Application of a Pto-RAD50 gene haplotype in evaluating plant photosynthetic efficiency

Abstract

The present invention provides an application of a Pto-RAD50 gene haplotype in evaluating plant photosynthetic efficiency, belonging to the field of plant molecular breeding technology. The nucleotide sequence of the Pto-RAD50 gene of the present invention is shown in SEQ ID NO: 1; the Pto-RAD50 gene haplotype is determined according to the nucleotides of SNP1, SNP2 and InDel, the SNP1 is the nucleotide at the 172nd position of SEQ ID NO: 1, and the nucleotide is C or A; the SNP2 is the nucleotide at the 442nd position of SEQ ID NO: 1, and the nucleotide is A or G; the InDel is the nucleotide after the 422nd position of SEQ ID NO: 1 is ATTATTTTAATA or lacks ATTATTTTAATA. By measuring the genotype combination of the above three sites, the photosynthetic efficiency of poplar can be accurately judged, and the superior plants with high photosynthetic efficiency can be accurately and efficiently screened in the early growth stage of poplar, effectively shortening the breeding cycle.

Description

Technical Field

[0001] The invention belongs to the technical field of plant molecular breeding, and in particular relates to an application of a Pto-RAD50 gene haplotype in evaluating plant photosynthetic efficiency. Background Art

[0002] Populus tomentosa is a dominant native species, a backbone tree species for renewable biological resources and forest carbon sinks, and one of the main sources of wood and pulp raw materials, with important economic and ecological value. Photosynthetic efficiency directly affects carbon flow input, which in turn affects wood accumulation, and is one of the most important physiological processes that determine forest productivity. Therefore, improving photosynthetic efficiency is an important goal for improving forest productivity.

[0003] Photosynthetic efficiency is a complex quantitative trait controlled by multiple genes. In the process of selecting and breeding excellent poplar varieties, photosynthetic indicators that are significantly related to photosynthetic efficiency, such as net photosynthetic rate, transpiration rate, intercellular carbon dioxide concentration, electron transfer rate, etc., are the main reference factors for evaluating photosynthetic efficiency indicators. At present, the selection of individuals with high photosynthetic efficiency is mainly through phenotypic measurement, but the photosynthetic efficiency is affected by a variety of environmental factors during the growth and development of poplars. Therefore, the method of observing phenotypes alone has low accuracy and limitations. With the continuous development of modern molecular breeding technology, the development of key molecular markers that can affect photosynthetic efficiency and the determination of the genetic effects of key molecular marker combinations on the photosynthetic efficiency of trees can achieve rapid and accurate screening of new forest germplasm with strong photosynthetic capacity, which has important application value for the evaluation of photosynthetic efficiency in the seedling stage of trees. Summary of the invention

[0004] In view of this, the object of the present invention is to provide an application of a Pto-RAD50 gene haplotype in evaluating plant photosynthetic efficiency, which can quickly screen plants with high photosynthetic efficiency.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] A use of a Pto-RAD50 gene haplotype in evaluating plant photosynthetic efficiency, wherein the nucleotide sequence of the Pto-RAD50 gene is shown in SEQ ID NO: 1; the Pto-RAD50 gene haplotype is determined according to the nucleotides of SNP1, SNP2 and InDel, wherein the SNP1 is the nucleotide at position 172 of SEQ ID NO: 1, and the nucleotide is C or A; the SNP2 is the nucleotide at position 442 of SEQ ID NO: 1, and the nucleotide is A or G; and the InDel is the nucleotide after position 422 of SEQ ID NO: 1, which is ATTATTTTAATA or lacks ATTATTTTAATA.

[0007] Preferably, the nucleotide of the SNP1 is C, the nucleotide of the SNP2 is A, and when the nucleotide of the InDel lacks ATTATTTTAATA, the photosynthetic efficiency of the plant is low.

[0008] Preferably, when the nucleotide of the SNP1 is A, the nucleotide of the SNP2 is G, and the nucleotide of the InDel is ATTATTTTAATA, the photosynthetic efficiency of the plant is high.

[0009] Preferably, the plant is poplar.

[0010] Another object of the present invention is to provide a primer set for detecting plant photosynthetic efficiency, characterized in that it includes a primer set for detecting the SNP1 genotype: the nucleotide sequences are shown in SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 respectively;

[0011] Primer set for detecting SNP2 genotype: nucleotide sequences are shown in SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, respectively;

[0012] Primer set for detecting InDel genotype: nucleotide sequences are shown as SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10, respectively.

[0013] Another object of the present invention is to provide a kit for detecting photosynthetic efficiency of poplar, comprising the above primer set.

[0014] Another object of the present invention is to provide the application of the application or the primer set or the kit in poplar breeding.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] The present invention provides an application of Pto-RAD50 gene haplotype in evaluating plant photosynthetic efficiency. Based on the strategy of whole genome association analysis, relying on the germplasm resource population of Populus tomentosa, and using the mixed linear model in EMMAX software, SNP sites significantly correlated with the net photosynthetic rate of Populus tomentosa were detected at the whole genome level. SNP1 (P=9.02×10 -8 ) and SNP2 (P = 7.31 × 10 -9) were significantly associated with the net photosynthetic rate. Gene annotation showed that the two SNP sites were located in the promoter region of the Pto-RAD50 gene. Using the SNP and InDel variation information within the Pto-RAD50 gene, candidate gene-based association analysis found that in addition to the two SNPs significantly associated with the net photosynthetic rate, an InDel located in the promoter region of Pto-RAD50 was also significantly associated with the net photosynthetic rate (P = 7.25 × 10 -8 ), and this InDel showed a high degree of linkage relationship with SNP1 and SNP2 (R 2 >0.8), forming a stable haplotype module. Among them, SNP1 is located at the 172nd position in the promoter region of the Pto-RAD50 gene, and there are three genotypes of CC, CA and AA in the Populus tomentosa germplasm resource population. SNP2 is located at the 442nd position in the promoter region of the Pto-RAD50 gene, and there are only two homozygous genotypes of AA and GG in the Populus tomentosa germplasm resource population. InDel is located after the 422nd base in the promoter region of the Pto-RAD50 gene, and there are only two genotypes of DD (homozygous deletion type) and II (homozygous insertion type) in the Populus tomentosa germplasm resource population. By measuring the genotype combination of the above three sites, the photosynthetic efficiency of poplar can be accurately judged, and the superior plants with high photosynthetic efficiency can be accurately and efficiently screened in the early growth stage of poplar, effectively shortening the breeding cycle. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 :LD linkage map of the haplotype block of the Pto-RAD50 gene, including two SNPs and one InDel;

[0018] Figure 2 : Genotypic effect diagram of different genotype combinations in the Pto-RAD50 gene haplotype module on the photosynthetic efficiency of Populus tomentosa. DETAILED DESCRIPTION

[0019] The present invention provides an application of a Pto-RAD50 gene haplotype in evaluating plant photosynthetic efficiency, wherein the nucleotide sequence of the Pto-RAD50 gene is shown in SEQ ID NO: 1; the Pto-RAD50 gene haplotype is determined according to the nucleotides of SNP1, SNP2 and InDel, wherein the SNP1 is the nucleotide at position 172 of SEQ ID NO: 1, and the nucleotide is C or A; the SNP2 is the nucleotide at position 442 of SEQ ID NO: 1, and the nucleotide is A or G; and the InDel is the nucleotide after position 422 of SEQ ID NO: 1, which is ATTATTTTAATA (i.e., insertion type Insertion, I) or deletion ATTATTTTAATA (i.e., deletion type Deletion, D).

[0020] In the present invention, the nucleotide sequence shown in SEQ ID NO: 1 is as follows:

[0021] attttaatgaaatcacttcgagtcaatttattttctataaaaaaattgactactctagtcctagtttcttaacactgctgtttagtcccaaaaattttctactgaaaatggggggcttgcatattctgtggtggatgtttttttaaaatttcccaacaaataaaaaagggt C atttctgtccccactttggcaccaaacctcgcaagattcactgtttaaaggaaagaggacaaacattgtctggaaggtatcggatatgtctgtcccccacacaccaccccatgcccaaaaactgcatttggacagctcagagtaccattaaccatcaagggaaattaaccctaacatgatttttttttagcttaaaattggtttgtttttgtgttgaaaatattattttaaatttatttaattattttaa ATTATTTTAATA tatgcaatattaaaaataa A

[0022] Among them, the underlined uppercase base C is the site before SNP1 mutation, the underlined uppercase base A is the site before SNP2 mutation, and the underlined uppercase base sequence ATTATTTTAATA is the insertion sequence.

[0023] In the present invention, when the nucleotide of SNP1 is C (i.e., the genotype is CC), the nucleotide of SNP2 is A (i.e., the genotype is AA), and the nucleotide of InDel is missing ATTATTTTAATA (i.e., the genotype is DD), that is, when the genotype combination is CC-AA-DD, the plant photosynthetic efficiency is low.

[0024] In the present invention, when the nucleotide of SNP1 is A (ie, the genotype is AA), the nucleotide of SNP2 is G (ie, the genotype is GG), and the nucleotide of InDel is ATTATTTTAATA (ie, the genotype is II), that is, when the genotype combination is AA-GG-II, the plant photosynthetic efficiency is high.

[0025] In the present invention, the plant is poplar, preferably Populus tomentosa.

[0026] The two SNPs at the 172nd and 442nd bases of the Pto-RAD50 gene described in the present invention are based on a strategy of genome-wide association analysis, relying on the Populus tomentosa germplasm resource population, and using a mixed linear model in the EMMAX software to detect SNP sites significantly associated with the net photosynthetic rate of Populus tomentosa at the genome-wide level. The InDel is based on all SNP and InDel variations of the PtoRAD50 gene, and a candidate gene association strategy is used to detect an InDel significantly associated with the net photosynthetic rate. The InDel also shows a high degree of linkage relationship (R) with SNP1 and SNP2. 2 >0.8), forming a stable haplotype module. The association significance of the SNP and InDel described in the present invention with the net photosynthetic rate was P < 1×10 -7 .

[0027] Among them, SNP1 is located at the 172nd position in the promoter region of the Pto-RAD50 gene, and there are three genotypes of CC, CA and AA in the Populus tomentosa germplasm resource population. SNP2 is located at the 442nd position in the promoter region of the Pto-RAD50 gene, and there are only two homozygous genotypes of AA and GG in the Populus tomentosa germplasm resource population. InDel is located after the 422nd base in the promoter region of the Pto-RAD50 gene, and there are only two genotypes of DD (homozygous deletion type) and II (homozygous insertion type) in the Populus tomentosa germplasm resource population. By measuring the genotype combination of the above three sites, the photosynthetic efficiency of poplars can be accurately judged, and high-photosynthetic efficiency superior plants can be accurately and efficiently selected in the early growth stage of poplars, effectively shortening the breeding cycle.

[0028] After determining the genotype combination of the above-mentioned SNP and InDel sites, the present invention judges the photosynthetic efficiency of the poplar according to the genotype combination of the above-mentioned sites: when the genotype of SNP1 is CC, the genotype of SNP2 is AA, and the genotype of InDel is DD, that is, when the genotype combination of the haplotype is CC-AA-DD, the photosynthetic efficiency of the poplar sample leaves is the lowest; when the genotype of SNP1 is AA, the genotype of SNP2 is GG, and the genotype of InDel is II, that is, when the genotype combination of the haplotype is AA-GG-II, the photosynthetic efficiency of the poplar sample leaves is the highest.

[0029] The present invention has no special requirements for the extraction method of the genomic DNA of the test sample, and the conventional plant genome extraction method in the art can be used. The present invention has no special restrictions on the determination method of the InDel genotype after the 172nd base, the 442nd base, and the 422nd base upstream of the Pto-RAD50 gene, and the SNP and InDel genotype detection method familiar to those skilled in the art can be used. As an practicable method, the present invention is implemented by a PCR amplification method.

[0030] The present invention also provides a primer set for detecting plant photosynthetic efficiency, characterized in that it includes a primer set for detecting the SNP1 genotype: Pto-RAD50-172-CF, the nucleotide sequence of which is shown in SEQ ID NO: 2, Pto-RAD50-172-AF, the nucleotide sequence of which is shown in SEQ ID NO: 3, and Pto-RAD50-172-R, the nucleotide sequence of which is shown in SEQ ID NO: 4;

[0031] Primer set for detecting SNP2 genotype: Pto-RAD50-442-AF, nucleotide sequence as shown in SEQ ID NO: 5, Pto-RAD50-442-GF, nucleotide sequence as shown in SEQ ID NO: 6, Pto-RAD50-442-R, nucleotide sequence as shown in SEQ ID NO: 7;

[0032] Primer sets for detecting InDel genotypes: Pto-RAD50-422-DF, the nucleotide sequence is shown in SEQ ID NO: 8, Pto-RAD50-422-IF, the nucleotide sequence is shown in SEQ ID NO: 9, and Pto-RAD50-422-R, the nucleotide sequence is shown in SEQ ID NO: 10.

[0033] The present invention designs primers for the sites SNP1, SNP2 and InDel to be tested and performs PCR amplification, detects whether the amplified product exists to judge the genotype of the sites to be tested, and then evaluates the photosynthetic efficiency of poplar. The primer design requirement for the two SNP sites is that the last base of the 3' end of the forward primer is the corresponding functional site, and the primer design requirement for the InDel is that the end of the forward primer contains the insertion or does not contain the insertion. In order to ensure the specificity of the amplified product, the last base of the forward primer is modified with locked nucleic acid (LNA). The genotypes of the two SNP and InDel sites significantly related to the photosynthetic efficiency trait of poplar can be accurately and quickly determined by the above-mentioned primer set, and then the photosynthetic efficiency of poplar can be judged by the determined genotype combination, so as to accurately and efficiently screen the superior plants of Populus tomentosa with high photosynthetic efficiency in the early growth stage of poplar, and effectively shorten the breeding cycle.

[0034] The present invention utilizes PCR amplification method to identify the genotype of the plant, and the method for detecting the amplification product is agarose gel electrophoresis or amplicon sequencing, preferably agarose gel electrophoresis. In the present invention, the amplified product size of Pto-RAD50-172-CF and Pto-RAD50-172-R is 91bp, the amplified product size of Pto-RAD50-172-AF and Pto-RAD50-172-R is 91bp, the amplified product size of Pto-RAD50-442-AF and Pto-RAD50-442-R is 81bp, the amplified product size of Pto-RAD50-442-GF and Pto-RAD50-442-R is 81bp, the amplified product size of Pto-RAD50-422-DF and Pto-RAD50-422-R is 92bp, and the amplified product size of Pto-RAD50-422-IF and Pto-RAD50-422-R is 104bp. If there is no target band in the agarose gel electrophoresis result, it indicates that the corresponding amplified product is not obtained.

[0035] According to the amplification results, the genotype of the test sample can be determined. If Pto-RAD50-172-CF and Pto-RAD50-172-R obtain amplification products when PCR amplification is performed, and Pto-RAD50-172-AF and Pto-RAD50-172-R do not obtain amplification products when PCR amplification is performed, the genotype of the sample SNP1 is CC;

[0036] If Pto-RAD50-172-CF and Pto-RAD50-172-R obtain amplification products when PCR amplification is performed, and Pto-RAD50-172-AF and Pto-RAD50-172-R also obtain amplification products when PCR amplification is performed, then the genotype of SNP1 of the sample is CA;

[0037] If no amplification product is obtained when Pto-RAD50-172-CF and Pto-RAD50-172-R are subjected to PCR amplification, and an amplification product is obtained when Pto-RAD50-172-AF and Pto-RAD50-172-R are subjected to PCR amplification, the genotype of SNP1 of the sample is AA;

[0038] If Pto-RAD50-442-AF and Pto-RAD50-442-R obtain amplification products when PCR amplification is performed, and Pto-RAD50-442-GF and Pto-RAD50-442-R do not obtain amplification products when PCR amplification is performed, the genotype of SNP2 of the sample is AA;

[0039] If no amplification product is obtained when Pto-RAD50-442-AF and Pto-RAD50-442-R are subjected to PCR amplification, and an amplification product is obtained when Pto-RAD50-442-GF and Pto-RAD50-442-R are subjected to PCR amplification, the genotype of SNP2 of the sample is GG;

[0040] If amplification products are obtained when Pto-RAD50-422-DF and Pto-RAD50-422-R are subjected to PCR amplification, and no amplification products are obtained when Pto-RAD50-422-IF and Pto-RAD50-422-R are subjected to PCR amplification, the genotype of the sample InDel is DD, i.e., deletion type;

[0041] If no amplification product is obtained when Pto-RAD50-422-DF and Pto-RAD50-422-R are subjected to PCR amplification, and an amplification product is obtained when Pto-RAD50-422-IF and Pto-RAD50-422-R are subjected to PCR amplification, the genotype of the sample InDel is II, that is, the insertion type.

[0042] The present invention also provides a kit for detecting photosynthetic efficiency of poplars, comprising the above primer set. The kit provided by the present invention can accurately and quickly determine the photosynthetic efficiency of poplars.

[0043] The present invention also provides an application of the application or the primer set or the kit in poplar breeding. The present invention can quickly and accurately determine the genotype of the SNP and InDel of the poplar sample to be tested, and then judge the photosynthetic efficiency of the poplar by the determined genotype combination, so as to accurately and efficiently screen the superior plants of Populus tomentosa with high photosynthetic efficiency in the early growth stage of the poplar, and effectively shorten the breeding cycle. By detecting the genotype of the SNP and InDel sites, the present invention can screen the poplar samples with the genotype combination of AA-GG-II for subsequent breeding operations in order to obtain poplar varieties with high photosynthetic efficiency.

[0044] In the present invention, all primers were synthesized by Sangon Biotech Co., Ltd.

[0045] In the present invention, unless otherwise specified, the chemical reagents used are all conventional commercially available reagents, and the technical means used are all conventional technical means well known to those skilled in the art.

[0046] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0047] Example 1

[0048] Primer set for detecting haplotypes of Pto-RAD50 gene

[0049] The primer set includes: a primer set for identifying the genotype of the 172nd base (SNP1) of the nucleotide sequence shown in SEQ ID NO.1: Pto-RAD50-172-CF and Pto-RAD50-172-R, the amplification product is 91bp, Pto-RAD50-172-AF and Pto-RAD50-172-R, the amplification product is 91bp; a primer set for identifying the genotype of the 442nd base (SNP2) of the nucleotide sequence shown in SEQ ID NO.1: Pto-RAD50-442-AF and Pto-RAD50-442-R, the amplification product is 81bp, Pto-RAD50-442-GF and Pto-RAD50-442-R, the amplification product is 81bp; a primer set for identifying the genotype of the 442nd base (SNP2) of the nucleotide sequence shown in SEQ ID NO.1: Pto-RAD50-442-AF and Pto-RAD50-442-R, the amplification product is 81bp; The primer set for the InDel sequence after position 422 of the nucleotide sequence shown in NO.1 is: Pto-RAD50-422-DF and Pto-RAD50-422-R, the amplification product is 92bp, Pto-RAD50-422-IF and Pto-RAD50-422-R, the amplification product is 104bp; the specific nucleotide sequence of the primer set is shown in Table 1.

[0050] Table 1 Primer sets used to identify SNP and InDel genotypes

[0051]

[0052] All primers were synthesized by Sangon Biotech.

[0053] Example 2

[0054] The primer set of Example 1 was used to identify the genotypes of the SNPs and InDels of 30 individuals in a hybrid population of Populus tomentosa, and then the photosynthetic efficiency of the samples was evaluated, in the following steps:

[0055] 1) 30 individuals were randomly selected from the hybrid population germplasm resource bank of Populus tomentosa planted in Guanxian County, Shandong Province. The net photosynthetic rate of any leaf from the third to the sixth leaf was measured using the Li-6800 portable photosynthetic fluorescence measurement system between 8:30 and 11:00 in the morning on a clear day. The measurement results are shown in Table 2.

[0056] 2) After the measurement, the leaves were collected and immediately frozen in liquid nitrogen (-196°C);

[0057] 3) The genomic DNA of leaf samples was extracted using the FastPure Universal Plant Total RNA Isolation Kit (Vazyme China, Nanjing, China);

[0058] 4) Using the locked nucleic acid modification method to determine the 172nd base, the 442nd base, and the InDel after the 422nd base in the promoter region of the Pto-RAD50 gene in the genomic DNA of the leaf sample of the Populus tomentosa leaf. Using the primer set described in Example 1, PCR amplification was performed using the genomic DNA obtained in step 3) as a template;

[0059] The PCR reaction system was as follows: 5 μL of 10× PCR amplification buffer, 1 μL of 0.01 μmol / μL dNTP mixture, 2.5 μL of 300 ng / μL genomic DNA template, 0.5 μL of 2.5 U / μL high-fidelity DNA polymerase, 0.5 μL of 1.5 mmol / μL MgCl2, 1.25 μL of each of 10 μmol / L upstream and downstream primers, and 38 μL of double distilled water;

[0060] The amplification procedure is as follows:

[0061] Step 1: pre-denaturation at 95°C for 3 min;

[0062] Step 2: denaturation at 95 °C for 15 s, annealing at 57 °C for 30 s, and extension at 72 °C for 15 s, and step 2 was performed for 35 cycles;

[0063] Step 3: Extend thoroughly at 72°C for 5 min.

[0064] After PCR amplification, agarose gel electrophoresis was used to detect the amplified product and the result was judged.

[0065] The genotypes of the SNPs and InDels of the candidate samples and the corresponding net photosynthetic rates are shown in Table 2.

[0066] Table 2 Genotypes and net photosynthetic rates of three predetermined loci of Populus tomentosa individuals to be tested

[0067]

[0068]

[0069] According to the results in Table 2, the overall net photosynthetic rate of the 30 plants was 15.21 μmol CO2·m -2 ·s -1 ±5.01μmol CO2·m -2 ·s -1 When the genotype combination of the 172nd base, the 442nd base, and the InDel after the 422nd base in the promoter region of Pto-RAD50 was CC-AA-DD, the net photosynthetic rate of the candidate poplar individuals was the lowest, as reflected in the net photosynthetic rate of the candidate individuals (10.79 μmol CO2·m -2 ·s -1±1.16μmol CO2·m -2 ·s -1 ) and the overall net photosynthetic rate (15.21 μmol CO2·m -2 ·s -1 ±5.01μmol CO2·m -2 ·s -1 ) was 29.06% lower than that of the candidate poplars. When the genotype combination of the 172nd base, the 442nd base, and the InDel after the 422nd base in the Pto-RAD50 promoter region was AA-GG-II, the net photosynthetic rate of the candidate poplars was the highest, as reflected in the net photosynthetic rate of the candidate individuals (22.75 μmol CO2·m -2 ·s -1 ±0.92μmol CO2·m -2 ·s -1 ) and the overall net photosynthetic rate (15.21 μmol CO2·m -2 ·s -1 ±5.01μmol CO2·m -2 ·s -1 ) is 49.57% higher than that of

[0070] It can be seen that the present invention can accurately and quickly determine the genotypes of the two SNP and InDel sites that are significantly correlated with the photosynthetic efficiency traits of poplar trees, and then judge the photosynthetic efficiency of poplar trees by the determined genotype combination, thereby accurately and efficiently screening high-photosynthetic-efficiency superior plants in the early growth stage of poplar trees, and effectively shortening the breeding cycle of high-productivity poplar varieties.

[0071] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An application of a Pto-RAD50 gene haplotype in evaluating plant photosynthetic efficiency, characterized in that: The nucleotide sequence of the Pto-RAD50 gene is shown in SEQ ID NO: 1; the haplotype of the Pto-RAD50 gene is determined according to the nucleotides of SNP1, SNP2 and InDel, wherein SNP1 is the nucleotide at position 172 of SEQ ID NO: 1, and the nucleotide is C or A; SNP2 is the nucleotide at position 442 of SEQ ID NO: 1, and the nucleotide is A or G; and the InDel is the nucleotide after position 422 of SEQ ID NO: 1, which is ATTATTTTAATA or ATTATTTTAATA is missing; The nucleotide of the SNP1 is C, the nucleotide of the SNP2 is A, and when the nucleotide of the InDel lacks ATTATTTTAATA, the photosynthetic efficiency of the plant is low; When the nucleotide of the SNP1 is A, the nucleotide of the SNP2 is G, and the nucleotide of the InDel is ATTATTTTAATA, the photosynthetic efficiency of the plant is high; The plant is Populus tomentosa.

2. A primer set for detecting plant photosynthetic efficiency, characterized in that: It includes a primer set for detecting the SNP1 genotype: the nucleotide sequences are shown as SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 respectively; Primer set for detecting SNP2 genotype: nucleotide sequences are shown as SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, respectively; Primer set for detecting InDel genotype: nucleotide sequences are shown in SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10, respectively; The nucleotide of the SNP1 is C, the nucleotide of the SNP2 is A, and when the nucleotide of the InDel lacks ATTATTTTAATA, the photosynthetic efficiency of the plant is low; When the nucleotide of the SNP1 is A, the nucleotide of the SNP2 is G, and the nucleotide of the InDel is ATTATTTTAATA, the photosynthetic efficiency of the plant is high; The plant is Populus tomentosa.

3. A kit for detecting photosynthetic efficiency of poplar, characterized in that: Comprising the primer set of claim 2; the poplar is Populus tomentosa.

4. Use of the primer set according to claim 2 or the kit according to claim 3 in poplar breeding, characterized in that: The poplar is Populus tomentosa.

Images