Application of qULG2b gene in improving grain length trait of rice
Through CRISPR/Cas9 gene editing technology, the problem of improving grain length of japonica rice was solved, and the significant increase in grain length and yield improvement of rice was achieved.
Patent Information
- Application Number
- CN202410698541.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-31
- Publication Date
- 2025-08-05
- Estimated Expiration
- 2044-05-31
AI Technical Summary
The digging of japonica rice grain length genes is weak, which limits the improvement of japonica rice grain length. It is difficult for the existing technology to effectively increase the length of rice grains, which in turn affects yield.
The qULG2b gene was knocked out by CRISPR/Cas9 gene editing technology, and the nucleotide sequence and amino acid sequence of the qULG2b gene were used to construct recombinant expression vectors and transfect rice lines to improve the grain length traits.
Significantly increase the length of rice grains, increase the weight of 1,000 grains, and thus increase the yield of rice, providing a new improved way for japonica rice breeding.
Smart Images

Figure CN118440982B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of plant genetic engineering, and particularly relates to the application of the qULG2b gene in improving the rice grain length trait. Background Art
[0002] Rice grain shape is closely related to yield and quality traits and has become an important target trait for molecular breeding of high-yield and high-quality rice. The key to genetic improvement of grain shape lies in the discovery, innovation, and utilization of relevant variants. To date, significant progress has been made in the genetic basis of rice grain shape and the mapping and function of grain shape genes. A growing number of complex quantitative trait loci (QTLs) and cloned genes associated with grain shape have been reported, but most of these QTLs and genes are derived from mutant materials, significantly limiting their direct application in breeding. With the continued advancement of relevant research, it is currently difficult to discover new genes for important agronomic traits through natural variation. In addition, most induced mutants represent novel functions or alleles of known genes. Furthermore, the molecular basis of rice grain morphology and its genetic regulatory network remain unclear. While northern japonica rice is currently undergoing breeding for longer grains, the discovery of grain length genes in japonica rice is relatively limited, hindering the improvement of grain length in japonica rice. Therefore, it is necessary to discover more grain shape genes, enrich the grain shape regulatory network, and apply this knowledge to grain shape breeding in Northeast China. Summary of the Invention
[0003] In order to solve the problem that the existing technology of discovering japonica rice grain length genes is relatively weak, which limits the improvement of japonica rice grain length, and to achieve the above-mentioned purpose, the present invention adopts the following technical solutions:
[0004] The present invention provides an application of the qULG2b gene in improving rice grain length traits. The nucleotide sequence of the qULG2b gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by the qULG2b gene is shown in SEQ ID NO.2.
[0005] The qULG2b gene was discovered by the inventors while studying a rare rice germplasm resource with a thousand-grain weight of more than 60g. It is an important gene that can increase grain length, thereby increasing thousand-grain weight and ultimately improving yield. It has broad application prospects in rice breeding.
[0006] Specifically, the present invention utilizes genetic engineering to knock out the qULG2b gene or reduce its expression, thereby obtaining rice mutants with improved grain length. Increased grain length significantly increases rice 1000-grain weight. 1000-grain weight is an important yield factor, and increasing 1000-grain weight significantly increases rice yield.
[0007] The present invention also provides a method for improving the rice grain length trait, using CRISPR / Cas9 gene editing technology to edit the target site of the rice qULG2b gene;
[0008] The nucleotide sequence of the qULG2b gene is shown in SEQ ID NO.1, the amino acid sequence is shown in SEQ ID NO.2, and the sequence of the target site is shown in SEQ ID NO.3.
[0009] The method for improving rice grain length provided by the present invention specifically comprises: linking the target site of the qULG2b gene into a transgenic vector to construct a recombinant expression vector; and transfecting the recombinant expression vector into the plant material to be transformed, thereby obtaining gene-edited site-directed knockout rice plants with improved grain length. The plants exhibit significantly increased grain length, 1000-grain weight, and yield per plant.
[0010] The transgenic vector is pRGEB32, which has mature technology and high genetic transformation efficiency.
[0011] The present invention also provides a method for cultivating rice with improved grain length traits, comprising the following steps:
[0012] Obtaining a target site sequence at the first exon of the qULG2b gene, and synthesizing an sgRNA primer for the target site sequence;
[0013] constructing an expression vector containing the qULG2b gene using the sgRNA primer;
[0014] Transforming the expression vector containing the qULG2b gene into Agrobacterium to obtain recombinant Agrobacterium;
[0015] The recombinant Agrobacterium is transfected into a rice line to be transformed, and rice plants with improved grain length traits are obtained through selection, differentiation, rooting, seedling hardening and transplanting.
[0016] Wherein, the sgRNA primer sequence is shown as SEQ ID NO.3.
[0017] The method for constructing an expression vector containing the qULG2b gene comprises the following steps:
[0018] The sgRNA primer is melted to double-strand, and a double-stranded sgRNA sequence fragment is obtained;
[0019] The double-stranded sgRNA sequence fragment and the pRGEB32 vector digested with BsaI were mixed in a molar ratio of 5 to 3:1, and reacted with T4 DNA ligase to construct the expression vector containing the qULG2b gene.
[0020] After the recombinant Agrobacterium is transfected into the rice line to be transformed, rice regenerated seedlings are obtained by tissue culture, qULG2b gene fragments containing the target site are obtained by PCR amplification, and rice plants with qULG2b gene mutations are obtained by sequencing to confirm.
[0021] The primers used in the PCR amplification include a forward primer and a reverse primer, and their specific sequences are as follows:
[0022] The nucleotide sequence of the forward primer is shown in SEQ ID NO. 4: TCATTTCTATGGCAATTTCCCGA;
[0023] The nucleotide sequence of the reverse primer is shown in SEQ ID NO. 5: CAAGGCATTTGCTGGTGACA.
[0024] The above primers were designed through the Primer3Plus website (https: / / www.primer3plus.com / index.htmL) and are unique.
[0025] Compared with the prior art, the present invention has the following beneficial effects:
[0026] The present invention provides the use of the qULG2b gene for improving rice grain length. Using CRISPR / Cas9 gene editing technology, the qULG2b gene was specifically knocked out, completely abolishing its function. This resulted in the construction of a rice strain with a specific knockout of the qULG2b gene. Studies have shown that knocking out the qULG2b gene significantly increases grain length and, consequently, rice yield. This result provides a new, simple, and effective method for cultivating rice with superior traits, which can be widely adopted.
[0027] The present invention uses CRISPR / Cas9 gene editing technology to specifically knock out the qULG2b gene, completely disabling its function and producing a rice germplasm with increased grain length. The nucleotide sequence of the qULG2b gene is shown in the sequence listing as SEQ ID NO. 1, and the amino acid sequence encoded by it is shown in the sequence listing as SEQ ID NO. 2. The high-yield germplasm produced by the present invention has increased grain length and can be used in rice breeding to significantly increase rice yield, thus showing great potential for application. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 Comparison of target site sequences of the wild type and qULG2b gene knockout mutants in the present invention, wherein A is the gene structure and gene editing microarray of qULG-2b; B is the mutant sequence of the qULG-2b gene-edited plant;
[0029] Figure 2 This is a comparison picture of the grain length between the wild type and the qULG2b gene knockout mutant in the present invention;
[0030] Figure 3 Comparative data of grain length between the wild type and qULG2b gene knockout mutant in the present invention;
[0031] Figure 4 Comparison data of 1000-grain weight between the wild type and qULG2b gene knockout mutant in the present invention;
[0032] Figure 5 The data are comparative data of single plant yield between the wild type and the qULG2b gene knockout mutant in the present invention. DETAILED DESCRIPTION
[0033] The present invention will be described in detail below with reference to the accompanying drawings and specific examples, but they should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.
[0034] Example 1
[0035] 1. Construction of Rice Overexpressing the qULG2b Gene
[0036] 1. Retrieve gene sequence: The complete CDS nucleotide sequence of rice qULG2b was retrieved from the rice genome annotation database TIGR as shown in SEQ ID NO.1:
[0037]
[0038] Its amino acid sequence is shown in SEQ ID NO.2;
[0039]
[0040] The gRNA primer sequence for the qULG2b gene was designed using the website http: / / www.genome.arizona.edu / crispr as shown in SEQ ID NO. 3: GCCTACTGAGATCGCTAGTATGG, and was artificially synthesized by Shenzhen BGI Genomics Co., Ltd.
[0041] 2. Double-stranding of sgRNA primer sequence fragments: The synthesized sgRNA primer sequence fragments of the target gene were mixed at a molar concentration ratio of 1:1, and melted at 95°C for 10 minutes. During the natural cooling process, the sgRNA forward and reverse primer sequences were double-stranded to obtain double-stranded sgRNA sequence fragments.
[0042] 3. Construction of a Gene Editing Vector: The gene editing vector used was pRGEB32. The vector was digested with BsaI and recovered. The recovered vector fragment and the double-stranded sgRNA sequence fragment obtained above were mixed at a molar ratio of 1:5 and ligated with T4 DNA ligase in a biochemical incubator at 16°C for 3 hours. The ligation product was transformed into competent Escherichia coli (DH5α). The transformed E. coli plasmid was extracted and sequenced. The vector containing the target gene sgRNA sequence after sequencing was considered the correct gene editing vector.
[0043] 4. Transformation of gene editing vector into Agrobacterium: The correctly constructed gene editing vector was transformed into Agrobacterium (EHA105) competent cells, the transformed Agrobacterium plasmid was extracted, and it was transformed into Escherichia coli (DH5α) competent cells again. The E. coli plasmid was extracted and sequenced to confirm that the constructed gene editing vector was correctly transformed into Agrobacterium.
[0044] 5. Tissue culture
[0045] 1) Callus Induction: Plump, mature, mold-free rice ZH11 seeds were shelled and rinsed three times with sterile water. The seeds were then treated with 70% ethanol (volume fraction) for 1 min, rinsed three times with sterile water for 30 s each, disinfected with 0.1% mercuric chloride solution for 12 min, and rinsed seven times with sterile water for 30 s each. The seeds were placed on sterile filter paper to absorb moisture and then clipped onto induction medium with sterile tweezers. The seeds were cultured in the dark at 28°C for at least 4 weeks to obtain callus.
[0046] The formula of the induction medium is shown in Table 1.
[0047] Table 1 Formula composition of induction medium
[0048]
[0049] 2) Callus subculture: Select bright, firm and dry embryonic callus and culture it on subculture medium in the dark at 28°C for 10 days.
[0050] The formula of the subculture medium is shown in Table 2.
[0051] Table 2 Composition of the secondary culture medium
[0052] N6 macroelements: 50mL B5 trace: 10mL Iron salts: 10mL niacin: 1mL Pyridoxine hydrochloride: 1mL Thiamine hydrochloride: 1mL Inositol: 10mL L-Glu: 0.5g L-pro: 0.5g(2.8g) CH: 0.3g 6-B(2,4-D) 0.5mL (2mL) NAA 0.5mL sucrose 30g Agar 8g pH value: 5.8
[0053] 3) Agrobacterium Infection: Place the constructed Agrobacterium transformed with the gene editing vector into a liquid co-culture medium, vigorously break it up, and shake it on a shaker for 1 hour until the OD600 of the culture solution reaches 0.9. Select bright, firm, and dry embryogenic callus, mix it with the Agrobacterium suspension, and soak it for 30 minutes. Transfer the callus to sterilized filter paper and air-dry it on a clean bench. Place the callus on a layer of filter paper-lined co-culture medium and culture it at 28°C for 3 days.
[0054] The formula of the co-culture medium is shown in Table 3.
[0055] Table 3 Co-culture medium formula composition
[0056]
[0057] 4) Selection Culture: The co-cultured callus was transferred to a sterilized Erlenmeyer flask and thoroughly washed with sterile distilled water. The callus was then immersed in sterile water containing 400 mg / L carbenicillin for 30 minutes with shaking. The callus was then transferred to sterilized filter paper to absorb the moisture and air-dried in a clean bench. The callus was then transferred to a selective medium containing 50 mg / L hygromycin and cultured twice for 2 weeks each, with the first carbenicillin selection concentration being 400 mg / L and the second at 250 mg / L to obtain resistant callus.
[0058] Among them, the formula of the selection culture medium is shown in Table 4.
[0059] Table 4 Select the formula composition of the culture medium
[0060]
[0061] The first carbenicillin screening concentration was 400 mg / L, and the second was 250 mg / L.
[0062] 5) Differentiation culture: The resistant callus was transferred to differentiation medium and cultured under light at 28°C for 50 days until transgenic seedlings were obtained.
[0063] The formula of the differentiation medium is shown in Table 5.
[0064] Table 5: Formulation of differentiation medium
[0065]
[0066] 6) Rooting culture: Cut off the roots produced during differentiation, and then transfer the transgenic seedlings to rooting medium and culture them in the light for more than 2 weeks at a temperature of 28°C to obtain transgenic seedlings with a height of 10 cm.
[0067] 7) When the transgenic seedlings are about 10 cm tall and have a well-developed root system, open the bottle cap and inject sterile water into the bottle. After hardening the seedlings for 2 days, wash off the residual culture medium on the roots and transplant them to obtain strong transgenic rice seedlings.
[0068] It should be noted that in the first few days after transplanting, cover with plastic wrap, avoid strong light exposure, and keep moisture.
[0069] 2. Identification of qULG2b gene-edited site-directed knockout rice transgenic lines
[0070] To identify the mutation sequences in the gene-edited plants, DNA extraction and sequencing were performed on the transgenic rice seedlings obtained above. The specific research is as follows:
[0071] 1. Identification of positive transgenic lines
[0072] A total of 52 rice regeneration seedlings were obtained, all of which were transplanted to a test field. Leaf DNA of each rice regeneration seedling was taken for hygromycin-labeled PCR identification, and a total of 37 independent transgenic positive strains were obtained.
[0073] Among them, the DNA extraction method is the TPS method, and the specific method is as follows:
[0074] a. Prepare a 70℃ water bath;
[0075] b. Grind the leaves in a grinder (2 mL tube);
[0076] c. Add 500 μL TPS buffer;
[0077] d. 70℃ water bath for 30 minutes;
[0078] e. Centrifuge at 2900 rpm for 30 minutes;
[0079] f. Transfer the supernatant to a new 1.5 mL tube;
[0080] g. Add an equal volume of isopropyl alcohol;
[0081] h. Let stand for 10 minutes;
[0082] 1. Centrifuge at 2900 rpm for 20 minutes;
[0083] m. Add 50 μL of 70% ethanol;
[0084] n. Centrifuge at 2900 rpm for 5 minutes;
[0085] p. Repeat 10&11;
[0086] q. Discard the liquid and dry in the dark for 1 hour;
[0087] r. Add RNase-free water and incubate at 65°C for 30 minutes or at 37°C overnight.
[0088] The formula of TPS extract is:
[0089]
[0090]
[0091] Among them, the PCR reaction amplification system is:
[0092] Template DNA 1 μL; 2× Taq buffer 10 μL; dNTP 0.5 μL; forward primer 0.5 μL; reverse primer 0.5 μL; Taq enzyme 0.5 μL; ddH2O 7 μL.
[0093] The nucleotide sequence of the forward primer is shown in SEQ ID NO. 4: TCATTTCTATGGCAATTTCCCGA;
[0094] The nucleotide sequence of the reverse primer is shown in SEQ ID NO. 5: CAAGGCATTTGCTGGTGACA.
[0095] The PCR reaction amplification program is:
[0096] Pre-denaturation at 94°C for 5 min; 31 cycles of denaturation at 94°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 1 min; and extension at 72°C for 5 min.
[0097] 2. Identification of qULG2b gene knockout strains
[0098] The 37 independent transgenic positive lines were used as materials, and DNA was extracted from flag leaves at the heading stage. PCR amplification was performed using the specific detection primers for the qULG2b gene target site: TCATTTCTATGGCAATTTCCCGA; and the reverse primer: CAAGGCATTTGCTGGTGACA. The amplified fragments were run on agarose gels, cut, recovered, and sequenced. The results showed that the transgenic line qULG2b had a deletion of one base in the first exon of the qULG2b gene compared to the wild type, resulting in a gene mutation. Figure 1 shown.
[0099] At the maturity stage, 20 strains of wild-type and qULG2b knockout lines were selected for grain length investigation.
[0100] The results showed that the grain length of the qULG2b gene knockout lines was significantly increased. Because the increased grain length increases the 1000-grain weight, and thus the yield, this result provides a new, simple and effective method for breeding high-yield rice.
[0101] From the above results, it can be seen that using CRISPR / Cas9 gene editing technology to knock out qULG2b and construct a transgenic strain of qULG2b can significantly increase rice grain length.
[0102] Therefore, the present invention provides the application of the qULG2b gene in improving the rice grain length trait. Using CRISPR / Cas9 gene editing technology to knock out qULG2b can significantly increase rice grain length. Rice grain length is an important agronomic trait that not only directly affects the rice thousand-grain weight, one of the three major factors in yield, but is also closely related to the appearance quality of rice grains. The present invention significantly increases rice grain length by using CRISPR / Cas9 gene editing technology to knock out qULG2b. This not only increases rice yield by increasing the thousand-grain weight, but also improves the appearance quality of rice, and has broad breeding application prospects.
[0103] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes preferred embodiments.
[0104] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.
[0105] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.
Claims
1. A method for improving rice grain length trait, characterized in that: Using CRISPR / Cas9 gene editing technology to edit rice QURG2 target site of the gene; described QURG2 The nucleotide sequence of the gene is shown in SEQ ID NO.1, the amino acid sequence is shown in SEQ ID NO.2, and the sequence of the target site is shown in SEQ ID NO.3; The sgRNA primer sequence is shown in SEQ ID NO.
3.
2. The method according to claim 1, characterized in that The QURG2 The target site of the gene is connected to a transgenic vector to construct a recombinant expression vector; the recombinant expression vector is transfected into the plant material to be transformed to obtain a gene-edited site-directed knockout rice plant with improved grain length traits.
3. The method according to claim 2, characterized in that The transgenic vector includes pRGEB32.
4. A method for cultivating rice with improved grain length trait, characterized in that: The following steps are involved: In claim 1 QURG2 A target site sequence is obtained at the first exon of the gene, and an sgRNA primer is synthesized for the target site sequence; The sgRNA primers were used to construct QURG2 Gene expression vector; The said QURG2 The gene expression vector is transferred into Agrobacterium to obtain recombinant Agrobacterium; Transfecting the recombinant Agrobacterium into a rice line to be transformed, and obtaining rice plants with improved grain length traits through selection, differentiation, rooting, seedling hardening, and transplanting; described QURG2 The nucleotide sequence of the gene is shown in SEQ ID NO.1, the amino acid sequence is shown in SEQ ID NO.2, and the sequence of the target site is shown in SEQ ID NO.3; The sgRNA primer sequence is shown in SEQ ID NO.
3.
5. The cultivation method according to claim 4, characterized in that contain QURG2 The method for constructing a gene expression vector comprises the following steps: The sgRNA primer is melted to double-strand, and a double-stranded sgRNA sequence fragment is obtained; The double-stranded sgRNA sequence fragment was mixed with the pRGEB32 vector digested with BsaI at a molar ratio of 5 to 3:1, and reacted with T4 DNA ligase to construct the vector containing QURG2 Gene expression vector.
6. The cultivation method according to claim 4, characterized in that After the recombinant Agrobacterium is transfected into the rice line to be transformed, rice regeneration seedlings are obtained by tissue culture, and the target site is obtained by PCR amplification. QURG2 Gene fragments, sequenced and confirmed QURG2 Rice plants with genetic mutations.
7. The cultivation method according to claim 6, characterized in that The primers used in the PCR amplification include a forward primer and a reverse primer; The nucleotide sequence of the forward primer is shown in SEQ ID NO.4, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.5.