerol, preferably more than 20% glycerol, such as at least 50% glycerol; and / or one or more detergents, such as one or more nonionic detergents, zwitterionic detergents, anionic detergents, or cationic detergents.

[0151] The mother liquor mixture can optionally be lyophilized (or lyophilized formulation) for storage at room temperature. In these embodiments, the mother liquor mixture may contain sugars suitable for lyophilization, such as stachyose, trehalose, or other sugars suitable for binding water molecules. In these embodiments, the light absorption properties of the composition and the pyridine azoline dye-divalent metal complex are not substantially affected by the lyophilization process. As shown in Figure 13, the lyophilized mother liquor mixture containing Formula 1 dye and manganese ions exhibits similar LAMP activity to the unly lyophilized equivalent formulation. This represents a significant advantage for extending the shelf life of the mother liquor mixture or for its use in the field, for example, at medical points for infectious disease testing.

[0152] It has been demonstrated that the reagents in the mother liquor mixture do not substantially affect the sensitivity of the color change of the colorimetric dye after target-specific amplification. In some cases, depending on the user's needs, it may be desirable to combine the dye and metal ions of Formula 1 (e.g., dye:metal complex) with the dye-deficient mother liquor mixture during the reaction.

[0153] The dye and metal salt (or dye:metal complex) can bind to the test sample or control sample. If the dye and metal salt (or dye:metal complex) are provided separately from the mother liquor mixture or a portion thereof, the mother liquor mixture or the remainder thereof can be added to the sample in a separate step. Therefore, a reaction mixture is provided comprising the dye and metal salt (or dye:metal complex), one or more reaction reagents (e.g., added to the reaction as a mother liquor mixture), and a substrate. For example, the reaction mixture may be an amplification reaction mixture comprising the dye and metal salt (or dye:metal complex), a polymerase, one or more NTPs, and a nucleic acid substrate.

[0154] Reagent test kit

[0155] Kits containing any of the above-described reagents are provided. In one embodiment, a kit is provided comprising an enzyme that releases pyrophosphate from a substrate, a pyridinium azoaniline dye (preferably a dye of Formula 1), and a metal salt, preferably a divalent manganese salt. The enzyme (and its substrate), dye, and salt are described above. For example, the kit may contain RNA or DNA polymerase, optionally one or more rNTPs or dNTPs, a manganese salt, and a dye of Formula 1 as described above. The kits of the present invention may also contain any one or more NTPs, primers, other enzymes, buffers, reagents, or reagent compositions; and, in some cases, instructions for use.

[0156] The components in the kit can be mixed together, separated from each other, or any combination of two. For example, the kit may include the composition of the present invention as described above, including an enzyme and a dye, and a metal salt (such as a manganese salt) may be provided in the composition or separately. Optionally, the enzyme may be in one container, and the dye and metal salt (such as a dye:metal complex) may be in a separate container. Alternatively, the enzyme and metal salt may be in one container, and the dye in a separate container.

[0157] In some embodiments, the components of the kit may be combined with each other (or are suitable for combination), and optionally with other reagents not included in the kit, to form a stock solution mixture for a reaction (e.g., an amplification reaction). In one embodiment, the kit may contain a dye combined with a stock solution mixture (such as an amplification stock solution mixture) to form a single reagent. In another embodiment, the kit may contain a container for the dye and a container for a stock solution mixture lacking the dye, adapted to be combined in a reaction, such as an amplification reaction.

[0158] Methods for detecting pyrophosphate

[0159] A method for detecting pyrophosphate is provided, comprising:

[0160] (a) A reaction mixture is prepared by mixing a metal salt, an enzyme, an enzyme substrate (which releases pyrophosphate when cleaved by the enzyme), and a dye of Formula 1.

[0161]

[0162] in:

[0163] R1 and R5 are each independently selected from H, halogen, nitro, cyano, sulfonic acid, carboxyl, trifluoromethyl, trichloromethyl and tribromomethyl;

[0164] R2 and R3 are each independently selected from lower alkyl groups, optionally containing a terminal sulfonic acid group; and

[0165] R4 is H, hydroxyl, or carboxyl group;

[0166] (b) Incubate the reaction mixture under conditions where the enzyme cleaves the substrate to produce pyrophosphate; and

[0167] (c) Observe the color change of the reaction mixture, where the color change indicates the formation of pyrophosphate. The dye, metal salt, and enzyme of Formula 1 used in this method, and their substrates, are each as described above.

[0168] In some embodiments, the dye is selected from 2-(5-bromo-2-pyridiniazo)-5-[N-propyl-N-(3-sulfopropyl)amino]phenol disodium salt dihydrate (5-bromo-PAPS), 2-(5-nitro-2-pyridiniazo)-5-[N-propyl-N-(3-sulfopropyl)amino]phenol disodium salt dihydrate (5-nitro-PAPS), and 2-(3,5-dibromo-2-pyridiniazo)-5-(N-ethyl-N-sulfopropylamino)benzene (3,5-dibromo-PAESA). In one embodiment, the dye is 2-(5-bromo-2-pyridiniazo)-5-[N-propyl-N-(3-sulfopropyl)amino]phenol disodium salt dihydrate (5-bromo-PAPS) or 2-(5-nitro-2-pyridiniazo)-5-[N-propyl-N-(3-sulfopropyl)amino]phenol disodium salt dihydrate (5-nitro-PAPS).

[0169] The metal salt comprises any metal ion that (i) can form a complex with the dye by coordination with the oxygen of the phenolic group and the nitrogen of the azo and pyridine groups, and (ii) can be removed from the dye-metal complex in the presence of pyrophosphate. The metal salt is preferably a divalent manganese salt (Mn). 2+ The dye, such as MnCl2, MnSO4, MnCO3, or Mn(NO3)2, is preferred. In one embodiment, step (a) of the method includes conjugating a complex of the dye and the metal ion (dye:metal complex) with an enzyme and a substrate to produce a reaction mixture. Thus, in some embodiments, the dye of Formula 1 is complexed with a metal ion, preferably MnCl2. 2+ For example.

[0170] In one embodiment, step (a) of the method includes combining a dye and a metal salt (or a dye:metal complex) with an enzyme and further optional reagents to form a reagent stock solution mixture for reaction, and then combining the stock solution mixture with a substrate to produce a reaction mixture. Alternatively, step (a) of the method includes combining a dye and a metal salt (or a dye:metal complex) with a substrate, and then adding a pre-formed stock solution mixture containing an enzyme and other reaction reagents to produce a reaction mixture.

[0171] As described herein, the enzyme can be any enzyme that cleaves the substrate to release pyrophosphate from it. For example, the substrate can be NTPs (dNTPs and / or rNTPs). In a preferred embodiment, the dye-metal complex is substantially unaffected by the NTPs and any other phosphorylation that may be present in the amplification buffer prior to the amplification reaction. Therefore, the reaction mixture can contain one or more nucleoside triphosphates (NTPs), selected from rNTPs and dNTPs. Enzymes that hydrolyze dNTPs or rNTPs to release pyrophosphate include, for example, DNA polymerases, RNA polymerases, reverse transcriptases, primases, ligases, helicases, nucleotide pyrophosphatases / phosphodiesterases, RNA uncapping enzymes (RNA 5' pyrophosphate hydrolases), and geraniyl pyrophosphate synthases (for producing terpene precursors). Therefore, in one embodiment of the method, the enzyme is a DNA polymerase, RNA polymerase, or reverse transcriptase.

[0172] Dyes and metal salts (or dye-metal complexes) can bind individually to one or more of these enzymes and substrates, or to one or more other reagents, such as adding the reagent to the mother liquor mixture, to detect the reaction that produces pyrophosphate. In various enzyme-dependent workflows utilizing NTPs, dye-metal complexes can be used as indicators of NTP hydrolysis. Examples of reactions involving NTP hydrolysis include: amplifying nucleic acids to detect the presence of target nucleic acids; ligating aptamers from NGS libraries; removing pyrophosphate from capped RNA used in various RNA workflows; and measuring RNA synthesis by RNA polymerase under the action of selected promoters.

[0173] In some implementations, metal salts (e.g., Mn) 2+ Salts (such as MnCl2) are added to the reaction mixture at any concentration in the range of 10 μM to 500 μM, such as in the range of 25 μM to 250 μM or 50 μM to 150 μM; and / or dyes are added to the reaction mixture at any concentration in the range of 10 μM to 350 μM, such as in the range of 25 μM to 150 μM or 50 μM to 100 μM. For example, 25 μM, 50 μM, 75 μM, or 100 μM MnCl2. 2+ and 50 μM or 75 μM dyes; for example, 100 μM Mn 2+ and 75 μM dye, or 50 μM Mn 2+ And 50 μM dye. The concentration ratio of dye to metal salt has been discussed above. For example, the metal salt and dye can be added to the reaction mixture at any concentration ratio in the range of 5:1 to 1:5 or 2:1 to 1:2. In some embodiments, the molar ratio of divalent manganese salt to dye is greater than 1.

[0174] In one embodiment, the reaction mixture comprises a dye, a manganese salt, a polymerase, rNTPs or dNTPs, and a template nucleic acid; the reaction mixture is incubated under conditions suitable for nucleic acid amplification; and a color change indicates that a product has been amplified. For example, the reaction mixture may comprise an amplification mixture for loop-mediated isothermal amplification (LAMP), polymerase chain reaction (PCR), strand displacement amplification (SDA), helicase-dependent amplification (HDA), multiple displacement amplification (MDA), rolling circle amplification, ligation-mediated amplification, whole genome amplification (WGA), nucleic acid sequence-based amplification (NASBA), or recombinase polymerase amplification (RPA). Conditions suitable for these amplification methods are well known in the art. For example, if the reaction mixture is a PCR reaction mixture, step (b) may include thermal cycling of the reaction mixture. If the reaction mixture is a LAMP reaction mixture, step (b) may include incubating the reaction mixture under isothermal conditions.

[0175] As described herein, the color change of the dye family characterized by Formula 1 in the reaction mixture is a result of the release of pyrophosphate from the substrate (e.g., via NTP cleavage in an amplification reaction), which leads to the removal of metal ions from the dye. In the method of the present invention, the color change indicates the release of pyrophosphate and therefore the cleavage of the substrate (while the color of the reaction without a substrate control remains red). The color change can be detected by spectrophotometry, image analysis, or visual inspection. For example, step (c) of the method may include detecting a change in hue or a change in peak wavelength. The color change is preferably binary and is the result of the maximum optical density at different, distinct wavelengths being associated with a positive signal (pyrophosphate production, such as amplified nucleic acid) or a negative signal (no pyrophosphate production, e.g., no amplification, and therefore no target nucleic acid). In one embodiment, the color change in (c) is from red to yellow, where yellow indicates the production of pyrophosphate (and therefore the cleavage of the substrate). Color changes can be detected by observing the change in the wavelength peak height ratio before and after step (b); for example, where the wavelength peak height is in the range of 350nm-620nm, 430nm-480nm, and / or 520nm-620nm. In one embodiment, color changes are detected by observing an increase in absorbance at around 450nm and a decrease in absorbance at around 550nm.

[0176] Dyes and metal salts used for non-pH-dependent colorimetric assays (such as nucleic acid amplification assays) preferably have two or more, three or more, five or more, or seven or more of the following characteristics:

[0177] (a) When included in the amplification reagent stock solution mixture or amplification reaction mixture, the adverse effects on the selected reaction (such as nucleic acid amplification reaction) are minimized;

[0178] (b) Minimal negative impact on the sensitivity of amplification reactions used to detect low amounts of nucleic acids;

[0179] (c) Minimal interference with primer binding to target nucleic acid and with the specificity of the reaction;

[0180] (d) Color changes directly caused by the hydrolysis of nucleoside triphosphates are easily detected;

[0181] (e) Different wavelengths that are distinct from the color change of the dye;

[0182] (f) This dye will react with divalent metal ions (here, Mn) 2+ For example, a visible color change occurs due to a change in concentration, and this change is not affected by the presence of a standard buffer or a pH value between 7 and 9.

[0183] (g) This dye is available on the market;

[0184] (h) The dye is soluble in water;

[0185] (i) Dyes can be freeze-dried.

[0186] This article uses the pyridine azo aniline dye-manganese complex as an example to demonstrate that the sensitivity of amplification assays to the target nucleic acid is similar in the absence or presence of the dye:metal complex. Therefore, it is concluded that the dye:metal complex does not have a substantial adverse effect on the activity of DNA polymerase or reverse transcriptase.

[0187] Therefore, the colorimetric visual detection according to the method of the present invention enables the simple detection of pyrophosphate production, for example, as a result of nucleic acid amplification, which uses visible readings to indicate the presence or absence of pyrophosphate, thus indicating the amplification of the DNA or RNA target of interest.

[0188] Diagnostic testing of nucleic acids may require large-scale readings of plates containing numerous samples in a diagnostic laboratory. In these cases, it is desirable to use an inexpensive and efficient spectrophotometer that provides optical density values ​​for each sample at selected positive and negative wavelengths, where a computer can conveniently, accurately, and inexpensively process the data to determine peak ratios or hues based on the spectrophotometer readings.

[0189] Another application of colorimetric detection of amplification is to determine the concentration of amplified nucleic acid (e.g., DNA) by determining the peak ratio corresponding to the colors of the dye:metal complex (e.g., red) and the non-complexed dye (e.g., yellow) after amplification, and selectively comparing it with the peak height before amplification. In one embodiment, the method of the present invention may further include determining the amount of template nucleic acid or amplicon by determining the number of thermal cycles in the PCR amplification reaction that produce the predetermined wavelength peak height ratio.

[0190] Determining amplification yield can be particularly useful in NGS library preparation, cloning, and synthetic biology. As shown herein, when using the methods of the present invention, the PCR amplicon yield at which a color change is initially observable with the naked eye is lower than that when using pH-dependent dyes (e.g., yields of only 40-65 ng / μl).

[0191] Alternatively, it is desirable to use the technology in the field or at medical facilities, such as for isothermal amplification, to perform a small number of diagnostic tests. In these cases, visual detection of the target nucleic acid is desired through clear and distinct visual color changes. In such situations, it may be desirable to use a mobile phone camera or other methods to photograph the sample and perform image analysis to quantify the results.

[0192] In workflows that involve further processing or analysis of DNA or RNA synthesized in vitro or in vivo, colorimetric analysis ensures the success of the amplification step before secondary reactions. Examples of such workflows include library preparation for next-generation sequencing, generation of first-strand cDNA via reverse transcriptase, and in vitro transcription of RNA via RNA polymerase. An additional use of these colorimetric dyes is in DNA sequencing reactions, where bound dNTPs produce localized concentrations of pyrophosphate, and the corresponding color change is associated with the nucleotides bound to a specific sequence.

[0193] The recent COVID-19 pandemic has highlighted the need for simple, rapid, sensitive, and cost-effective viral diagnostic tests that can be used for large-scale (population testing) or small-scale (personalized testing) testing, capable of detecting viral nucleic acids from bodily fluids, most readily available being nasal swabs and saliva. Formula 1 dye-metal complexes have been shown to possess the properties required for achieving diagnostic tests such as these. COVID-19 tests have been used on environmental samples, such as wastewater. Similarly, Formula 1 dye-metal complexes are sensitive indicators that can be used in conjunction with selected amplification methods for real-time use in the field.

[0194] Therefore, in some embodiments of the method of the present invention, a pyridine azoaniline dye, a metal salt, and an enzyme and its substrate (and other optional reagents as desired) are combined with a sample containing or suspected of containing a target nucleic acid, which may be a pathogen nucleic acid, such as viral nucleic acid, optionally SARS-CoV-2 RNA; and a color change is observed to indicate the presence of the target nucleic acid in the reaction mixture. The sample may be any sample described herein, such as a clinical or environmental sample.

[0195] Synthetic biology requires the creation of bacterial clones containing synthetic constructs within plasmids. The ability to rapidly and easily identify correctly assembled clones accelerates the discovery process. For example, molecular biology workflows using colony PCR amplification are used to screen for correctly assembled DNA molecules and typically require agarose gel electrophoresis. As shown in this article and examples, colorimetric detection of amplifications using a Formula 1 dye-metal complex in the reaction mixture facilitates rapid screening of these reactions, avoiding electrophoresis, saving time, and increasing yield.

[0196] Example

[0197] The following are examples of specific embodiments for carrying out the present invention. These examples are for illustrative purposes only and are not intended to limit the scope of the invention in any way.

[0198] Materials and Methods

[0199] Purchased chemical reagents: 5-bromo-PAPS, 4-(2-pyridinium azo)resorcinol, Black T, MnCl2, CaCl2, CuCl2, ZnCl2, FeSO4, NiCl2, ReCl3, and CrCl2 were obtained from Sigma-Aldrich (St. Louis, MO), 5-nitro-PAPS from Dojindo Molecular Technologies (Rockville, MD), and hydroxynaphthol blue from Acros Organics. Unless otherwise stated, all molecular reagents were obtained from New England Biolabs (Ipswich, MA).

[0200] To screen for metal-sensing dyes and metal ions, using LAMP kit (DNA & RNA) (New England Biolabs, Ipswich, MA) and λDNA primer set (Tanner et al., Biotechniques 58(2), 59-68 (2015)) were used. 25 μL LAMP reactions were performed using 1 ng λDNA or NTC, in triplicate. Dyes and metal ions were diluted to a 25× concentration and then mixed with the LAMP reaction to a 1× concentration before incubation. The reaction was performed in a Bio-Rad CFX96. TM Incubation was performed at 65°C on a real-time PCR instrument (Bio-Rad Laboratories, Hercules, CA), with readings taken every 15 seconds (108 cycles, approximately 40 minutes). Before and after incubation, measurements were taken using an office scanner. The Perfection Photo Scanner V600 (Epson, Los Alamitos, CA) scanned and recorded the color of each reaction. An M5 microplate reader (Molecular Devices, San Jose, CA) was used to measure the absorbance of each reaction. When testing pyrophosphate requirements, 1 unit of isothermal inorganic pyrophosphatase was added to 25 μL of LAMP reaction. To compare the tolerance of the carry-on solution, [the following was used]. The elution buffer (10 mM Tris, pH 8.5) and VTM (BD) from the PCR purification kit (Qiagen, Hilden, Germany) were used. TM Universal viral transport medium (Becton Dickinson, Franklin Lakes, NJ). pH-based colorimetric LAMP reactions were performed using WarmStart Colorimetric LAMP 2× Mixed Stock Solution (DNA & RNA) as recommended by the product. For RT-LAMP, SARS-CoV-2 E1 and N2 primer sets and synthetic SARS-CoV-2 RNA from Twist Bioscience (Twist Synthetic SARS-CoV-2 RNA Control 2) (Twist Bioscience, South San Francisco, CA) were diluted to approximately 10 copies / μL in the presence of 10 ng / μL Jurkat total RNA.

[0201] By adding 50 μM PAPS dye and 50 μM Mn to 25 μL of LongAmp Taq 2× stock solution or OneTaq 2× stock solution in a standard buffer solution. 2+ PCR amplification was then detected colorimetrically. The same concentrations of PAPS dye and Mn were added to the Q5 High-Fidelity 2× mixed stock solution. 2+ Tween 20 was added to bring the final concentration to 0.1%. Primer pairs used for amplifying the λDNA fragment had the same forward primer 5'CCTGCTCTGCCGCTTCACGC (SEQ ID NO:1) and different reverse primers to produce products of different lengths. The reverse primers are shown below:

[0202] 5'TCCGGATAAAAACGTCGATGACATTTGC (SEQ ID NO:2); Product length 0.5kb;

[0203] 5'GATGACGCATCCTCACGATAATATCCGG (SEQ ID NO:3); Product length 1kb;

[0204] 5'CCATGATTCAGTGTGCCCGTCTGG (SEQ ID NO:4); product length 2.0 kb; and

[0205] 5'CGAACGTCGCGCAGAGAAACAGG (SEQ ID NO:5); Product length 5.0kb.

[0206] To amplify 1-2kb fragments of E. coli and 0.5kb-2kb fragments of human genomic DNA, a LongAmpHot Start Taq 2× mixed stock solution was used with 50μM bromine-PAPS and 25 or 50μM Mn. 2+ The reaction was carried out with 1 ng of E. coli DNA (approximately 200,000 copies) or 10 ng of Jurkat cell DNA (approximately 2,900 copies).

[0207] The primer sequence for the 1kb E. coli fragment is:

[0208] Positive: 5'CCTGGATCCAGATGCAGTAATACCGC(SEQ ID NO:6);

[0209] Reverse: 5'TCCGAGGATGGTATTCGTCATG(SEQ ID NO:7).

[0210] The primer sequence for the 0.5kb human fragment is as follows:

[0211] Positive: 5'GGGGCACCTTCTCCAACTCATACT(SEQ ID NO:8);

[0212] Reverse: 5'CGAGCTACCACGCAGACATCAACC(SEQ ID NO:9).

[0213] The primer sequence for the 1kb human fragment is:

[0214] Positive: 5'GGGGCACCTTCTCCAACTCATACT(SEQ ID NO:10);

[0215] Reverse: 5'CCTCATTTGGGGAGGGGGTTATCT(SEQ ID NO:11).

[0216] The primer sequences for the 2kb human fragment are:

[0217] Positive: 5'GAAGAGCCAAGGACAGGTAC(SEQ ID NO:12);

[0218] Reverse: 5'CCTCCAAATCAAGCCTCTAC(SEQ ID NO:13).

[0219] Using Quant-iT TM The dsDNA detection kit (Thermo Fisher Scientific, Waltham, MA) measures the DNA yield of a PCR reaction.

[0220] For colony PCR, a small fraction of E. coli colonies is transferred to 15 μL of water using a pipette tip. 1 μL of bacterial suspension is used for each PCR reaction with LongAmp.

[0221] Similar conditions were used to amplify the 6136bp and 5292bp fragments, except that the extension time at 65°C was adjusted to 5 minutes. Each 5μL PCR product was mixed with... The 1kb DNA ladder (New England Biolabs, Ipswich, MA) was analyzed by electrophoresis on a 1% agarose gel.

[0222] Tested Figure 1B The compounds shown are examples, but for the sake of brevity, data for 5-bromo-PAPS are primarily provided in the examples.

[0223] result

[0224] Metal-bound dyes binding to various metal ions were screened in a fully buffered (20 mM Tris) reaction. Prior to LAMP, pyridine azo aniline dyes, 5-bromo-PAPS, and 5-nitro-PAPS were screened with Cu. 2+ Zn 2+ Fe 2+ and Ni 2+ When complexed, a bright color is observed, while with Ca... 2+ Cr 2+ and Re 3+ It cannot be observed during complexation. However, except for Mn 2+ Apart from ions, the color observed after LAMP remains essentially unchanged. In LAMP ( Figure 2A-2D ) and PCR amplification of positive samples ( Figures 8A-8C At the end, Mn 2+ This will cause the color of 5-bromo-PAPS and 5-nitro-PAPS to change from red to yellow. The pyridine azo dye 4-(2-pyridine azo)resorcinol (PAR), with a different core structure, also changes color in response to LAMP amplification in the presence of Mn2+, but the color contrast from yellow to orange after amplification is not obvious. Figure 1ETwo other dyes, HNB and EBT, have been used as Mg-based dyes. 2+ Sensing LAMP amplification indicator, by adding Mn 2+ This caused their coloring to be almost completely quenched. Figure 1F and 1G ).

[0225] Pyridine azo aniline dyes and Mn 2+ The complex presents a red color, but during amplification, it is replaced by pyrophosphate (PPi) to form insoluble manganese(II) pyrophosphate, thus restoring the dye's original yellow color. Figure 3C This hypothesis was tested using 5-bromoPAPS. Figure 3A ). In relation to Mn 2+ Adding inorganic pyrophosphatase to the complexed pyridine azo aniline dye can convert PPi produced by DNA polymerization into inorganic monophosphate (Pi), eliminating the red-yellow color change caused by amplification. Figure 3B Furthermore, high concentrations of EDTA immediately cause a red-yellow color change, unrelated to amplification, indicating that EDTA chelates Mn. 2+ Stronger than chelated pyridine azo aniline dyes ( Figure 3B ).

[0226] 5-bromo-PAPS dyes (50-100 μM) and Mn were tested. 2+ The concentration range (50 μM-150 μM) is used to determine whether this ratio is crucial. Figures 4A-4C This indicates that the situation is not as described; the ratios of all tests were valid. Using real-time fluorescence, no significant inhibition of the LAMP reaction caused by PAPS dye or manganese ions was observed at these concentrations. All combinations provided high-contrast visual differences between positive and NTC reactions, and allowed for reliable visual detection of LAMP amplification. For convenience, 75 μM PAPS dye and 100 μM Mn were used in subsequent studies. 2+ .

[0227] In a completed LAMP reaction, the absorbance spectral shift of the PAPS dye is another useful indicator of positive amplification. In a positive reaction, the absorbance at 450 nm increases significantly, while the absorbance near 550 nm decreases significantly. In an objective, automated measurement system, these shifts in the absorbance peak can be used to quantitatively determine a positive reaction. Figures 5A-5D The image shows two methods for quantitatively determining a positive reaction: using the difference in relative absorbance between 450 nm and 550 nm. Figure 5C ) or the ratio between these peaks ( Figure 5DBoth methods provide easily distinguishable positive and negative reaction readings. In addition to endpoint analysis, the absorbance of these two peaks can be measured in real time and used to determine the amplification results, similar to the pH-based colorimetric method used in the high-throughput ColorHealth COVID-19 colorimetric LAMP assay.

[0228] After identifying the factors influencing the color change of pyridine azoaniline dye, a pyridine azoaniline-based detection method was used to determine the sensitivity of detecting synthetic SARS-CoV-2 RNA using RT-LAMP. Twenty-four reactions were performed, each inputting approximately 10 copies of viral RNA, which is below the detection limit of commercially available pH-dependent dye-based kits (approximately 50 copies, SARS-CoV-2 Rapid Colorimetric LAMP Detection Kit (New England Biolabs, Ipswich, MA)). At such low nucleic acid concentrations, positive and negative reactions were detectable visually. Figures 7A-7D This indicates that this is the visual detection limit of the detection method. Of the 24 reactions, 12 showed a color change after 40 minutes of incubation, indicating a positive LAMP reaction. These reactions were also confirmed as positive by real-time fluorescence detection. The other 12 reactions did not show a color change, consistent with the 8 NTC reactions that did not amplify, confirmed by real-time detection. The relative absorption changes at 450 nm and 550 nm were plotted (…). Figure 7C ) or a ratio chart between them ( Figure 7D The positive reaction value always differs greatly from the negative reaction and NTC reaction values, providing a clear identification standard for virus-specific amplification.

[0229] To determine the pyridine azo aniline dye and Mn 2+ To determine whether RT-LAMP detection sensitivity was affected, two sets of SARS-CoV-2 primers were tested, with and without guanidine hydrochloride (GuHCl) (Table 1). Each condition was tested with 24 replicates of approximately 10 copies of SARS-CoV-2 RNA. The number of positive results under different conditions was compared by adding 75 μM MPa APS dye alone or in combination with 100 μM Mn. 2+ It has no effect on detection sensitivity. Furthermore, GuHCl is not only compatible with the reaction conditions, but also slightly improves detection sensitivity.

[0230] Table 1. In 75 μM bromine-PAPS and / or 100 μM Mn 2+ Sensitivity of RT-LAMP in existence

[0231]

[0232] *With 5-bromo-PAPS and Mn++ The results of the reaction were determined based on color changes and were identical to those obtained from real-time monitoring.

[0233] By testing the tolerance carried by various buffer solutions, the pyridine azoaniline colorimetric reporting system demonstrated its superiority over pH-based detection. Figures 6A-6B For example, in a 25 μL LAMP reaction using a PAPS reporter system, 0 μL–7 μL (0–28% v / v) of typical nucleic acid purification column elution buffer (Qiagen EB, 10 mM Tris, pH 8.5) does not interfere with color changes or inhibit the LAMP reaction. However, in pH-based colorimetric assays, even with 3–4 μL of elution buffer, the contrast between positive and negative reactions is much smaller. Similarly, PAPS-based colorimetric assay systems can detect 0–7 μL of VTM, while pH-based systems achieve clear visual contrast with only up to 4 μL of VTM. The tolerance of quantitative measurement systems (such as absorbance) may be even higher than what the naked eye can see. These results demonstrate that PAPS-based assays allow for the use of larger amounts of buffer and thus overcome key limitations associated with pH-based colorimetric LAMP.

[0234] Taking 5-bromo-PAPS dye as an example, pyridine azoaniline dye is a visual reporter for PCR reactions. In 50 μM 5-bromo-PAPS and 50 μM Mn... 2+ In the presence of three commercially available PCR mixed stock solutions ( Figure 8A λDNA fragments ranging from 0.5kb to 5.0kb were amplified using the manufacturer's recommended standard PCR conditions. Before PCR cycling, all reactions were red, as seen in the LAMP mixture. After PCR, reactions containing template DNA changed from red to yellow, while the template-free control reaction remained red. Agarose gel electrophoresis confirmed that the color-changing samples were identical to those successfully amplified using standard PCR. Figure 8B The results showed that PAPS dyes were largely compatible with standard PCR mixtures. The advantage of PAPS-based detection is that it eliminates the need to coat samples with mineral oil.

[0235] The robustness and sensitivity of PAPS-based colorimetric PCR detection were determined by amplifying DNA fragments from E. coli and the human genome for 32-44 cycles. Color changes and the yield of specific product bands were compared by electrophoresis. Figures 8A-8DFor a 1.0 kb E. coli fragment using 1 ng of input genomic DNA template (approximately 200,000 copies), the reaction color turned yellow in fewer than 32 PCR cycles. For a human fragment of the same size using 10 ng of genomic DNA (approximately 2,900 copies), the desired color change was obtained using 40 cycles.

[0236] When the size of the human fragment increased to 2 kb, the number of cycles required for the color change decreased to 32–36. These results indicate that the color change depends on the amount of DNA produced, confirming the product yield observed by gel electrophoresis.

[0237] The relationship between visual color changes and DNA production was quantified using visual inspection and absorbance spectroscopy. Figures 10A-10C , Figure 11A-11C , Figure 12A-12F The colorimetric PCR reaction was performed within a certain number of cycles to amplify low copy number templates (human genomic DNA, approximately 2900 copies) and high copy number templates (λDNA, approximately 1.91 × 10⁻⁶ copies). 7 (Multiple copies), including 0.5kb, 1.0kb, and 2.0kb amplicones. Visual color change of the reaction was examined, and absorbance and DNA yield were measured. Absorbance change (A450–A550) was indeed correlated with DNA yield and could be detected at least 4 cycles before a visible color change appeared. As expected, the high copy number λ amplicon template required fewer PCR cycles to accumulate a similar amount of DNA and cause color change compared to the low copy number human template. DNA yields for all λ and human amplicones were very similar when the color change was perceptible to the naked eye, ranging from 40–65 ng / µl.

[0238] For colony PCR using 5-bromo-PAPS, further examples of workflow improvements achieved through colorimetric PCR can be observed. Figures 9A-9D Colony PCR is typically used to directly identify colonies carrying the correct plasmid DNA combination from a small number of *E. coli* cells. Artificial gel electrophoresis is usually required to confirm the presence and size of the product. Clones transformed into *E. coli* are selected for PCR analysis using PAPS. Following standard practice, plasmids in 5-bromo-PAPS and Mn... 2+ In the presence of purified plasmid DNA, the optimal annealing temperature for each primer pair was determined. Figure 9A Eight *E. coli* colonies were analyzed by PCR—each containing four colonies of two different plasmids. The selected primer pairs were unique in the first four colonies. Figure 9A and 9B It was the only one among the last four colonies. Figure 9C ), or shared by both ( Figure 9D The PCR reaction will only change color and perfectly match the specific band detected by agarose gel electrophoresis when the target plasmid is correct. Using a much simpler workflow that does not require gels, PCR results for detecting positive colonies using PAPS are at least as good as those obtained using standard agarose gel electrophoresis.

Claims

1. A composition comprising an enzyme capable of releasing pyrophosphate from a substrate, manganese ions (Mn 2+ ) and a dye of formula 1 : wherein: R1is halogen or nitro; R5is H or halogen; R2and R3are each independently linear or branched C 1-10 - an alkyl group, optionally comprising a terminal sulfonic acid group; and R4is OH.

2. The composition of claim 1, wherein: at least one of R1and R5is F, CI, Br, or I; R2and R3are each independently n-butyl, sec-butyl, iso-butyl, t-butyl, propyl, n-propyl, iso-propyl, ethyl, or methyl, and at least one of R2and R3comprises a terminal sulfonic acid group.

3. The composition of claim 1, wherein the composition comprises a manganese salt, wherein the molar ratio of the manganese salt to dye is greater than 1.

4. The composition of claim 1, wherein the composition further comprises one or more nucleoside triphosphates (NTPs) selected from rNTPs and dNTPs.

5. The composition of claim 4, wherein the molar ratio of the NTPs to manganese salt is greater than 1.

6. The composition of claim 1, wherein the dye is 2-(5-bromo-2-pyridylazo)-5-(N- propyl-N-sulfopropylamino)phenol (5-Br-PAPS) or 2-(5-nitro-2-pyridylazo)-5-(N- propyl-N-sulfopropylamino)phenol (5-nitro-PAPS).

7. The composition of claim 1, wherein the enzyme is selected from the group consisting of DNA polymerase, RNA polymerase, reverse transcriptase, primase, ligase, helicase, nucleotide pyrophosphatase (Ppase) / phosphodiesterase, RNA de-capping enzyme (RNA 5' pyrophosphate hydrolase), and geranyl pyrophosphate synthase.

8. The composition of claim 1, wherein the enzyme is a polymerase selected from the group consisting of a thermostable DNA polymerase, a strand displacement DNA polymerase, an RNA polymerase, and a reverse transcriptase.

9. The composition of claim 7, wherein the enzyme is a DNA polymerase selected from the group consisting of a Bst polymerase, a Bsu polymerase, an archaeal DNA polymerase, a Taq polymerase, or a variant thereof.

10. The composition of claim 1, wherein the composition is lyophilized or an aqueous solution.

11. The composition of claim 1, further comprising a substrate for the enzyme, wherein cleavage of the substrate by the enzyme results in the production of pyrophosphate.

12. The composition of claim 1, further comprising a nucleic acid sample comprising a nucleic acid of interest and optionally a primer.

13. The composition of claim 12, wherein the sample is a sample from an animal subject.

14. The composition of claim 12, wherein the sample is a clinical sample selected from the group consisting of saliva, nasal mucosa, urine, tissue biopsy, and a cell scrape, or an environmental sample selected from the group consisting of water, sewage, soil, and plant or animal material used as food.

15. A method of detecting pyrophosphate comprising: (a) combining a manganese salt, an enzyme, a substrate for the enzyme, and a dye of Formula 1 to produce a reaction mixture that releases pyrophosphate when the substrate is cleaved by the enzyme; wherein: R1is halogen or nitro; R5is H or halogen; R2and R3are each independently linear or branched C 1-10 - an alkyl group, optionally comprising a terminal sulfonic acid group; and R4is OH; (b) incubating the reaction mixture under conditions in which the enzyme cleaves the substrate to produce pyrophosphate; and (c) detecting the presence of pyrophosphate. (c) observing a change in color of the reaction mixture, wherein the change in color indicates the production of pyrophosphate.

16. The method of claim 15, wherein the enzyme is selected from the group consisting of a DNA polymerase, an RNA polymerase, a reverse transcriptase, a primase, a ligase, a helicase, a nucleotide pyrophosphatase (Ppase) / phosphodiesterase, an RNA de-capping enzyme (RNA 5' pyrophosphohydrolase), and a geranyl pyrophosphate synthase.

17. The method of claim 15, wherein the substrate is an NTP.

18. The method of claim 15, wherein: the reaction mixture comprises a polymerase, rNTPs or dNTPs, a manganese salt, a template nucleic acid, and the dye; the reaction mixture is incubated under conditions suitable for amplification of the nucleic acid; and the change in color indicates that a product has been amplified.

19. The method of claim 18, wherein the reaction mixture comprises an amplification mixture for a loop-mediated isothermal amplification (LAMP), a polymerase chain reaction (PCR), a strand displacement amplification (SDA), a helicase-dependent amplification (HDA), a multiple displacement amplification (MDA), a rolling circle amplification, a ligation-mediated amplification, a whole genome amplification (WGA), a nucleic acid sequence-based amplification (NASBA), or a recombinase polymerase amplification (RPA) mixture.

20. The method of claim 18, wherein the reaction mixture is a PCR reaction mixture, and the method comprises subjecting the reaction mixture to thermal cycling.

21. The method of claim 18, wherein the reaction mixture is a LAMP reaction mixture, and the method comprises incubating the reaction mixture under isothermal conditions.

22. The method of claim 15, wherein the change in color in (c) is from red to yellow, wherein yellow indicates the production of pyrophosphate.

23. The method of claim 15, wherein (c) further comprises detecting the change in color by spectrophotometry, image analysis, or by the naked eye.

24. The method of claim 15, wherein (c) further comprises detecting the change in color by a change in hue or a change in peak wavelength.

25. The method of claim 15, wherein the change in color is detected by observing a change in wavelength peak height ratio before and after step (b).

26. The method of claim 25, wherein the wavelength peak height is in the range of 350 nm-620 nm, 430 nm-480 nm, and / or 520 nm-620 nm.

27. The method of claim 18, further comprising determining the amount of nucleic acid substrate or the amount of amplicon by determining the number of thermal cycles in a PCR amplification reaction that produces a predetermined wavelength peak height ratio.

28. The method of claim 15, wherein the dye is 2-(5-bromo-2-pyridylazo)-5-(N- propyl-N-sulfopropylamino)phenol (5-Br-PAPS) or 2-(5-nitro-2-pyridylazo)-5-(N- propyl-N-sulfopropylamino)phenol (5-nitro-PAPS). ​ ​ ​ 29. A kit comprising a polymerase, a manganese salt, and a dye of Formula 1 : ###0007### Formula 1 wherein: R1 is halo or nitro; R2 is H or halo; R3 is H or halo; R4 is OH; R5 is H or halo; and R6 is H or halo.

29. A kit comprising a polymerase, a manganese salt, and a dye of Formula 1 : ###0007### Formula 1 wherein: R1 ​ ​ R2and R3are each independently linear or branched C 1-10 - an alkyl group, optionally comprising a terminal sulfonic acid group; and ​

Images