Application of enzalutamide combined with copper ion carrier in the preparation of drugs for the treatment of prostate cancer

Abstract

The present invention discloses the use of enzalutamide in combination with a copper ion carrier in the preparation of a drug for treating prostate cancer. The present invention discovers for the first time that the combination of enzalutamide and a copper ion carrier has a synergistic therapeutic effect in the treatment of prostate cancer, providing a new treatment option for the research field of prostate cancer treatment and offering new ideas and strategies for the development of drugs for treating prostate cancer. The present invention has important scientific significance and clinical application value, and has broad application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the use of enzalutamide in combination with a copper ion carrier in the preparation of a drug for treating prostate cancer. Background Art

[0002] With the widespread adoption of prostate cancer (PCa) screening, the incidence of prostate cancer continues to rise. Surgery is the treatment of choice for prostate cancer. However, within 10 years after radical prostate cancer treatment, approximately 20% to 50% of patients will experience biochemical recurrence, characterized by elevated levels of prostate-specific antigen (PSA), a target gene of the transcription factor androgen receptor (AR). The AR signaling pathway plays a crucial role in the development and progression of prostate cancer. Androgen deprivation therapy (ADT), either surgically or with medications, can effectively reduce tumor burden. However, despite low serum androgen levels after treatment, some prostate cancers continue to proliferate and progress to castration-resistant prostate cancer (CRPC). Because AR signaling persists in the majority of CRPC cases, patients are treated with the more potent AR antagonist enzalutamide (ENZ). Unfortunately, patients receiving enzalutamide eventually develop resistance through a variety of complex mechanisms. Therefore, it is particularly important to explore the mechanism of ENZ resistance and further develop safe and effective combination treatment strategies to improve the overall treatment effect of castration-resistant prostate cancer.

[0003] Elesclomol (ELE) was originally used as an adjuvant chemotherapy agent to enhance sensitivity to paclitaxel-based drugs and is currently being used in the treatment of metastatic melanoma. Although a Phase III clinical trial demonstrated that the combination of elesclomol and paclitaxel did not prolong progression-free survival, related studies have shown that patients with low lactate dehydrogenase (LDH) levels may be more sensitive to elesclomol. Elevated serum LDH levels in tumors are often associated with hypoxia, which forces tumor cells to utilize enhanced glycolysis for energy. This strongly suggests a relationship between tumor sensitivity to elesclomol and cellular metabolism. In recent years, elesclomol's ability to transport copper ions into mitochondria has garnered significant attention. This ability has been used to treat copper-deficiency disorders such as Menkes disease. Elesclomol's potent anti-tumor activity suggests that it holds promise for cancer patients. Most studies examining elesclomol's anti-cancer mechanism explain its promotion of intracellular ROS accumulation and induction of oxidative stress. A recent study showed that the anti-cancer effect of ilisimol depends on its ability to transport extracellular copper ions into cells and the mitochondrial metabolic intensity of cancer cells, and induces a new type of cell death characterized by the instability of iron-sulfur cluster proteins and the aggregation of acylated proteins, which is named copper death.

[0004] Disulfiram (DSF), a drug approved by the US Food and Drug Administration in 1951 for the treatment of alcohol addiction, has been widely used clinically for over 70 years without serious side effects. As an inhibitor of aldehyde dehydrogenase (ALDH), DSF inhibits all currently identified cytosolic and mitochondrial ALDH isoforms, leading to the specific accumulation of acetaldehyde, which causes unpleasant reactions when drinking alcohol, thus serving as an alcohol abstinence medication. DSF has been considered a potential cancer treatment, and its cytotoxicity is dependent on copper ions. Copper is an essential micronutrient involved in fundamental life processes and conserved in all forms of life. It plays a crucial role in redox reactions and triggers the generation of reactive oxygen species (ROS). As a divalent metal ion carrier, DSF was previously thought to form complexes with copper, which are more readily absorbed by cells and have cytotoxic effects on various cancer cells. A recent study shows that disulfiram, as a copper ion carrier, can transport divalent copper ions into cells, increasing the intracellular copper ion level. When the copper level is higher than the maximum range that the cell can tolerate, it will inhibit the fatty acylation process in the cell's mitochondrial metabolism, leading to copper death of the cell.

[0005] At present, there are no studies or reports on the combined use of enzalutamide and the above-mentioned two copper ion carriers ilisimol and disulfiram for the treatment of prostate cancer or the treatment of prostate cancer resistant to enzalutamide. Summary of the Invention

[0006] In view of this, in order to overcome the technical problem that there is still a lack of safe and effective combination treatment options in the field of prostate cancer treatment, the purpose of the present invention is to provide a combination pharmaceutical composition for treating prostate cancer (or prostate cancer resistant to enzalutamide), providing an effective drug combination strategy in this field.

[0007] The combination pharmaceutical composition comprises enzalutamide and a copper ion carrier (elisimol or disulfiram). The present invention is the first to discover that the combination of enzalutamide and a copper ion carrier (elisimol or disulfiram) can significantly enhance the killing effect on prostate cancer cells and has a synergistic effect on the treatment of prostate cancer.

[0008] The above-mentioned object of the present invention is achieved through the following technical solutions:

[0009] A first aspect of the present invention provides a combined pharmaceutical composition for treating and / or preventing prostate cancer or for treating and / or preventing enzalutamide-resistant prostate cancer.

[0010] Furthermore, the combination pharmaceutical composition comprises enzalutamide and a copper ion carrier.

[0011] Furthermore, the copper ion carrier is ilisimol or disulfiram;

[0012] Preferably, the concentration ratio of enzalutamide and ilisimol is (1.25 μM-80 μM): (1.25 nM-200 nM);

[0013] Preferably, the concentration ratio of enzalutamide to disulfiram is (1.25 μM-80 μM): (18.83 nM-800 nM);

[0014] Preferably, the combined pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or excipient;

[0015] Preferably, the prostate cancer is castration-resistant prostate cancer.

[0016] In some embodiments, the pharmaceutically acceptable carrier and / or excipient includes any substance suitable for use in humans and / or mammals without excessive adverse side effects (e.g., toxicity, irritation, and allergic reactions), i.e., a substance with a reasonable benefit / risk ratio. The pharmaceutically acceptable carriers and / or excipients that can be used in the combination pharmaceutical composition or pharmaceutical preparation of the present invention are conventional, and suitable pharmaceutically acceptable carriers and / or excipients are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995). Exemplarily, the pharmaceutically acceptable carrier and / or excipient include, but are not limited to, any one or a combination of at least two of a diluent, excipient, filler, binder, wetting agent, disintegrant, emulsifier, solubilizer, osmotic pressure regulator, surfactant, coating material, colorant, pH regulator, antioxidant, antibacterial agent, or buffer.

[0017] In some embodiments, the combination pharmaceutical composition comprises a single compound preparation or a combination of two separate single preparations. In some embodiments, the combination pharmaceutical composition is a single compound preparation, wherein the compound preparation is a compound preparation comprising the aforementioned enzalutamide and a copper ion carrier. In some embodiments, the combination pharmaceutical composition is a combination of two separate single preparations, wherein the combination of single preparations is a combination of a single preparation comprising the aforementioned enzalutamide and a single preparation comprising the aforementioned copper ion carrier.

[0018] In some embodiments, the administration methods of the two single-ingredient preparations in the combination of the single-ingredient preparations include but are not limited to: simultaneous administration and sequential administration. When the administration method of the two single-ingredient preparations in the combination of the single-ingredient preparations is sequential administration, the administration methods include: first administering the single-ingredient preparation containing the above-mentioned enzalutamide, and then administering the single-ingredient preparation containing the above-mentioned copper ion carrier; first administering the single-ingredient preparation containing the above-mentioned copper ion carrier, and then administering the single-ingredient preparation containing the above-mentioned enzalutamide.

[0019] In the present invention, the treatment and / or prevention refers to delaying the development of a disease, preventing the development of a disease, and / or reducing the severity of the symptoms that will develop or are expected to develop. Therefore, these terms include improving existing disease symptoms, preventing additional symptoms, improving or preventing potential metabolic causes of symptoms, inhibiting an obstacle or disease, for example, preventing the development of an obstacle or disease, alleviating an obstacle or disease, causing an obstacle or disease to regress, alleviating the symptoms caused by the disease or obstacle, or stopping the symptoms of a disease or obstacle. In a specific embodiment of the present invention, the disease is prostate cancer.

[0020] In some embodiments, the prostate cancer includes, but is not limited to, hormone-sensitive prostate cancer and castration-resistant prostate cancer. Hormone-sensitive prostate cancer patients are sensitive and responsive to endocrine therapy, and the vast majority of prostate cancer patients are diagnosed with hormone-sensitive prostate cancer. Castration-resistant prostate cancer patients are resistant to traditional endocrine therapy and represent a terminal stage of prostate cancer.

[0021] A second aspect of the present invention provides a pharmaceutical preparation for treating and / or preventing prostate cancer or for treating and / or preventing enzalutamide-resistant prostate cancer.

[0022] Furthermore, the pharmaceutical preparation comprises the combined pharmaceutical composition described in the first aspect of the present invention.

[0023] Furthermore, the dosage form of the pharmaceutical preparation includes a dosage form for enteral administration and a dosage form for parenteral administration;

[0024] Preferably, the dosage forms for administration via the gastrointestinal tract include solutions, granules, tablets, capsules, suspensions, powders, sustained-release preparations, effervescent preparations, emulsions, syrups, drops, and chewable preparations;

[0025] Preferably, the non-gastrointestinal administration dosage form includes an injection dosage form, a respiratory tract administration dosage form, a cavity administration dosage form, a mucosal administration dosage form, and a skin administration dosage form;

[0026] Preferably, the prostate cancer is castration-resistant prostate cancer.

[0027] In some embodiments, the pharmaceutical preparation contains pharmaceutical excipients, which can be conventionally used in various preparations, including but not limited to isotonic agents, buffers, flavoring agents, excipients, fillers, binders, disintegrants and lubricants; or selected for compatibility with the substance, including but not limited to emulsifiers, solubilizers, antibacterial agents, analgesics and antioxidants. Such excipients can effectively improve the stability and solubility of the active ingredients contained in the composition or change the release rate and absorption rate of the active ingredients, thereby improving the metabolism of various active ingredients in the organism and enhancing the administration effect of the composition. In addition, excipients used to achieve specific administration purposes or methods, such as sustained-release administration, controlled-release administration and pulse administration, include but are not limited to gelatin, albumin, chitosan, polyether and polyester polymers (such as polyethylene glycol, polyurethane, polycarbonate and its copolymers, etc.). The main manifestations of the advantages of administration include: improving therapeutic effect, improving bioavailability, reducing toxic side effects and improving patient compliance.

[0028] In some embodiments, the injection dosage forms include but are not limited to: intravenous injection, intramuscular injection, subcutaneous injection, intradermal injection and intracavitary injection and other injections; the respiratory tract administration dosage forms include but are not limited to: sprays, aerosols, powder mists, etc.; the cavity administration dosage forms include but are not limited to: suppositories, aerosols, effervescent tablets, drops, pills, etc., for use in the rectum, vagina, urethra, nasal cavity, ear canal, etc.; the mucosal administration dosage forms include but are not limited to: eye drops, nasal drops, eye ointments, gargles, sublingual tablets, adhesive tablets, patches, etc.; the skin administration dosage forms include but are not limited to: external solutions, lotions, liniments, ointments, plasters, pastes, patches, etc.

[0029] In some embodiments, the appropriate dosage of the combination pharmaceutical composition or pharmaceutical preparation described in the present invention can be prescribed in a variety of ways depending on factors such as the formulation method, administration method, patient's age, weight, sex, morbidity, diet, administration time, administration route, excretion rate and reaction sensitivity. A skilled physician can usually easily determine the prescription and the desired effective dosage for treatment.

[0030] In some embodiments, the combination pharmaceutical composition or pharmaceutical preparation described in the present invention can also be used in combination with other therapeutic compounds that can be used to treat and / or prevent and / or assist in the treatment and / or assist in the prevention of prostate cancer. During the treatment process, the dosage of the combination pharmaceutical composition or pharmaceutical preparation described in the present invention can be adjusted according to the severity of the symptoms, the frequency of recurrence and the physiological response to the treatment regimen.

[0031] In some embodiments, the other therapeutic compounds that can be used to treat and / or prevent and / or assist in the treatment and / or assist in the prevention of prostate cancer include any currently known drugs that can be used to treat and / or prevent and / or assist in the treatment and / or assist in the prevention of prostate cancer, including but not limited to: anti-androgen drugs, chemical drugs, and analgesics. The anti-androgen drugs include but are not limited to: bicalutamide tablets, ketoconazole tablets, flutamide tablets, etc. The chemical drugs include but are not limited to: methotrexate for injection, cyclophosphamide for injection, fluorouracil injection, etc. The analgesics include but are not limited to: ibuprofen tablets, celecoxib capsules, diclofenac sodium sustained-release tablets, etc.

[0032] A third aspect of the present invention provides the use of enzalutamide in combination with a copper ion carrier in the preparation of a medicament for treating and / or preventing prostate cancer or for treating and / or preventing prostate cancer resistant to enzalutamide.

[0033] Furthermore, the copper ion carrier is ilisimol or disulfiram;

[0034] Preferably, the concentration ratio of enzalutamide and ilisimol is (1.25 μM-80 μM): (1.25 nM-200 nM);

[0035] Preferably, the concentration ratio of enzalutamide to disulfiram is (1.25 μM-80 μM): (18.83 nM-800 nM);

[0036] Preferably, the drug further comprises a pharmaceutically acceptable carrier and / or excipient;

[0037] Preferably, the prostate cancer is castration-resistant prostate cancer.

[0038] A fourth aspect of the present invention provides an in vitro method for inhibiting the growth of prostate cancer cells or prostate cancer organoids and / or promoting apoptosis of prostate cancer cells or prostate cancer organoids for non-therapeutic purposes.

[0039] Furthermore, the method comprises the following steps: treating target prostate cancer cells or prostate cancer organoids with the combined pharmaceutical composition described in the first aspect of the present invention or the pharmaceutical preparation described in the second aspect of the present invention.

[0040] A fifth aspect of the present invention provides an in vitro method for inhibiting the growth of enzalutamide-resistant prostate cancer cells or prostate cancer organoids and / or promoting apoptosis of enzalutamide-resistant prostate cancer cells or prostate cancer organoids for non-therapeutic purposes.

[0041] Furthermore, the method comprises the following steps: treating target prostate cancer cells or prostate cancer organoids that are resistant to enzalutamide using the combined pharmaceutical composition of the first aspect of the present invention or the pharmaceutical preparation of the second aspect of the present invention.

[0042] In specific embodiments of the present invention, the present invention has first discovered, through cell and animal experiments, that the combination of enzalutamide and elisimol, or the combination of enzalutamide and disulfiram, can produce a synergistic effect in the treatment of prostate cancer (including enzalutamide-resistant prostate cancer), significantly inhibiting the growth and proliferation of prostate cancer cells and promoting apoptosis of prostate cancer cells. Therefore, the combination pharmaceutical composition or pharmaceutical formulation can be used as an inhibitor for inhibiting the growth and proliferation of prostate cancer cells or prostate cancer organoids for non-therapeutic purposes, and can be used in scientific research, such as to further study the growth, metabolism, or resistance mechanisms of prostate cancer cells (including enzalutamide-resistant prostate cancer), screen for potential drugs for the treatment of prostate cancer, or screen for potential sensitizers that enhance the sensitivity of prostate cancer cells to enzalutamide.

[0043] In a specific embodiment of the present invention, the present invention visually verifies the synergistic effect of the combination of enzalutamide and ilisimol, and the combination of enzalutamide and disulfiram through the CI index of the combination, and the CI values ​​are all less than 1. The combination CI (combination index, CI) index is a method for evaluating the combined effect of drugs. The method is based on the dose-effect curve of the drug, and the drug combination index CI corresponding to the cell effect fraction (Fraction affected, Fa, i.e., the cell growth inhibition rate after drug treatment) of each treatment group is calculated by CompuSyn software, and the Fa-CI curve is drawn to determine whether the combination has a synergistic effect, an additive effect, or an antagonistic effect. When CI <1, it means that the combination of the two drugs has a synergistic effect, when CI = 1, it means that the combination of the two drugs has an additive effect, and when CI > 1, it means that the combination of the two drugs has an antagonistic effect.

[0044] The present invention also provides a method for treating and / or preventing prostate cancer or treating and / or preventing prostate cancer resistant to enzalutamide, comprising the steps of administering to a subject in need thereof a therapeutically and / or prophylactically effective amount of the combination pharmaceutical composition of the first aspect of the present invention or the pharmaceutical preparation of the second aspect of the present invention.

[0045] In the present invention, the effective amount refers to the amount of the compound (the active ingredients in the combination pharmaceutical composition or pharmaceutical formulation of the present invention, i.e., enzalutamide and elisemol, or enzalutamide and disulfiram) that effectively produces the desired preventive, allergic, or therapeutic effect. The amount of the combination pharmaceutical composition or pharmaceutical formulation of the present invention required to achieve an effective amount will vary depending on factors such as the compound, the symptoms and their severity, and the age of the mammal being treated. However, the specific amount can be routinely determined by a person of ordinary skill in the art based on their knowledge in the art and the disclosure herein.

[0046] In some embodiments, the combination pharmaceutical composition or pharmaceutical preparation can be administered to the subject by injection, topical administration or oral administration. For example, the method can include administering the combination pharmaceutical composition or pharmaceutical preparation to the subject three times a day, once a day, once every two days, etc. In certain embodiments, injection administration can include subcutaneous injection, intramuscular injection, intravenous injection, etc. In certain embodiments, injection administration can include injecting the combination pharmaceutical composition directly into the lesion or in the area near the lesion, and in certain embodiments, topical administration can include rectal administration, nasal administration, ear administration, intramedullary administration, intraarticular administration, intrapleural administration, etc., or any combination thereof. In certain embodiments, the combination pharmaceutical composition or pharmaceutical preparation can be administered to the subject via a combination of different administration methods.

[0047] In some embodiments, the subject is an animal, preferably a mammal (human and non-human animals), including but not limited to humans, non-human primates (particularly higher primates, such as macaques, crab-eating macaques, short-tailed macaques, bear monkeys, flat-topped monkeys, golden monkeys and tree shrews), sheep, dogs, rodents (such as mice or rats), guinea pigs, goats, pigs, cats, rabbits, cows, any livestock or pets, etc. In a preferred embodiment, the subject is a human.

[0048] A sixth aspect of the present invention provides any of the following applications:

[0049] (1) Use of copper ion carriers in the preparation of drugs for enhancing the anti-prostate cancer activity of enzalutamide;

[0050] (2) Use of enzalutamide and a copper ion carrier in combination to prepare a reagent for inhibiting the growth of prostate cancer cells or prostate cancer organoids and / or promoting apoptosis of prostate cancer cells or prostate cancer organoids for non-therapeutic purposes in vitro.

[0051] Furthermore, the copper ion carrier is ilisimol or disulfiram;

[0052] Preferably, the concentration ratio of enzalutamide and ilisimol is (1.25 μM-80 μM): (1.25 nM-200 nM);

[0053] Preferably, the concentration ratio of enzalutamide to disulfiram is (1.25 μM-80 μM): (18.83 nM-800 nM);

[0054] Preferably, the prostate cancer cells or prostate cancer organoids include prostate cancer cells or prostate cancer organoids that are resistant to enzalutamide;

[0055] Preferably, the prostate cancer is castration-resistant prostate cancer.

[0056] Compared with the prior art, the present invention has the following beneficial effects:

[0057] The present invention discovers for the first time that the combination of enzalutamide and a copper ion carrier (elisimol or disulfiram) has a synergistic therapeutic effect in the treatment of prostate cancer. The combination of enzalutamide and a copper ion carrier (elisimol or disulfiram) can significantly enhance the killing effect on prostate cancer cells and significantly improve the therapeutic effect on prostate cancer. The present invention provides a new treatment option for the research field of prostate cancer treatment and offers new ideas and strategies for the development of prostate cancer treatment drugs. It has important scientific significance and clinical application value, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1Enzalutamide synergistically inhibits the growth of castration-resistant prostate cancer cells with copper ionophores. (AB) Dose-response curves of 22Rv1 and C4-2B cells treated with the copper ionophores elesclomol (ELE) or disulfiram (DSF) alone or in combination with enzalutamide (ENZ) were measured by crystal violet assay. Data are shown as mean ± SD. (CD) Combination index (CI) and fraction-affected values ​​of ELE / DSF and ENZ in 22Rv1 and C4-2B cells were calculated using CalcuSyn software based on the Chou-Talay equation. Graphs were plotted using GraphPad Prism 10.0 software.

[0059] Figure 2 Enzalutamide combined with a copper ionophore synergistically inhibits the proliferation of castration-resistant prostate cancer cells. A clonogenic assay was performed to examine the effects of the copper ionophore ilisimol or disulfiram combined with enzalutamide on the proliferation of 22Rv1 and C4-2B cells. Cells were treated with medium containing or without the copper ion chelator TTM overnight before drug treatment. After 10 days of treatment with either single or combined drugs, cells grown on cell culture plates were fixed with methanol and stained with crystal violet. For 22Rv1 cells, the following treatments were performed: ELE, 2 nM; DSF, 50 nM; ENZ, 20 μM. For C4-2B cells, the following treatments were performed: ELE, 5 nM; DSF, 100 nM; ENZ, 10 μM. Data are shown as mean ± SD. ***p < 0.001 (Student's t-test).

[0060] Figure 3 Enzalutamide combined with copper ionophores synergistically inhibits the 3D spheroid formation of castration-resistant prostate cancer cells. 22Rv1 and C4-2B cells cultured in Matrigel were treated with copper ionophores (ELE or DSF) and ENZ, either alone or in combination, for 10 days. Images were taken using an inverted microscope. Representative images of each treatment group are shown. Spheroid integrity was analyzed, with the percentage of intact, partially disintegrated, and completely disintegrated spheroids in each group being presented. Scale bar, 200 μm. For 22Rv1 cells, ELE, 5 nM; DSF, 200 nM; and ENZ, 20 μM. For C4-2B cells, ELE, 10 nM; DSF, 300 nM; and ENZ, 10 μM were used.

[0061] Figure 4The synergistic cell inhibition caused by enzalutamide combined with a copper ionophore can only be restored by a copper ion chelator. (AB) Heatmaps showing the viability of 22Rv1 and C4-2B cells after pretreatment overnight with 30 μM apoptosis inhibitor Z-VAD-FMK (Z-Vad), 10 μM ferroptosis inhibitor Ferrostatin-1 (Fer-1), 20 μM necroptosis inhibitor Necrostatin-1 (Nec-1), 20 μM copper ion chelator TTM, and 2 mM oxidative stress inhibitor N-acetylcysteine ​​(NAC), followed by 5 days of treatment with enzalutamide and / or ilisimol (A) or disulfiram (B).

[0062] Figure 5 Enzalutamide combined with copper ionophores synergistically induces iron-sulfur cluster protein destabilization and lipoylated protein aggregation. (A) Western blotting assays examined the expression of iron-sulfur cluster proteins FDX1 and LIAS in 22Rv1 and C4-2B cells after 48-hour treatment with copper ionophores (ELE or DSF) and / or ENZ. Vinculin was used as a reference protein. (B) Quantification of protein expression in (A) is shown. Data are shown as mean ± SEM. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001 (Student's t-test). (C) Immunofluorescence analysis of DLAT (green), Mitotracker (red), and DAPI (blue) in 22Rv1 cells after 48-hour treatment with copper ionophores (ELE or DSF) and / or ENZ. Representative images were taken for each group. Scale bar, 20 μm.

[0063] Figure 6 Knockdown of FDX1 partially reversed cell death induced by ELE alone or the ENZ / ELE combination, but not by DSF alone or the ENZ / DSF combination. (A) Quantitative PCR assay was used to verify the knockdown effect of FDX1 by siRNA in 22Rv1 cells, using β-actin as a reference gene. Data are shown as mean ± SD, ***p < 0.001 (Student's t-test). (B-C) Crystal violet staining was used to assess cell viability in 22Rv1 cells transfected with siNC or siFDX1 and treated with copper ionophores (ELE or DSF) and / or ENZ. Data are shown as mean ± SD, ns, not significant, ***p < 0.001 by a two-way ANOVA (Tukey's multiple comparison test).

[0064] Figure 7 Copper ionophores and enzalutamide synergistically inhibit the growth of CRPC cell line 22Rv1 mouse xenograft tumors. (A) Enzalutamide (25 mg / kg / day, every other day, by oral gavage) and / or the copper ionophore ilisimol (25 mg / kg / day, twice weekly, subcutaneous injection) or disulfiram (25 mg / kg / day, once daily, by oral gavage) were used alone or in combination to treat a 22Rv1 cell xenograft mouse model. Figures show the fold change in tumor volume compared to the initial treatment on day 0. Tumor volume was measured every two days. Data are shown as mean ± SEM, n = 8, ***p < 0.001 by a two-way ANOVA (Tukey's multiple comparison test). (B) Images of isolated tumor sizes at the end of treatment for the different treatment groups. (C) Tumor weights of mice in the different treatment groups are shown as mean ± SEM, **p < 0.01, ***p < 0.001 by a one-way ANOVA (Tukey's multiple comparison test). (D) Waterfall plot showing the fold change in tumor volume of mice treated with different treatment groups. The fold change was calculated as: (tumor volume at the end of treatment - tumor volume before treatment) / tumor volume before treatment × 100%. Note: The tumor volume before treatment is the tumor volume on day 0.

[0065] Figure 8 Effects of the combined copper ionophore and enzalutamide therapy on Ki67 and LIAS. Representative images of Ki67 and LIAS immunohistochemical staining at the end of treatment in 22Rv1 xenograft tumors from different treatment groups. n = 6. Integrated optical density (IOD) was measured using Image J software. Scale bar, 50 μm. Data are shown as mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001 by one-way ANOVA (Tukey's multiple comparison test).

[0066] Figure 9 :Build Pten - / - p53 - / - Mouse prostate organoid model. (A) Schematic diagram showing the prostate organoid model derived from Pten loxp / loxp p53 loxp / loxpMouse prostate organoids. Pten and p53 knockout was achieved by adenoviral Cre (Ad-Cre) infection and Nutlin3a selection. (B) Pten protein levels were assessed by Western blot to verify Pten and p53 knockout, with vinculin serving as a reference protein. (C) Representative images of mouse prostate organoids cultured on the indicated days before and after Pten and p53 double knockout. Scale bar, 100 μm.

[0067] Figure 10 : Copper ionophores and enzalutamide have synergistic cytotoxicity against Pten p53-deficient mouse prostate organoids and cells, and enzalutamide treatment makes cells more dependent on oxidative phosphorylation. (A) (Left) Representative images of organoids after 4 days of treatment with copper ionophores ELE or DSF and ENZ, (Right) shows the ATP levels (luminescent signal) of organoids in different treatment groups. ELE, 5nM; DSF, 200nM, ENZ, 10μM. Scale bar, 200μm. Data are shown as mean ± SD, **p < 0.01, ***p < 0.001 by a one-way ANOVA (Tukey's multiples comparison test). (B) MPOd cells (Pten p53-deficient mice) treated with different concentrations of the oxidative phosphorylation inhibitor IACS-010759 with or without enzalutamide (5μM) were treated. - / - p53 - / - Mouse prostate organoid-derived cells were cultured for 5 days. Cell viability was assessed using the crystal violet assay after 5 days. Data are shown as mean ± SD. ***p < 0.001 by a two-way ANOVA (Tukey's multiple comparison test). (C) Dose-response curves of MPOd cells treated with the copper ionophore ilisimol or disulfiram alone or in combination with enzalutamide were measured using the crystal violet assay. Data are shown as mean ± SD. (D) Combination Index (CI) and Fraction Affected value were calculated using CalcuSyn software based on the Chou-Talay equation and plotted using GraphPad Prism 10.0 software.

[0068] Figure 11Copper ionophores and enzalutamide inhibit the growth of MPOd cells. A colony formation assay examined the effects of the copper ionophore ilisimol (8 nM) or disulfiram (80 nM) combined with enzalutamide (5 μM) on the growth of MPOd cells. Cells were pretreated overnight with medium containing or without the copper ion chelator TTM (2 μM) before drug treatment. After 8 days of treatment with either single or combined drugs, cells grown on cell culture plates were fixed with methanol and stained with crystal violet. Data are shown as mean ± SD. ***p < 0.001 (Student's t-test).

[0069] Figure 12 Copper ionophores combined with enzalutamide synergistically induce destabilization of iron-sulfur cluster proteins and aggregation of lipoylated proteins. (A) Western blot analysis of the expression of iron-sulfur cluster proteins FDX1 and LIAS in MPOd cells after 48 hours of treatment with copper ionophores (ELE or DSF) and / or ENZ. Vinculin was used as a loading control protein. Quantification of protein expression abundance is shown. Data are shown as mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001 (Student's t-test). (B) Immunofluorescence analysis of DLAT (green), Mitotracker (red), and DAPI (blue) in 22Rv1 cells after 48 hours of treatment with copper ionophores (ELE or DSF) and / or ENZ. Scale bar, 20 μm.

[0070] Figure 13 Enzalutamide treatment increases reliance on oxidative phosphorylation in resistant cells. (A) Viability of C4-2B and LNCaP parental cells or enzalutamide-resistant (ENZR) cells treated with enzalutamide for 5 days was measured using a crystal violet assay. (B) Enzalutamide-resistant cell lines (C4-2B ENZR and LNCaP ENZR) were treated with different concentrations of the oxidative phosphorylation inhibitor IACS-010759 with or without enzalutamide (10 μM). Cell viability was assessed using a crystal violet assay after 5 days. Data are shown as mean ± SD. ***p < 0.001 by a two-way ANOVA (Tukey's multiple comparison test).

[0071] Figure 14Copper ionophores synergistically inhibit the growth of drug-resistant cells with enzalutamide. (A-B) Dose-response curves of the copper ionophores elisimol (A) or disulfiram (B) after 5-day treatment of MPOd cells, measured by the crystal violet assay. Data are shown as mean ± SD. (B-C) Combination indexes (CI) and fraction affected values ​​for elisimol or disulfiram monotherapy or combination therapy with enzalutamide were calculated using CalcuSyn software based on the Chou-Talay equation. Graphs were plotted using GraphPad Prism 10.0 software.

[0072] Figure 15 Copper ionophores synergistically inhibit the colony formation of drug-resistant cells with enzalutamide. A colony formation assay examined the effects of the copper ionophores ilisimol (2 nM) or disulfiram (120 nM) combined with enzalutamide (10 μM) on the growth of enzalutamide-resistant cells. Cells were pretreated overnight with medium containing or without the copper ion chelator TTM (2 μM) before drug treatment. Seven days after treatment with either single or combined drugs, cells grown on cell culture plates were fixed with methanol and stained with crystal violet. Data are shown as mean ± SD. ***p < 0.001 (Student's t-test).

[0073] Figure 16 Copper ionophores and enzalutamide synergistically induce destabilization of iron-sulfur cluster proteins. Western blot analysis examined the expression of the iron-sulfur cluster proteins FDX1 and LIAS in enzalutamide-resistant cells after 48 hours of treatment with copper ionophores (ELE or DSF) and / or ENZ. Vinculin was used as a reference protein. Quantification of protein expression abundance is shown in the figure. Data are shown as mean ± SEM. ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001 (Student's t-test).

[0074] Figure 17 Copper ionophores and enzalutamide synergistically inhibit the 3D spheroid formation of drug-resistant cells. Enzalutamide-resistant cell lines (C4-2B ENZR and LNCaP ENZR) cultured in Matrigel were treated with copper ionophores (5 nM ELE or 250 nM DSF) and ENZ (20 μM) alone or in combination for 10 days. Images were taken using an inverted microscope. Representative images from each treatment group are shown. Spheroid integrity was analyzed, and the percentage of intact, partially disintegrated, and completely disintegrated spheroids in each group was shown. Scale bar, 200 μm. DETAILED DESCRIPTION

[0075] The present invention will be further described below with reference to specific embodiments. The specific embodiments are intended only to explain the present invention and are not to be construed as limiting the present invention. Those skilled in the art will appreciate that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and intent of the present invention. The scope of the present invention is defined by the claims and their equivalents.

[0076] The drugs, reagents, and raw materials used in the present invention are readily available to those skilled in the art and, unless otherwise specified, can be obtained from commercial sources. Experimental methods not specifying specific conditions in the present invention are generally carried out under conventional conditions or conditions recommended by the manufacturer. In particular, the following examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention in any way.

[0077] Example 1 Enzalutamide and copper ionophore synergistically inhibit the growth of castration-resistant prostate cancer cells

[0078] 1. Experimental Materials

[0079] Enzalutamide (ENZ, MCE, HY-70002), ilisimol (ELE, MCE, HY-12040), disulfiram (DSF, MCE, HY-B0240), copper ion chelator tetrathiomolybdate TTM (Sigma-Aldrich, 323446), prostate cancer cell line 22Rv1 were purchased from Kebai Biotechnology Co., Ltd., and prostate cancer cell line C4-2B was purchased from Kebai Biotechnology Co., Ltd.

[0080] 2. Experimental methods

[0081] (1) Cell activity detection experiment

[0082] The cell viability of AR-positive CRPC cell lines 22Rv1 and C4-2B was evaluated to assess the effects of the combined administration of copper ionophores (elisimox and disulfiram) and enzalutamide on cell growth and proliferation. The specific experimental method was as follows: cells in the logarithmic growth phase were digested. After terminating the digestion and obtaining a cell suspension, the cells were counted. Depending on the growth rate of the cell line, 800–4000 cells were plated per well of a 96-well plate. The 96-well plate was incubated overnight in a cell culture incubator. After the cells had fully adhered, fresh complete medium containing the corresponding drug was replaced. A DMSO control group was used. Fresh complete medium containing the drug was replaced every three days until the end of the experiment. After carefully removing the medium, a 0.5% crystal violet solution (soluble in methanol, which can fix cells) was added for staining for 10–30 minutes. After removing the crystal violet solution, the crystal violet not bound to the cells was washed with water, and the culture plate was air-dried. The dried culture plate was scanned and imaged. Then, 50% glacial acetic acid was used to dissolve the crystal violet stain bound to the cells, 100-200 μL was added to each well, and shaken on a shaker for 10-30 minutes. After all the stain was dissolved, the stain was analyzed using a multifunctional microplate reader (xMark TM ) The absorbance value (Optical Density, OD) at a wavelength of 570 nm was used to calculate the relative cell activity after drug treatment compared with the control group. The calculation formula is: relative cell activity % = (OD value 药物治疗组 -OD value 空白组 ) / (OD value 对照组 -OD value 空白组 )×100%.

[0083] (2) Clone formation experiment

[0084] A colony formation assay was performed to investigate the effects of combined ENZ / ELE and ENZ / DSF therapy on the growth of CRPC cell lines. Furthermore, the effects of combined ENZ / ELE and ENZ / DSF therapy on the growth of CRPC cell lines in the presence of the copper ion chelator TTM were investigated. The specific experimental methods were as follows: cells in the logarithmic growth phase were digested. After digestion was terminated and a cell suspension was obtained, the cells were counted. Depending on the growth rate of the cell line, 3,000 to 20,000 cells were plated per well of a 24-well plate. The 24-well plates were cultured overnight in a cell culture incubator. After the cells had fully adhered, fresh complete medium containing the corresponding drug was replaced. A DMSO control group was used. Fresh complete medium containing the drug was replaced every three days until the end of the experiment. After carefully removing the medium, the cells were stained with a 0.5% crystal violet solution (dissolved in methanol to fix the cells) for 10-30 minutes. After removing the crystal violet solution, the cells were washed with water to remove any crystal violet not bound to the cells, and the culture plates were air-dried. The dried plates were scanned and images were saved. Then, 50% glacial acetic acid was used to dissolve the crystal violet stain bound to the cells, 500 μL was added to each well, and shaken on a shaker for 10-30 minutes. After complete dissolution, the stain was analyzed by a multifunctional microplate reader (xMark TM ) Detection of OD value at a wavelength of 570 nm was used to quantify cell activity in clone formation experiments.

[0085] (3) 3D Matrigel Spheroidization Experiment

[0086] A 3D Matrigel spheroid assay was used to evaluate the response of 22Rv1 and C4-2B cells to treatment with a copper ionophore combined with ENZ. The assay was performed as follows: Matrigel was removed from a -20°C freezer and placed in a 4°C refrigerator to allow the Matrigel to solidify. Matrigel was mixed with basal culture medium at a 1:1 ratio, and 80 μL of this mixture was added to each well of a 96-well plate. The plate was then incubated in a cell culture incubator for 30 minutes to allow the Matrigel to solidify. All Matrigel manipulations should be performed on ice to prevent solidification. Cells in the logarithmic growth phase were digested. After digestion was terminated and a cell suspension was obtained, the cells were counted and plated at a density of 2,000–4,000 cells / well in a 96-well plate. 100 μL of culture medium consisting of 96% basal culture medium, 2% FBS, and 2% Matrigel was added to each well, avoiding the formation of air bubbles. After plating the cells, the culture plate was placed in a cell culture incubator. After the cells grew into spheres, the medium was replaced with culture medium containing the specified drugs. Fresh culture medium containing drugs was replaced every 2 days. After about 10 days, images were taken using an inverted phase contrast microscope and the spheroids were classified into three categories based on their 3D structural integrity: intact, semi-disintegrated, and completely disintegrated. More than 200 spheroids were classified for each condition.

[0087] 3. Experimental results

[0088] The results showed that ELE, DSF and ENZ alone could inhibit the growth of CRPC cell lines to a certain extent, and the combined treatment of ENZ / ELE and ENZ / DSF significantly inhibited the growth of CRPC cell lines, with the combined drug index being less than 1.0 ( Figure 1 ), among which, the concentration ratio of ENZ and ELE was (2.5μM-80μM): (1.25nM-200nM), and the concentration ratio of ENZ and DSF was (1.88μM-80μM): (18.83nM-800nM), indicating that copper ion carriers and ENZ synergistically inhibited the growth of CRPC cell lines. The results of the clone formation experiment showed that the combination of ENZ / ELE and ENZ / DSF significantly inhibited the growth of CRPC cell lines compared with the monotherapy group and the control group ( Figure 2 ), and under the action of the copper ion chelator TTM, the cell growth inhibitory effects of ENZ / ELE and ENZ / DSF combined treatment were reversed ( Figure 2 ), indicating that copper ion accumulation mediates the cytostatic effect of the combined copper ionophore and ENZ. 3D Matrigel spheroidization assay results showed that compared with the monotherapy groups, the combined treatment of copper ionophore and enzalutamide led to a significant disintegration of spheroids formed in 3D Matrigel by the two CRPC cell lines, 22Rv1 and C4-2B ( Figure 3 ).

[0089] Example 2 Enzalutamide and copper ionophore synergistically induce copper death

[0090] 1. Experimental Materials

[0091] Apoptosis inhibitor (Z-VAD-FMK, Z-Vad) (MCE, HY-16658B), ferroptosis inhibitor (Ferrostatin-1, Fer-1) (MCE, HY-100579), necroptosis inhibitor (Necrostatin-1, Nec-1) (MCE, HY-15760), oxidative stress inhibitor (N-acetylcysteine, NAC) (Sigma-aldrich, A9165).

[0092] 2. Experimental methods

[0093] 22Rv1 and C4-2B cells were pretreated with other cell death inhibitors (including Z-Vad, Fer-1, Nec-1, NAC and TTM) to explore the form of CRPC cell death induced by copper ion carriers combined with ENZ. The specific experimental method is as follows: 22Rv1 and C4-2B cells were pretreated overnight with 30μM apoptosis inhibitor Z-VAD-FMK (Z-Vad), 10μM ferroptosis inhibitor Ferrostatin-1 (Fer-1), 20μM necroptosis inhibitor Necrostatin-1 (Nec-1), 20μM copper ion chelator TTM and 2mM oxidative stress inhibitor N-acetylcysteine ​​(NAC), and then the viability of 22Rv1 and C4-2B cells was continuously treated with enzalutamide and / or ilisimol or disulfiram for 5 days.

[0094] Western blot experiments were used to study the effects of ENZ / ELE and ENZ / DSF combination treatment on the expression levels of iron-sulfur cluster proteins: Ferrodoxin 1 (FDX1) and lipoic acid synthetase (LIAS) in cells. The specific experimental method is as follows: after washing the gel plate and letting it dry, select a separation gel of appropriate concentration according to the molecular weight of the target protein. If the protein molecular weight is large, a separation gel with a small concentration should be selected; prepare the lower separation gel according to the formula, add about 7μL of separation gel to each gel plate, add 1μL of anhydrous ethanol to flatten it, and after about 40-50 minutes, wait for the separation gel to completely solidify, discard the anhydrous ethanol, and let it dry; prepare the upper concentrated gel according to the formula, prepare about 5μL for each gel plate, add the concentrated gel to the gel plate, insert the electrophoresis comb, and after about 40-50 minutes, the concentrated gel will completely solidify; fix the gel plate and place it in the electrophoresis tank, pour in the electrophoresis buffer, completely cover the sample wells, remove the electrophoresis comb, add the denatured protein samples to the sample wells in turn, use a voltage of 80V, adjust the voltage to 120V after about half an hour of electrophoresis, and stop electrophoresis after the proteins are completely separated. Transfer: Pre-cool the transfer buffer in a 4°C refrigerator. After SDS-PAGE electrophoresis, remove the concentrated gel and soak the separation gel in pre-cooled transfer buffer. Then soak the cut nitrocellulose membrane (NC membrane) in transfer buffer. Install the transfer plate in the order of negative electrode (black), sponge, thick filter paper, thin filter paper, separation gel, NC membrane, thin filter paper, thick filter paper, sponge, and positive electrode (transparent plate). After installation, place it in the transfer tank and pour in pre-cooled transfer buffer. Transfer the membrane at 120V for 120 minutes. Blocking: Dissolve 5% skim milk powder in PBS as blocking solution. The transferred NC membrane was immersed in blocking solution and blocked at room temperature for one hour; primary antibody incubation: the NC membrane was washed twice with PBS, cut according to the molecular weight of the target protein and placed in an antibody incubation box, diluted antibodies were added, and incubated on a shaker in a 4°C refrigerator overnight; secondary antibody incubation: the NC membrane was washed three times with PBST solution on a shaker at room temperature, each time for 10 minutes, and then the fluorescent secondary antibody was added and incubated on a shaker at room temperature for 1 hour; development: the NC membrane was washed three times with PBST solution on a shaker at room temperature, each time for 10 minutes, and then the NC membrane was scanned and imaged using a scanning imaging system (Odyssey).

[0095] Dihydrolipoamide transacetylase (DLAT), as a protein target for acylation, is involved in mediating the entry of carbon into the tricarboxylic acid cycle. Copper ions will form aggregates with acylated DLAT. Immunofluorescence experiments were further used to study whether DLAT protein aggregation occurred in the ENZ / ELE and ENZ / DSF combination treatment groups. The specific experimental method is as follows: prepare a cell suspension, plate a cell slide in a 12 / 24-well plate, and plate 5,000 cells per well; replace the medium with complete medium containing the designated drug. After drug treatment for a period of time, aspirate the medium, wash with PBS, add 4% paraformaldehyde, and fix at room temperature for 15 minutes; wash with PBS three times, 5 minutes each time, permeabilize the membrane with 0.2% Triton-X 100 for 15 minutes; wash with PBS three times, 5 minutes each time, and block with 5% BSA blocking solution at room temperature for 1 hour; add primary antibody and incubate at 4°C overnight; recover the primary antibody, wash with PBS three times, 5 minutes each time, add fluorescent secondary antibody, and incubate at room temperature in the dark for 1 hour; add DAPI staining solution and incubate in the dark for 15 minutes; wash with PBS three times, 5 minutes each time, prepare slides, add antifade agent, and invert the slides; photograph using an upright fluorescence microscope.

[0096] FDX1 catalyzes the reduction of Cu(II) to Cu(I) in mitochondria and serves as a direct target of the copper ionophore ELE. We investigated whether knocking down FDX1 expression by siRNA (sense strand: GGACAAUAUGACUGUUCGATT (SEQ ID NO: 1)) could reverse ENZ / ELE-induced cell death. The antisense strand of the FDX1 siRNA was UCGAACAGUCAUAUUGUCCAU (SEQ ID NO: 2).

[0097] 3. Experimental results

[0098] To investigate the cell death mode induced by copper ionophore combined with ENZ, 22Rv1 and C4-2B cells were pretreated with other cell death inhibitors, including Z-Vad, Fer-1, Nec-1, NAC and TTM. It was found that except for TTM, other cell death inhibitors failed to reverse the cell death induced by copper ionophore combined with ENZ ( Figure 4), indicating that copper ionophores synergistically induced copper-dependent cell death in prostate cancer cells with enzalutamide. Although the reactive oxygen species (ROS) inhibitor NAC failed to rescue ENZ / ELE-treated cells, indicating that a ROS-independent mechanism may exist, NAC partially reversed the growth inhibition of ENZ / DSF, suggesting that ROS may be involved in the cell death induced by this combination. Studies have shown that copper ionophores cause the instability of iron-sulfur cluster proteins. Western blot experiments found that the levels of iron-sulfur cluster proteins: FDX1 and LIAS were significantly decreased in the ENZ / ELE and ENZ / DSF combination treatment groups compared with the control group ( Figure 5 AB), indicating that the combination of copper ion carriers and ENZ will cause instability in the level of cellular iron-sulfur cluster proteins. Further immunofluorescence experiments found that DLAT protein aggregation occurred in both the ENZ / ELE and ENZ / DSF combination treatment groups, and DLAT aggregation was more obvious in the ENZ / ELE group than in the ENZ / DSF group ( Figure 5 C). Knockdown of FDX1 expression by siRNA ( Figure 6 A), partially reversed ENZ / ELE-induced cell death ( Figure 6 B), but could not restore ENZ / DSF-induced cell death ( Figure 6 C). This suggests that the two copper ionophores have different mechanisms of copper death. These results suggest that the combination of copper ionophores and enzalutamide induces copper death in castration-resistant prostate cancer cells.

[0099] Example 3: Synergistic Treatment of CRPC Cell Line 22Rv1 Mouse Xenograft Tumor Model with Enzalutamide and Copper Ionophore 1. Experimental Methods

[0100] In in vitro cell experiments, ENZ treatment caused CRPC cells to rely on oxidative phosphorylation, thereby enhancing the sensitivity of cells to treatment with copper ion carriers (elisimol and disulfiram). Xenograft mouse models are the most commonly used preclinical models to evaluate the in vivo efficacy of drugs. In this example, a subcutaneous transplant tumor model of CRPC cell line 22Rv1 mice was established and treated in groups. Tumor volume, tumor weight, and tumor burden were analyzed.

[0101] Immunohistochemical staining was further used to analyze the percentage of Ki67-positive cells, a tumor cell proliferation indicator, and the level of the iron-sulfur cluster protein LIAS in tumor cells in the ENZ / ELE combination group, the ENZ / DSF combination group, and each single-drug treatment group.

[0102] 2. Experimental results

[0103] The results showed that the ELE monotherapy group and the DSF monotherapy group were able to inhibit tumor growth compared with the control group, but still showed a significant growth trend. The ENZ / ELE combination and the ENZ / DSF combination both significantly inhibited tumor growth. The ENZ / ELE combination showed a stronger tumor growth inhibition than the ENZ / DSF combination ( Figure 7 AC), and some tumors regressed ( Figure 7 D).

[0104] Immunohistochemical staining revealed that the percentage of Ki67-positive cells in the ENZ / ELE and ENZ / DSF combination groups was significantly lower than that in the single-drug treatment groups; and the iron-sulfur cluster protein LIAS level in the tumor cells in the combination groups was significantly decreased compared with the control group ( Figure 8 ), suggesting that the androgen receptor antagonist ENZ combined with copper ion carriers plays a therapeutic role by inducing copper cell death in vivo.

[0105] Example 4 Copper ionophore and enzalutamide have synergistic cytotoxicity against Pten p53-deficient mouse prostate organoids

[0106] 1. Experimental methods

[0107] Pten p53 double deletion (Pten - / - p53 - / - The organoid model derived from prostate epithelial cells is considered to be an aggressive prostate cancer model, consistent with the characteristics of late-stage prostate cancer. loxp / loxp p53 loxp / loxp Mouse prostate epithelial cell organoid model, and Pten was obtained through Cre virus infection and Nutlin 3a screening - / - p53 - / - Mouse prostate organoid model ( Figure 9 The organoid model was used to study the inhibitory effects of ENZ alone, ENZ / ELE or ENZ / DSF combination on the growth of the organoids.

[0108] To better explore the synergistic effect of the drug, this example evaluates the combined effect of copper ion carriers and ENZ in MPOd cells. The inhibitory effect of ENZ / ELE and ENZ / DSF combined treatment on the growth of MPOd cells was studied by clone formation experiments. The effect of ENZ / ELE and ENZ / DSF combined treatment on the protein expression levels of iron-sulfur cluster proteins FDX1 and LIAS in MPOd cells was studied by immunoblotting experiments. Whether the ENZ / ELE and ENZ / DSF combined treatment groups can cause dihydrolipoic acid transacetylase (DLAT) aggregation was further studied by immunofluorescence experiments. The experimental methods of specific clone formation experiments, immunoblotting experiments and immunofluorescence experiments are as described above.

[0109] 2. Experimental results

[0110] The results showed that ENZ alone inhibited the growth and proliferation of organoids, but the inhibitory effect of ENZ / ELE or ENZ / DSF combination groups was more significant ( Figure 10 A), indicating that the combination of ENZ and copper ion carriers enhanced the inhibitory effect. - / - p53 - / - Mouse prostate organoids), are more sensitive to the oxidative phosphorylation inhibitor IACS-010759 ( Figure 10 B) confirmed the dependence of MPOd cells on oxidative phosphorylation after AR inhibition. Compared with single-drug treatment, both ENZ / ELE and ENZ / DSF combination groups synergistically inhibited the growth of MPOd cells and the combination index was less than 1.0 ( Figure 10 CD), among which, the concentration ratio of ENZ and ELE is (1.25μM-40μM): (2nM-64nM), and the concentration ratio of ENZ and DSF is (1.25μM-40μM): (20nM-640nM), indicating that the combination of copper ion carrier and ENZ has a synergistic inhibitory effect on the growth of MPOd cells. Through clone formation experiments, it was found that the combined treatment of ENZ / ELE and ENZ / DSF significantly inhibited the growth of MPOd cells compared with the single drug group ( Figure 11 ), and the cell growth inhibitory effects of ENZ / ELE and ENZ / DSF combined treatment were reversed under the action of copper ion chelator TTM ( Figure 11 ), suggesting that the cell death induced by the combined treatment is copper-dependent. By immunoblotting experiments, it was observed that the protein levels of iron-sulfur cluster proteins FDX1 and LIAS were significantly reduced in MPOd cells treated with ENZ / ELE and ENZ / DSF combined drugs compared with the control group ( Figure 12A), suggesting that the combination of copper ion carriers and ENZ caused the instability of the iron-sulfur cluster protein level in MPOd cells. Further immunofluorescence experiments showed that DLAT aggregation was observed in the ENZ / ELE and ENZ / DSF combination treatment groups compared with the single drug group and the control group, and the DLAT aggregation in the ENZ / ELE group was more obvious than that in the ENZ / DSF group ( Figure 12 B). Taken together, these experimental results suggest that combined treatment with copper ionophores and ENZ induces copper death in organoids derived from Pten and p53 double-deficient prostate cancer epithelial cells. This further suggests that the combined use of these two drugs may provide a new strategy for the clinical treatment of Pten and p53 double-deficient prostate cancer (advanced prostate cancer).

[0111] Example 5 Enzalutamide and copper ionophore have synergistic cytotoxicity against enzalutamide-resistant prostate cancer cell lines

[0112] 1. Experimental Materials

[0113] Oxidative phosphorylation inhibitor IACS-010759 (MCE, HY-112037).

[0114] 2. Experimental methods

[0115] To better explore the mechanism of enzalutamide resistance in clinical prostate cancer patients, this application previously established ENZ-resistant (ENZR) models of C4-2B and LNCaP cell lines ( Figure 13 A) The sensitivity of resistant cells to IACS-010759 (oxidative phosphorylation inhibitor) in the presence of ENZ was investigated by measuring the sensitivity of resistant cells to IACS-010759 in the presence of ENZ.

[0116] The inhibitory effects of ENZ / ELE and ENZ / DSF combination therapy on prostate cancer cell growth were investigated using colony formation assays. Western blotting was used to investigate the effects of the combination therapy on the levels of the iron-sulfur cluster proteins FDX1 and LIAS in ENZ-resistant cells. A 3D Matrigel spheroidization assay was used to evaluate the effects of copper ionophore and ENZ combination therapy on two resistant cell lines, C4-2B ENZR and LNCaP ENZR. The specific Western blotting and 3D Matrigel spheroidization assays were performed as described previously.

[0117] 3. Experimental results

[0118] By testing the sensitivity of drug-resistant cells with or without ENZ treatment to IACS-010759 (oxidative phosphorylation inhibitor), it was found that in the presence of ENZ, the sensitivity of drug-resistant cells to IACS-010759 increased significantly, indicating that drug-resistant cells are more dependent on oxidative phosphorylation ( Figure 13B). It is speculated that ENZ-resistant cells may be sensitive to the combined treatment of copper ionophores and ENZ. CalcuSyn analysis found that the combination index CI values ​​were all less than 1.0. Among them, the concentration ratio of ENZ and ELE was (2.5μM-80μM): (2.5nM-80nM), and the concentration ratio of ENZ and DSF was (2.5μM-80μM): (25nM-800nM), indicating that copper ionophores and ENZ have a synergistic inhibitory effect on C4-2B ENZR and LNCaP ENZR cells ( Figure 14 ). The clone formation experiment also found that the combined treatment of ENZ / ELE and ENZ / DSF significantly inhibited cell growth compared with the single drug and control groups, and the copper ion chelator TTM could effectively reverse this synergistic effect ( Figure 15 ), indicating that the death induced by the combination drug is copper-dependent. Western blotting experiments showed that the combined treatment group led to a significant decrease in the levels of iron-sulfur cluster proteins FDX1 and LIAS in ENZ-resistant cells ( Figure 16 ), which is consistent with the phenotype of copper death in cells under the combination of ENZ / ELE and ENZ / DSF. Next, a 3D Matrigel spheroidization assay was used to evaluate the effects of the combined treatment of copper ionophores and ENZ on the two drug-resistant cell lines, C4-2B ENZR and LNCaP ENZR. The results showed that compared with the monotherapy groups, the combined treatment of copper ionophores and ENZ caused a large disintegration of the spheroids formed by the two ENZ-resistant cell lines in 3D Matrigel, almost completely destroying the spheroid growth ( Figure 17 These results indicate that ENZ-resistant cells are more dependent on oxidative phosphorylation under the action of ENZ, and that the combined treatment of copper ion carriers and ENZ has a synergistic inhibitory effect on resistant cells, indicating that this combination drug strategy has certain potential for the treatment of patients with ENZ resistance in clinical practice.

Claims

1. A combined pharmaceutical composition for treating and / or preventing prostate cancer or for treating and / or preventing enzalutamide-resistant prostate cancer, characterized in that: The combined pharmaceutical composition comprises enzalutamide and a copper ion carrier; The copper ion carrier is ilisimol or disulfiram; The prostate cancer is castration-resistant prostate cancer; The concentration ratio of enzalutamide to ilisimol is 2.5 μM:1.25 nM, 5 μM:2.5 nM, 10 μM:5 nM, 20 μM:10 nM, 40 μM:20 nM, 80 μM:40 nM, 2.5 μM:6.25 nM, 5 μM:12.5 nM, 10 μM:25 nM, 20 μM:50 nM, 40 μM:100 nM, 80 μM:200 nM, 1.25 μM:2 nM, 2.5 μM:4 nM, 5 μM:8 nM, 10 μM:16 nM, 20 μM:32 nM, 40 μM:64 nM, 20 μM:20 nM, 40 μM:40 nM or 80 μM:80 nM; The concentration ratio of enzalutamide and disulfiram is 20 μM:200 nM, 40 μM:400 nM, 80 μM:800 nM, 1.88 μM:18.83 nM, 3.75 μM:37.5 nM, 7.5 μM:75 nM, 15 μM:150 nM, 30 μM:300 nM, 60 μM:600 nM, 1.25 μM:20 nM, 10 μM:160 nM, 20 μM:320 nM, 40 μM:640 nM, 40 μM:400 nM or 80 μM:800 nM.

2. The combined pharmaceutical composition according to claim 1, characterized in that The combined pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

3. A pharmaceutical preparation for treating and / or preventing prostate cancer or for treating and / or preventing prostate cancer resistant to enzalutamide, characterized in that: The pharmaceutical preparation comprises the combined pharmaceutical composition according to claim 1 or 2; The prostate cancer is castration-resistant prostate cancer.

4. The pharmaceutical preparation according to claim 3, characterized in that The dosage form of the pharmaceutical preparation includes a dosage form for enteral administration or a dosage form for parenteral administration.

5. The pharmaceutical preparation according to claim 4, characterized in that The dosage forms for administration through the gastrointestinal tract include solutions, granules, tablets, capsules, suspensions, powders, effervescents or emulsions.

6. The pharmaceutical preparation according to claim 5, characterized in that The solution is in the form of drops, and the tablet is in the form of chewable tablets.

7. The pharmaceutical preparation according to claim 4, characterized in that The non-gastrointestinal administration dosage form includes an injection dosage form, a respiratory tract administration dosage form, a cavity administration dosage form, a mucosal administration dosage form or a skin administration dosage form.

8. Use of enzalutamide in combination with a copper ion carrier in the preparation of a medicament for treating and / or preventing prostate cancer or for treating and / or preventing prostate cancer resistant to enzalutamide; The copper ion carrier is ilisimol or disulfiram; The prostate cancer is castration-resistant prostate cancer; The concentration ratio of enzalutamide to ilisimol is 2.5 μM:1.25 nM, 5 μM:2.5 nM, 10 μM:5 nM, 20 μM:10 nM, 40 μM:20 nM, 80 μM:40 nM, 2.5 μM:6.25 nM, 5 μM:12.5 nM, 10 μM:25 nM, 20 μM:50 nM, 40 μM:100 nM, 80 μM:200 nM, 1.25 μM:2 nM, 2.5 μM:4 nM, 5 μM:8 nM, 10 μM:16 nM, 20 μM:32 nM, 40 μM:64 nM, 20 μM:20 nM, 40 μM:40 nM or 80 μM:80 nM; The concentration ratio of enzalutamide and disulfiram is 20 μM:200 nM, 40 μM:400 nM, 80 μM:800 nM, 1.88 μM:18.83 nM, 3.75 μM:37.5 nM, 7.5 μM:75 nM, 15 μM:150 nM, 30 μM:300 nM, 60 μM:600 nM, 1.25 μM:20 nM, 10 μM:160 nM, 20 μM:320 nM, 40 μM:640 nM, 40 μM:400 nM or 80 μM:800 nM.

9. The use according to claim 8, characterized in that The drug further comprises a pharmaceutically acceptable carrier.

10. A method for inhibiting the growth of prostate cancer cells or prostate cancer organoids and / or promoting apoptosis of prostate cancer cells or prostate cancer organoids in vitro for non-therapeutic purposes, characterized in that: The method comprises the following steps: treating target prostate cancer cells or prostate cancer organoids with the combined pharmaceutical composition of claim 1 or 2 or the pharmaceutical preparation of any one of claims 3 to 7; The prostate cancer is castration-resistant prostate cancer.

11. A method for inhibiting the growth of enzalutamide-resistant prostate cancer cells or prostate cancer organoids and / or promoting apoptosis of enzalutamide-resistant prostate cancer cells or prostate cancer organoids in vitro for non-therapeutic purposes, characterized in that: The method comprises the following steps: treating target prostate cancer cells or prostate cancer organoids that are resistant to enzalutamide with the combined pharmaceutical composition of claim 1 or 2 or the pharmaceutical preparation of any one of claims 3 to 7; The prostate cancer is castration-resistant prostate cancer.

12. Use of enzalutamide in combination with a copper ion carrier in the preparation of an agent for inhibiting the growth of prostate cancer cells or prostate cancer organoids and / or promoting apoptosis of prostate cancer cells or prostate cancer organoids for non-therapeutic purposes in vitro; The copper ion carrier is ilisimol or disulfiram; The prostate cancer is castration-resistant prostate cancer; The concentration ratio of enzalutamide to ilisimol is 2.5 μM:1.25 nM, 5 μM:2.5 nM, 10 μM:5 nM, 20 μM:10 nM, 40 μM:20 nM, 80 μM:40 nM, 2.5 μM:6.25 nM, 5 μM:12.5 nM, 10 μM:25 nM, 20 μM:50 nM, 40 μM:100 nM, 80 μM:200 nM, 1.25 μM:2 nM, 2.5 μM:4 nM, 5 μM:8 nM, 10 μM:16 nM, 20 μM:32 nM, 40 μM:64 nM, 20 μM:20 nM, 40 μM:40 nM or 80 μM:80 nM; The concentration ratio of enzalutamide and disulfiram is 20 μM:200 nM, 40 μM:400 nM, 80 μM:800 nM, 1.88 μM:18.83 nM, 3.75 μM:37.5 nM, 7.5 μM:75 nM, 15 μM:150 nM, 30 μM:300 nM, 60 μM:600 nM, 1.25 μM:20 nM, 10 μM:160 nM, 20 μM:320 nM, 40 μM:640 nM, 40 μM:400 nM or 80 μM:800 nM.

13. The use according to claim 12, characterized in that The prostate cancer cells or prostate cancer organoids include prostate cancer cells or prostate cancer organoids that are resistant to enzalutamide.

Images