Application of Arabidopsis PLD genes in plant cadmium tolerance and resistance

By overexpressing the Arabidopsis thaliana PLD gene in plants, the problem of insufficient cadmium resistance in plants was solved, and the cadmium resistance of plants was improved, providing a theoretical basis for cultivating cadmium-tolerant crops.

CN118460573BActive Publication Date: 2026-02-06SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410565916.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-09
Publication Date
2026-02-06
Estimated Expiration
2044-05-09

AI Technical Summary

Technical Problem

In the existing technology, plants are not resistant enough to cadmium, which leads to crop yield reduction and endangers human health through the food chain. The function of phospholipase Dζ2 under heavy metal cadmium stress is not clear.

Method used

By overexpressing the Arabidopsis thaliana PLD gene using genetic engineering techniques, an overexpression vector was constructed and transformed into plants. Homozygous lines with PLD gene overexpression were screened to improve the plant's resistance to cadmium.

Benefits of technology

It significantly improved the plant's resistance to cadmium, verified the application value of the PLD gene in cadmium resistance, and laid the foundation for cultivating cadmium-resistant and high-yielding crops.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118460573B_ABST
    Figure CN118460573B_ABST
Patent Text Reader

Abstract

The application of Arabidopsis PLD gene in plant cadmium tolerance resistance, through phenotype experiment found that the root length of mutant is shorter than wild type under cadmium treatment, the root length of overexpression strain is longer than wild type, indicating that PLD gene plays a role in plant cadmium tolerance resistance; It is confirmed that Arabidopsis PLD gene has potential application value in plant cadmium tolerance resistance, and provides theoretical basis and guiding value for cultivating cadmium-tolerant crop varieties by using Arabidopsis PLD gene.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular, the application of Arabidopsis PLD gene in plant cadmium tolerance resistance. BACKGROUND

[0002] With the development of science and technology and economy, the problem of soil heavy metal pollution is increasingly serious, which not only endangers food security but also harms human health through the food chain.

[0003] Compared with other heavy metals such as nickel, copper, lead, mercury and zinc, cadmium has strong chemical activity, large mobility, low toxic concentration and persistent toxicity in the environment, and is easy to endanger human health through the enrichment of food chain. At present, the main source of soil heavy metal cadmium pollution is human activities, such as urban waste disposal, smelting, mining, metal manufacturing and use of pesticides and fertilizers. In plants, the toxicity of cadmium reduces the absorption and transport of nutrients and water, increases oxidative damage, destroys normal metabolic processes, inhibits plant morphology and physiology, and ultimately leads to crop yield reduction and edible part cadmium content. Plant remediation technology has been widely recognized today, and the research and functional description of plant cadmium tolerance genes have great significance for expanding excellent gene resources.

[0004] Phospholipase is a key enzyme that catalyzes the initial step of phospholipid hydrolysis in plants, and phospholipase and its hydrolysis products play a functional role in plant growth and development and stress response. Phospholipase Dζ2 (PLDζ2) is one of the important members of Arabidopsis phospholipase D gene family, and whether phospholipase Dζ2 plays a functional role under heavy metal cadmium stress has not been studied. SUMMARY

[0005] In order to overcome the above-mentioned shortcomings of the prior art, the purpose of the present application is to provide the application of Arabidopsis PLD gene in plant cadmium tolerance resistance.

[0006] The present application overexpresses the PLD gene through genetic engineering technology, then obtains an overexpression vector, transforms the vector into a strain, and selects a PLD gene overexpression homozygous strain, thereby significantly improving the cadmium resistance of plants.

[0007] The application of Arabidopsis PLD gene in plant cadmium tolerance resistance, characterized in that the nucleotide sequence of the Arabidopsis PLD gene is shown in SEQ ID NO. 1, the nucleotide sequence of the Arabidopsis PLD gene is overexpressed in plants, and the plants are Arabidopsis.

[0008] According to the above scheme, the overexpression vector containing the Arabidopsis PLD gene is transformed into plants by inflorescence infection method to obtain plants with cadmium resistance.

[0009] According to the above scheme, the overexpression vector includes pFGC121-PLDzeta2, the pFGC121 plasmid is cut, the Arabidopsis PLD gene is amplified and gel-recovered and purified.

[0010] According to the above scheme, the overexpression vector includes pFGC121-PLDzeta2, the pFGC121 plasmid is cut, and the Arabidopsis PLD gene is connected to the UBQ10 promoter of the vector plasmid to obtain.

[0011] According to the above scheme, the amplification primers of the Arabidopsis PLD gene are as follows:

[0012] PLDzeta2-F: TTTTCTGATTAACAGGGATCCATGTCGACGGATAAATTACTACTTCC

[0013] PLDzeta2-R: CGTCTCTGACCCTGAGGATCCGTGGAAGACTTGAGGAGCAGTGT.

[0014] According to the above scheme, the expression level of the PLD gene is detected by a quantitative PCR experiment, and the primers used in the quantitative PCR experiment are (5'-3'):

[0015] PLDzeta2-qRT-F: GGCTACACAGCTTGGGGATT

[0016] PLDzeta2-qRT-R: ACTGTCTCTGACCGGCCTAT.

[0017] According to the above scheme, the root length inhibition of the plant overexpression homozygous line containing the Arabidopsis PLD gene under cadmium treatment is lower than that of the wild type.

[0018] Compared with the prior art, the beneficial effects of the present application are as follows: the present application overexpresses the PLD gene through genetic engineering technology, then obtains an overexpression vector, transforms the vector into a plant line, and obtains a PLD gene overexpression homozygous line through screening, thereby significantly improving the cadmium resistance of the plant. The present application confirms for the first time that the Arabidopsis PLD gene can improve the cadmium resistance of the plant, and in view of the application of the PLD gene in cadmium resistance, it can be considered that the gene has potential application value in improving the cadmium resistance of the plant. At the same time, the present application also lays a good theoretical and application foundation for cultivating cadmium-resistant and high-yield crop varieties by using the PLD gene. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 It is an expression detection diagram of the PLD gene overexpression homozygous line of the present application.

[0020] Figure 2 Wild type line Col-0, mutant line PLD ζ2-26 , PLD ζ2-13 Growth under Cd treatment.

[0021] Figure 3 Wild type line Col-0, mutant line PLD ζ2-26 , PLD ζ2-13 Root length change under Cd treatment.

[0022] Figure 4 Wild type line Col-0, PLDζ2 overexpression line PLD ζ2#OE-2 , PLD ζ2#OE-7 , PLD ζ2#OE-12 Growth under Cd treatment.

[0023] Figure 5 Wild type line Col-0, PLDζ2 overexpression line PLD ζ2#OE-2 , PLD ζ2#OE-7 , PLD ζ2#OE-12 Root length change under Cd treatment. DETAILED DESCRIPTION

[0024] The principles and features of the present application are described below in conjunction with the attached drawings and specific embodiments, which are presented only for the purpose of illustration and not for the purpose of limiting the scope of the present application.

[0025] It should be understood that the terms used in the present application merely describe particular embodiments and are not intended to limit the present application. In addition, for the numerical ranges in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is specifically disclosed. Each intermediate value within any stated value or stated range of values and any other stated value or intermediate value within the stated range are also included within the present application. The upper limit and the lower limit of these smaller ranges can be included or excluded independently from the range.

[0026] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, preferred methods and materials are described. The reagents not specifically described in detail in the present application are all conventional reagents, which can be obtained commercially; the methods not specifically described in detail are all conventional experimental methods, which can be known from the prior art.

[0027] In the present application, the term "gene" refers to a nucleic acid fragment that expresses a specific protein or functional RNA molecule, which can include regulatory sequences located before (5' non-coding regions) and after (3' non-coding regions) the coding sequence.

[0028] Cadmium (Cd) is a heavy metal that is harmful to all living things and widely exists in the environment. Cadmium has a half-life of up to 30 years and can accumulate in the human body to cause various diseases. Cadmium is a rare element, and single-element cadmium is slightly toxic, but cadmium in the form of compounds (of which, wurtzite is the most common) is highly toxic in nature. Cadmium is a transition metal with luster and good ductility, widely exists in the surrounding environment, is non-essential for plants and humans, and is one of the most toxic heavy metal elements in the environment. According to the report of WHO, the content of Cd in soil ranges from 0.07 to 1.1 mg kg-1. Because Cd is mobile in soil, it can be easily absorbed and transported by plant roots into biological organisms and accumulated in the edible parts of plants, and then enter the food chain to cause harm to the health of animals and humans, causing various human diseases; at the same time, due to its long half-life, it is easy to accumulate in the human body, and over a long period of time, it can cause organ disease in the human body, and even low concentration intake can cause kidney dysfunction; symptoms of poisoning range from mild proteinuria to obvious ostealgia disease, and long-term poisoning can also cause emphysema, gastrointestinal disease, anemia, and hypertension. Because cadmium can freely move in the phloem of plants, cadmium can accumulate in various parts of plants to produce toxic effects. Studies have shown that Cd 2+ can affect the mismatch repair system in plant cells, cause damage to DNA, and significantly increase the rate of chromosomal aberration. Cd 2+ has a toxic effect on plants, which manifests as root and stem growth retardation, increased root hair number, chlorosis and wilting of leaves, and reduced biomass of the entire aboveground part at the whole plant level; and manifests as inhibition of photosynthesis, respiration, and transpiration, and causes oxidative stress and damage to the membrane system in cells at the physiological and biochemical level.

[0029] The present application first studies and discloses a PLD gene, confirms that the Arabidopsis PLD gene can improve the cadmium resistance of plants, and in view of the application of the PLD gene in cadmium resistance, it can be considered that the gene has potential application value for improving the cadmium resistance of plants. At the same time, the present application also provides a method for breeding cadmium-tolerant and high-yield crop varieties by using the PLD gene.

[0030] As used herein, unless otherwise specified, the PLDζ2 refers to a polypeptide having the sequence of SEQ ID NO: 1 or its encoding gene, and also includes sequence variants having the same function as the PLDζ2 polypeptide. The encoding gene can be gDNA or cDNA, and can also contain a promoter. For example, the cDNA has the nucleotide sequence shown in SEQ ID NO: 1. The sequence of the encoding gene also includes sequences degenerate to the sequences provided in the present application.

[0031] The embodiments provide the encoding nucleotide sequence (CDS sequence) of the Arabidopsis PLD gene, which is shown in SEQ ID NO. 1.

[0032] Sequence information:

[0033] PLDζ2 cDNA sequence SEQ ID NO: 1:

[0034] Embodiment

[0035] Obtaining of Arabidopsis thaliana PLD gene overexpression lines:

[0036] (1) Constructing overexpression vector of PLDζ2 driven by constitutive expression promoter UBQ10 (UBQ10::PLDζ2): according to the CDS sequence of Arabidopsis thaliana PLD gene, design gene-specific primers, the sequences are as follows:

[0037] PLDζ2-F: TTTTCTGATTAACAGGGATCCATGTCGACGGATAAATTACTACTTCC (SEQ ID NO.2);

[0038] PLDζ2-R: CGTCTCTGACCCTGAGGATCCGTGGAAGACTTGAGGAGCAGTGT (SEQ ID NO.3);

[0039] Amplify PLD gene by PCR technology, and recycle the amplification product, use restriction endonuclease BamHI to cut pFGC121 plasmid, and clone PLD gene to pFGC121-GFP-HA vector to obtain pFGC121-PLDζ2-GFP-HA recombinant plasmid;

[0040] (2) Perform PCR sequencing confirmation on pFGC121-PLDζ2-GFP-HA recombinant plasmid;

[0041] (3) Transform overexpression vector pFGC121-PLDζ2 into Agrobacterium GV3101 competent cells, and then transform into Arabidopsis thaliana by inflorescence infection method to obtain PLD gene overexpression lines.

[0042] Screening of PLDζ2 transgenic positive homozygous lines:

[0043] (1) Take the seed of single plant of PLD gene overexpression lines after infection as T 0 generation;

[0044] (2) Culture T 0 generation seeds on medium containing herbicide (0.001% glufosinate ammonium), select green seedlings and culture in nutrient soil medium, and the seed of single plant is T 1 generation;

[0045] (3) Culture T 1 generation seeds on medium containing herbicide, select green seedlings of offspring: the green seedlings in the strain with a yellow seedling separation ratio of 3:1 are cultured in nutrient soil medium, and the seed of single plant is T 2 generation;

[0046] (4) The T2 generation seeds are cultured on the medium containing herbicide, and the progeny of all green seedlings are selected and planted in the nutrient soil medium, and the received seeds are the seeds of the homozygous transgenic line of the PLDζ2 gene overexpression, which are named as PLD ζ2#OE-2 、 PLD ζ2#OE-7 、 PLD ζ2#OE-12 .

[0047] RT-PCR detection:

[0048] The RT-PCR experiment is performed on the seeds of the PLD gene transgenic positive homozygous line, wherein the primers used in the RT-PCR experiment are (5'-3'):

[0049] PLDζ2-qRT-F: GGCTACACAGCTTGGGGATT (SEQ ID NO: 4)

[0050] PLDζ2-qRT-R: ACTGTCTCTGACCGGCCTAT (SEQ ID NO: 5)

[0051] The results show that (Fig. 2), the PLD gene in the overexpression homozygous line Figure 1 , PLD ζ2#OE-2 、 PLD ζ2#OE-7 、 PLD ζ2#OE-12 presents a high level of expression, and therefore the line is selected for subsequent research, and ** represents that the overexpression line has a very significant difference compared with the wild type (p<0.01).

[0052] In order to verify the relationship between Arabidopsis PLDζ2 and cadmium resistance, the functional analysis experiment of Arabidopsis PLDζ2 under cadmium treatment is performed:

[0053] 1. Preparation of medium

[0054] (1) Preparation of 1 / 2MS medium for plant tissue culture: weigh MS powder 2.37 g / L, sucrose 20 g / L, MES 0.5 g / L, dissolve in pure water and constant volume, adjust pH to 5.8, and add agar 8 g / L;

[0055] (2) Sterilization: 121℃, 20min high pressure sterilization;

[0056] (3) After the medium is sterilized, when the medium is cooled to 50-60℃, it is placed in the clean bench, and the 1 / 2MS medium containing cadmium is added with a cadmium chloride mother liquor with a concentration of 100 mM, so that the final concentration of cadmium in the medium is 75, 100 μM. Pour the medium into a 13 cm plastic square dish, about 50 mL per square dish. After the medium solidifies, it is sealed in a sterile bag for use.

[0057] 2. Source of experimental materials

[0058] The T-DNA insertion mutant used in this example PLD ζ2-26 (SALK_119084C) was purchased from Fuzhou Baiersente Technology Co., Ltd., and its T-DNA insertion site is the third intron in the PLD gene DNA sequence. Gene-edited mutant. PLD ζ2- 13 Purchased from Wuhan Boyuan Biotechnology Co., Ltd. The homozygous overexpressing strain was constructed and obtained by the inventor. PLD ζ2# OE-2 , PLD ζ2#OE-7 , PLD ζ2#OE-12 .

[0059] 3. Seed disinfection

[0060] Wild-type Arabidopsis thaliana (Col-0) with uniform size and plump seeds were selected from samples taken at the same time period. PLD ζ2 Seeds of mutants and PLDζ2 overexpression lines were placed in 1.5 mL centrifuge tubes, 1 mL of disinfectant (20% bleach + 0.1% Tween 20) was added, and the mixture was vortexed for 15 minutes. The tubes were then rinsed 5-8 times with sterile pure water in a laminar flow hood.

[0061] 4. Cadmium treatment and root length measurement

[0062] Sterilized seeds were spotted onto 1 / 2 MS medium containing 0, 75, and 100 μM Cd, with each treatment repeated four times. The plants were then chilled at 4°C for 3 days, followed by 16 h (light) / 8 h (dark) incubation. The mutant and overexpression lines were photographed and taproot lengths measured on days 19 and 10, respectively.

[0063] 5. Experimental Results

[0064] See Figure 2 and Figure 4 Under conditions without Cd treatment, wild-type and PLD ζ2 There was no significant difference in growth between mutant and overexpression lines. However, under Cd treatment, the root length of mutant lines was shorter than that of wild type, while the root length of PLD gene overexpression lines was significantly longer than that of wild type. These results indicate that loss of PLDζ2 function leads to decreased cadmium tolerance in Arabidopsis thaliana, while PLDζ2 overexpression enhances cadmium tolerance, meaning that PLDζ2 positively regulates cadmium tolerance.

[0065] As an alternative approach, the method for downregulating the expression of plant PLDζ2 may include: (1) transferring an interfering molecule that interferes with PLD gene expression into plant cells, tissues, organs, or seeds to obtain plant cells, tissues, organs, or seeds transformed with the interfering molecule; (2) regenerating plants from the plant cells, tissues, organs, or seeds transformed with the interfering molecule obtained in step (1). Preferably, the method further includes: (3) selecting plant cells, tissues, or organs transformed with the vector; and (4) regenerating plants from the plant cells, tissues, or organs in step (3).

[0066] The polynucleotide (gene) encoding the PLDζ2 polypeptide can be a natural gene from a plant or a degenerate sequence thereof.

[0067] Vectors containing the said coding sequence, and host cells genetically engineered using the said vector or polypeptide coding sequence, are also included in this invention. Methods well known to those skilled in the art can be used to construct suitable expression vectors.

[0068] The main function of this invention is to overexpress the PLD gene using genetic engineering techniques, obtain an overexpression vector, transform this vector into plant lines, and screen to obtain homozygous PLD gene overexpression lines, thereby significantly improving the plant's cadmium resistance. This invention is the first to experimentally confirm that the Arabidopsis PLD gene can improve cadmium resistance in plants. Given the application of the PLD gene in cadmium resistance, it can be considered that this gene has potential application value in improving plant cadmium resistance. Furthermore, this invention lays a solid theoretical and applied foundation for using the PLD gene to cultivate cadmium-tolerant, high-yielding crop varieties.

[0069] In summary, after reading this invention document, those skilled in the art can make various other corresponding modifications to the technical solutions and concepts based on this invention without creative mental effort, and all of these modifications fall within the scope of protection of this invention.

[0070] sequence list

[0071] South China Agricultural University

[0072] Application of Arabidopsis thaliana PLD gene in cadmium resistance in plants 1 3141

[0075] DNA

[0076] Arabidopsis thaliana 1

[0078] ATGTCGACGGATAAATTACTACTTCCTAACGGCGTTAAGTCAGACGGAGTCATCAGAATGACCAGAGCTG

[0079] ATGCTGCGGCGGCGGCAGCTTCTTCTTCTCTCGGCGGTGGAAGTCAAATATTCGACGAGCTTCCCAAGGC

[0080] TGCGATCGTCTCGGTCTCGAGACCTGACACCACCGATTTTAGTCCCTTGCTTCTTTCTTACACCTTGGAG

[0081] CTTCAGTATAAACAGTTCAAGTGGACATTACAAAAGAAGGCTTCTCAAGTTCTGTACTTACATTTTGCGT

[0082] TGAAGAAACGTTTGATCATTGAAGAACTTCACGACAAGCAAGAACAGGTTAGAGAGTGGCTACACAGCTT

[0083] GGGGATTTTTGATATGCAAGGATCAGTTGTGCAAGATGATGAAGAACCTGACGATGGTGCTCTTCCTCTG

[0084] CACTATACTGAAGATAGTATCAAGAACAGGAATGTTCCTTCCCGTGCAGCGCTTCCAATCATTCGTCCAA

[0085] CGATAGGCCGGTCAGAGACAGTTGTAGATCGTGGGAGAACCGCAATGCAAGGCTACTTGAGTCTCTTTCT

[0086] AGGGAACTTGGACATTGTAAACTCCAAAGAGGTCTGCAAGTTCCTAGAAGTTTCTAGACTCTCATTTGCT

[0087] AGAGAGTACGGTTCCAAGATGAAAGAAGGGTATGTCACAGTGAAGCACTTGAGGGACGTCCCAGGTTCTG

[0088] ATGGTGTCCGATGCTGTCTTCCTACACACTGTCTCGGTTTCTTCGGAACTAGCTGGACAAAGGTTTGGGC

[0089] GGTTCTGAAACCAGGATTTTTGGCGTTACTAGAAGATCCATTCAGCGGAAAGCTTCTAGATATAATGGTG

[0090] TTCGACACATTGGGGTTGCAAGGTACTAAAGAGTCTTCTGAACAACCGCGTTTGGCTGAACAGGTGAAGG

[0091] AACACAACCCATTGCGTTTTGGCTTTAAAGTTACTAGTGGGGACCGAACCGTGAGGCTGAGAACAACGAG

[0092] CAGCAGGAAAGTTAAAGAGTGGGTTAAGGCCGTGGACGAAGCTGGTTGTTACAGTCCACATCGGTTTGGT

[0093] TCGTTTGCACCACCTAGAGGCTTGACATCGGACGGAAGCCAGGCACAGTGGTTCGTAGACGGTCACACTG

[0094] CGTTTGAAGCTATCGCGTTTGCAATCCAAAACGCAACATCAGAGATATTTATGACTGGTTGGTGGTTATG

[0095] TCCGGAGCTATATCTCAAACGCCCCTTTGAAGATCATCCATCATTGCGGCTCGATGCATTGCTGGAGACA

[0096] AAAGCAAAACAGGGCGTTAAGATATATATTCTTCTGTATAAGGAAGTCCAAATCGCGCTGAAAATCAACA

[0097] GCTTGTACAGCAAGAAACGGCTTCAAAACATTCACAAGAACGTCAAAGTTCTTCGTTATCCAGACCATCT

[0098] TCTTCTGCCTCACCGCCCCAAGAAATCCCTTTGCTTCTCCCACAAGAAACCGATGCAGATTTCGCCGGCA

[0099] TCTTCTGCCTCACCGCCCCAAGAAATCCCTTTGCTTCTCCCACAAGAAACCGATGCAGATTTCGCCGGCA

[0100] TCTTCTGCCTCACCGCCCCAAGAAATCCCTTTGCTTCTCCCACAAGAAACCGATGCAGATTTCGCCGGCA

[0101] TCTTCTGCCTCACCGCCCCAAGAAATCCCTTTGCTTCTCCCACAAGAAACCGATGCAGATTTCGCCGGCA

[0102] TCTTCTGCCTCACCGCCCCAAGAAATCCCTTTGCTTCTCCCACAAGAAACCGATGCAGATTTCGCCGGCA

[0103] TCTTCTGCCTCACCGCCCCAAGAAATCCCTTTGCTTCTCCCACAAGAAACCGATGCAGATTTCGCCGGCA

[0104] TCTTCTGCCTCACCGCCCCAAGAAATCCCTTTGCTTCTCCCACAAGAAACCGATGCAGATTTCGCCGGCA

[0105] TCTTCTGCCTCACCGCCCCAAGAAATCCCTTTGCTTCTCCCACAAGAAACCGATGCAGATTTCGCCGGCA

[0106] TCTTCTGCCTCACCGCCCCAAGAAATCCCTTTGCTTCTCCCACAAGAAACCGATGCAGATTTCGCCGGCA

[0107] TCTTCTGCCTCACCGCCCCAAGAAATCCCTTTGCTTCTCCCACAAGAAACCGATGCAGATTTCGCCGGCA

[0108] GTTAGCCAATGGTCTGCTGGGACGAGCCAGCCTGAAGATAGCATTCATAGAGCTTATTGTTCGCTTATCC

[0109] AGAACGCTGAACATTTTATCTACATAGAGAACCAATTCTTCATCTCCGGGCTAGAAAAAGAGGACACGAT

[0110] CCTAAACCGCGTTCTAGAAGCGTTATACAGACGCATTCTGAAGGCTCATGAAGAGAACAAGTGCTTCCGC

[0111] GTTGTGATCGTTATTCCGCTACTCCCTGGATTTCAGGGAGGTATTGATGACTTCGGAGCAGCCACGGTTC

[0112] GAGCACTGATGCATTGGCAATACCGTACGATCTCTAGAGAAGGAACTTCGATTCTTGACAACCTTAACGC

[0113] TTTGCTCGGTCCCAAGACGCAAGATTACATCTCTTTCTATGGTTTGAGATCGTACGGACGGCTGTTTGAG

[0114] GACGGTCCAATTGCCACTAGCCAGATTTACGTGCATAGCAAGTTAATGATTGTTGATGACCGGATCGCAG

[0115] TGATCGGATCTTCTAATATAAACGATAGGAGCTTACTAGGTTCACGAGACTCTGAGATCGGTGTTGTGAT

[0116] TGAAGACAAAGAATTCGTGGAATCTTCGATGAACGGAATGAAGTGGATGGCCGGGAAGTTCTCTTACAGT

[0117] CTTAGATGTTCCTTGTGGTCAGAGCATCTCGGCCTTCACGCCGGAGAGATTCAGAAGATCGAAGATCCAA

[0118] TCAAAGATGCAACATACAAAGACTTATGGATGGCAACAGCTAAGAAAAACACGGACATCTACAACCAAGT

[0119] CTTCTCGTGCATCCCGAATGAACATATACGCTCAAGAGCTGCATTGAGACACAATATGGCTCTTTGTAAA

[0120] GACAAGTTGGGTCACACTACGATCGACCTTGGCATTGCACCGGAGAGGCTAGAATCATGCGGCAGCGACT

[0121] CGTGGGAGATTCTGAAGGAGACAAGAGGGAACCTTGTGTGCTTCCCATTACAGTTCATGTGTGATCAAGA

[0122] AGATCTCAGACCAGGTTTCAACGAATCTGAGTTCTACACTGCTCCTCAAGTCTTCCACTAA 3141 2 47

[0125] DNA

[0126] Artificial Sequence 2

[0128] TTTTCTGATTAACAGGGATCCATGTCGACGGATAAATTACTACTTCC 47 3 44

[0131] DNA

[0132] Artificial Sequence 3

[0134] CGTCTCTGACCCTGAGGATCCGTGGAAGACTTGAGGAGCAGTGT 44 4 20

[0137] DNA

[0138] Artificial Sequence 4

[0140] GGCTACACAGCTTGGGGATT 20 5 2

[0143] DNA

[0144] Artificial Sequence 5

[0146] ACTGTCTCTGACCGGCCTAT 20

Claims

1. Use of Arabidopsis PLD genes in plant resistance to cadmium, characterized in that, The nucleotide sequence of the Arabidopsis PLD gene is shown as SEQ ID NO. 1, the nucleotide sequence of the Arabidopsis PLD gene is overexpressed in plants, and the plants are Arabidopsis.

2. The use of Arabidopsis PLD genes in plant cadmium tolerance resistance according to claim 1, characterized in that, The overexpression vector containing the Arabidopsis PLD gene is transformed into plants by inflorescence infection method to obtain plants with cadmium resistance.

3. The use of Arabidopsis PLD genes in plant cadmium tolerance resistance according to claim 2, characterized in that, The overexpression vector includes pFGC121-PLD, and after the pFGC121 plasmid is cut, the Arabidopsis PLD gene is connected to the UBQ10 promoter of the vector plasmid to obtain.

4. The use of Arabidopsis PLD genes in plant cadmium tolerance resistance according to claim 3, characterized in that, The amplification primer of the Arabidopsis PLD gene is: PLD-F: TTTTCTGATTAACAGGGATCCATGTCGACGGATAAATTACTACTTCC PLD-R: CGTCTCTGACCCTGAGGATCCGTGGAAGACTTGAGGAGCAGTGT.

Citation Information

Patent Citations

  • Gene for regulating sensibility of plants to auxin and uses thereof

    CN101173257A

  • Arabidopsis thaliana phospholipase C gene and application thereof in improvement of heat resistance of crops

    CN102121022A