A linked marker of wheat powdery mildew resistance gene and application thereof

Abstract

The application discloses a wheat powdery mildew resistance gene linkage marker and application thereof, and belongs to the technical field of plant genetics and crop molecular breeding. A wheat powdery mildew resistance gene named PmSYH is located from a local wheat variety resource Siyuehuang in Shanxi province, and two closely linked molecular markers Sxau7DS-37 and Sxau7DS-48 are obtained. The two molecular markers are both co-dominant SSR markers, can accurately identify the presence or absence of the PmSYH gene in wheat materials and predict the powdery mildew resistance, so that the wheat powdery mildew resistance gene PmSYH can be effectively detected in wheat molecular marker assisted breeding.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of plant genetics and crop molecular breeding technology, and more particularly to a wheat powdery mildew resistance gene linked marker and application thereof. BACKGROUND

[0002] Wheat (Triticum aestivum L.) is one of the main food crops for human beings. As the main organ of photosynthesis, leaves provide 95% of the energy for the growth and development of wheat, playing a crucial role in the formation of wheat yield. Blumeria graminis f. sp. Tritici (Bgt) is a specific biotrophic fungus that can rapidly form a layer of white powdery spore on the surface of wheat leaves after infection. This not only blocks sunlight and affects the normal photosynthesis of leaves, but also absorbs water and nutrients from leaves, damages cell structure, leading to premature leaf senescence or death, and seriously affecting the growth and development of wheat. Powdery mildew caused by Bgt is one of the most important diseases in wheat production, and occurs in all wheat planting areas. When the disease is severe, it can reduce wheat yield by more than 30%. In recent years, most varieties in wheat production are not resistant to powdery mildew or have poor resistance, which seriously affects the high yield and stable yield of wheat. Due to the long-term and excessive use of sterol demethylation inhibitor fungicides such as triazoles in production to control powdery mildew, the resistance of powdery mildew population to fungicides has rapidly increased, and the accumulation of azole fungicides in soil, water and organisms has also been serious, which seriously affects the safety of the ecological environment.

[0003] Promoting and planting disease-resistant varieties is an effective measure to prevent and control wheat powdery mildew, which is not only environmentally friendly, but also can save input costs and increase planting income. Using disease-resistant genes can effectively improve the resistance of wheat to powdery mildew. Pm2, Pm4, Pm6, Pm8, Pm21, Pm24 and other powdery mildew resistance genes have been widely used to cultivate a large number of excellent disease-resistant new varieties, effectively resisting the invasion of powdery mildew. However, due to the rapid evolution of wheat powdery mildew pathogenic strains, disease-resistant genes are easily overcome by newly emerging powdery mildew strains during promotion, leading to reduced resistance or loss of resistance, becoming ineffective genes. It has been reported that Pm1a, Pm2, Pm3a, Pm3b, Pm3f, Pm4a, Pm6, Pm8 and Pm17 have lost resistance in some areas of the United States, Australia, Egypt and other regions. In China, only a few major genes such as Pm2, Pm4, Pm12, Pm13, Pm21 and Pm52 have effective resistance in the promoted wheat varieties, among which Pm2 and Pm4 have lost resistance in some areas, and the resistance of Pm52 is also gradually decreasing.

[0004] Therefore, it is an urgent need for wheat breeding and utilization to identify disease-resistant germplasm from various wheat resources, continuously excavate new powdery mildew resistance genes and apply them to wheat cultivars to enrich the gene pool of wheat disease resistance genes to cope with the evolution of wheat powdery mildew strains. SUMMARY

[0005] Therefore, the application provides a wheat powdery mildew resistance gene linked marker and application thereof.

[0006] The application solves the problem of efficient utilization of the powdery mildew resistance gene PmSYH in wheat molecular marker-assisted breeding, and provides a linked molecular marker for accurately identifying whether a wheat offspring population to be tested contains the powdery mildew resistance gene PmSYH.

[0007] To achieve the above-mentioned purpose, the application adopts the following technical solutions.

[0008] The molecular marker linked to the wheat powdery mildew resistance gene is Sxau7DS-37 and Sxau7DS-48, and the genetic distance between the molecular marker and the wheat powdery mildew resistance gene is 1.8 cM and 3.1 cM, respectively, wherein the nucleotide sequence of Sxau7DS-37 is shown in SEQ ID NO:1, and the nucleotide sequence of Sxau7DS-48 is shown in SEQ ID NO:2.

[0009] caacacactcccctctcgttcctatgcatcaccatgatcttgtgtgtgtgtgtgtgcgtaggaaattttttgaaattac tacgttctccaacagatatgcatgagtagaacacaaagagttgtggg,SEQ ID NO:1.

[0010] tctctctttcttagtggggaacgacgttcgagggttcgtgagcgacagagagagggtgccgccgccgccgccc cggcgaacaaacacgatgtcttgctcctccggtgattcatcggcttctcgaggcggtgggctccgaaggagaggc,SEQ ID NO:2.

[0011] Further, the primer pair sequence of Sxau7DS-37 is shown in SEQ ID NO:3 and SEQ ID NO:4.

[0012] Sxau7DS-37-F: 5'-CAACACACTCCCCTCTCGTT-3', SEQ ID NO:3; Sxau7DS-37-R: 5'-GTTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT

[0013] Sxau7DS-37-R: 5'-CCCACAACTCTTTGTGTTCT-3', SEQ ID NO: 4.

[0014] Further, the primer pair sequence of Sxau7DS-48 is shown as SEQ ID NO: 5 and SEQ ID NO: 6.

[0015] Sxau7DS-48-F: 5'-TCTCTCTTTCTTAGTGGGGA-3', SEQ ID NO: 5;

[0016] Sxau7DS-48-R: 5'-GCCTCTCCTTCGGAGCCCAC-3', SEQ ID NO: 6.

[0017] The above-mentioned molecular marker is applied in wheat breeding / wheat powdery mildew resistance identification.

[0018] Further, the genomic DNA of the wheat plant is amplified by PCR, and when the 126bp band of the Sxau7DS-37 molecular marker appears, or when the 148bp band of the Sxau7DS-48 molecular marker appears, it indicates that the wheat powdery mildew resistance gene exists in the plant.

[0019] According to the technical solutions, compared with the prior art, the present application has the beneficial effects that: the present application locates a wheat powdery mildew resistance gene PmSYH from the local wheat variety resource SimaoHuang in Shanxi Province, and obtains two closely linked molecular markers Sxau7DS-37 and Sxau7DS-48. The two molecular markers are both co-dominant SSR markers, which can accurately identify the presence or absence of the PmSYH gene in the wheat material and predict the powdery mildew resistance, so as to effectively detect the wheat powdery mildew resistance gene PmSYH in the molecular marker assisted breeding of wheat. BRIEF DESCRIPTION OF DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments or the prior art description will be briefly introduced as follows. Obviously, the drawings in the following description are only embodiments of the present application, and those skilled in the art can obtain other drawings according to the provided drawings without creative labor.

[0021] Figure 1 The drawings are F 2:3The family is scanned by 90K SNP chip, wherein A represents the number of polymorphic markers on different chromosomes; B represents the number of polymorphic markers on the physical position of 7D chromosome;

[0022] Figure 2 The figure is a comparison between the genetic linkage map of the anti-powdery mildew gene PmSYH and the Chinese Spring physical map in the embodiment 1 of the present application, wherein A represents the genetic linkage map of PmSYH; B represents the Chinese Spring physical map;

[0023] Figure 3 The figure is the amplification result of the primer of the molecular marker Sxau7DS-37 on the F2 generation of anti- and susceptible-powdery mildew plants of SimiaoHuang, Jinmai 47 and SimiaoHuang x Jinmai 47 in the embodiment 2 of the present application, wherein M represents Marker; P1 represents the anti-disease parent (SimiaoHuang); P2 represents the susceptible-disease parent (Jinmai 47); R represents the anti-disease plant; S represents the susceptible-disease plant; the arrow represents the band of the molecular marker Sxau7DS-37 linked with the anti-disease gene PmSYH in the anti-disease parent and the anti-disease plant;

[0024] Figure 4 The figure is the amplification result of the primer of the molecular marker Sxau7DS-48 on the F2 generation of anti- and susceptible-powdery mildew plants of SimiaoHuang, Jinmai 47 and SimiaoHuang x Jinmai 47 in the embodiment 2 of the present application, wherein M represents Marker; P1 represents the anti-disease parent (SimiaoHuang); P2 represents the susceptible-disease parent (Jinmai 47); R represents the anti-disease plant; S represents the susceptible-disease plant; the arrow represents the band of the molecular marker Sxau7DS-48 linked with the anti-disease gene PmSYH in the anti-disease parent and the anti-disease plant. DETAILED DESCRIPTION

[0025] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by those skilled in the art without creative efforts belong to the scope of protection of the present application.

[0026] The required reagents in the present application are conventional experimental reagents, which are purchased from the market; the experimental methods not mentioned are conventional experimental methods, which will not be described here.

[0027] Embodiment 1

[0028] Wheat landraces are unique germplasm resources produced in long-term production, many of which have good resistance to powdery mildew. Twenty-four powdery mildew resistance genes or alleles have been discovered from these landraces. For example, powdery mildew resistance genes Pm5e and Pm24a were discovered from landraces Fugong 30 and Zidanyu. The powdery mildew resistance gene PmSYH identified in the present application was discovered in the landrace Simyuehuang in Shanxi Province. Artificial inoculation of the powdery mildew race E09 showed that Simyuehuang was immune or nearly immune to the powdery mildew race E09 and had excellent resistance to powdery mildew. Genetic analysis of the resistance showed that the resistance of Simyuehuang to powdery mildew was controlled by a dominant nuclear gene. In breeding practice, the use of the powdery mildew resistance gene PmSYH with better resistance can effectively improve the reliability and selection efficiency of gene selection in the process of variety breeding, thereby improving the resistance of newly bred wheat varieties to powdery mildew.

[0029] Specifically as follows:

[0030] The F1, F2, BC1F1 and F 2:3 families of the offspring produced by crossing and backcrossing the disease-resistant wheat parent Simyuehuang and the disease-susceptible wheat parent Jinmai 47 were used to construct a genetic mapping population.

[0031] Analysis of powdery mildew resistance at the seedling stage

[0032] The powdery mildew resistance of Simyuehuang, Jinmai 47, and the F1, F2, BC1F1 and F 2:3 families constructed from Simyuehuang and Jinmai 47 was identified in an artificial climate chamber using the wheat powdery mildew strain E09. The powdery mildew propagation, induction and control variety were Mingxian 169.

[0033] The experimental materials were sown in rectangular seedling trays with a size of 55 cm x 28 cm, each seedling tray having 72 independent holes with a size of 4.5 cm x 4.5 cm, and 10 seeds were sown in each hole. To ensure sufficient disease, 6 holes of the disease-susceptible control variety Mingxian 169 were sown in each seedling tray. The parents Simyuehuang and Jinmai 47 were sown adjacent to each other in two holes on each side of the seedling tray. The artificial climate chamber was set to a light and temperature cycle of 21℃ light for 14h and 16℃ darkness for 10h, a light intensity of 6000lx, and a relative humidity of 65% to 75%. About 10 days after sowing, when the first leaf of the plant was fully expanded, the seedlings of Mingxian 169 pre-cultured with a large number of fresh powdery mildew E09 spores were used to inoculate all the materials to be identified by shaking off the spores, and the inoculated materials were further cultured under the above conditions for 10 to 15 days. When the first leaf of Mingxian 169 in the seedling tray was covered with spores, the resistance of the experimental materials was investigated. According to the 0 to 4 grade standard, the resistance of all plants was recorded.

[0034] Wherein:

[0035] 0 is immune, no spore or necrotic spot on leaf;

[0036] 0; is near immune, no spore on leaf, with necrotic spot;

[0037] 1 is high resistance, with a small amount of spore or aerial mycelium on leaf;

[0038] 2 is moderate resistance, with a small amount of spore pile on leaf, the diameter of colony is less than 1mm;

[0039] 3 is moderate susceptible, with more mycelium and spore pile on leaf, the diameter of colony is more than 1mm;

[0040] 4 is high susceptible, with a large amount of spore pile on leaf.

[0041] Wherein 0-2 levels belong to disease resistant type, 3-4 levels belong to disease susceptible type.

[0042] The results showed that S. yunnanensis was immune or near immune (0 or 0;) to E09, while Jinmai 47 was highly susceptible. All of the 169 F1 plants from the cross of Jinmai 47 x S. yunnanensis or the reverse cross of S. yunnanensis x Jinmai 147 were immune or near immune, which was consistent with the resistant phenotype of S. yunnanensis. In the BC1F1 population with Jinmai 47 as the recurrent parent, 59 plants were resistant and 60 plants were susceptible, which was consistent with the theoretical value of 1:1 (χ2=0.16, P=0.42) by chi-square test, indicating that the resistance gene carried by S. yunnanensis was a dominant nuclear gene. In the F2 population of Jinmai 47 x S. yunnanensis, 263 plants were resistant (0-2) and 89 plants were susceptible (3-4), which was consistent with the theoretical value of 3:1 (χ2=0.07, P=0.28) by chi-square test. 2 2

[0043] According to the above genetic analysis, the resistance of S. yunnanensis to powdery mildew is controlled by 1 pair of dominant nuclear genes, and its genetic mode is consistent with Mendelian inheritance, which is temporarily named as PmSYH.

[0044] Analysis of the location of the powdery mildew resistance gene PmSYH

[0045] Using bulked segregant analysis (BSA), 30 homozygous resistant families (response type 0 or 0;) and 30 homozygous susceptible families (response type 4) were selected from the F 2:3 Each family took equal amount of DNA and mixed respectively to establish resistant pool and susceptible pool, which were sent to Beijing Zhongyu Jinbi Company for 90K chip scanning.

[0046] The results showed that Figure 1 ​​A), 133 SNP markers were polymorphic between the resistant pool and the parents in the JMM47 x SYH population, of which 64 were located on chromosome 7D, accounting for 48.1% of the total, and there were certain distributions on the other 20 chromosomes, but the number was small, so it was speculated that PmSYH was more likely located on chromosome 7D.

[0047] By analyzing the distribution of polymorphic SNP markers on chromosome 7D, Figure 1 B), 25 markers were concentrated in the 110Mb-140Mb segment, and 10 markers were concentrated in the 570Mb-610Mb segment, and the other markers were distributed relatively dispersedly, so it was speculated that PmSYH was more likely located in the 110Mb-140Mb segment or the 570Mb-610Mb segment.

[0048] Development of molecular markers and linkage map

[0049] 1. The total DNA was extracted by the CTAB method.

[0050] 2. Molecular marker analysis: 95℃ pre-denaturation for 4min; 95℃ denaturation for 30s, 60℃ (or 55℃) recombination for 30s, 72℃ extension for 30s, a total of 34 cycles; 72℃ extension for 10min; 4℃ storage for standby. The amplification products were electrophoresed on 8% non-denaturing polyacrylamide gel at 220V for 40min, silver nitrate staining and marker typing.

[0051] 3. According to the Chinese Spring genome sequence IWGSC RefSeq v2.1, 63 markers were developed in the 110Mb-140Mb segment and 80 markers were developed in the 570Mb-610Mb segment. From the F2 population of JMM47 x SYH, 10 homozygous resistant plants and 10 homozygous susceptible plants were selected to construct a small resistant and susceptible pool, and the resistant and susceptible parents were added as controls for PCR amplification. The results showed that 6 SSR markers linked to the resistance gene were screened from the 63 markers in the 110Mb-140Mb segment, which were Sxau7DS-12, Sxau7DS-23, Sxau7DS-35, Sxau7DS-37, Sxau7DS-48 and Sxau7DS-60, while the 80 markers in the 570Mb-610Mb segment were not linked to the resistance gene. Therefore, it can be determined that the PmSYH resistance gene carried by SYH is located near the 110Mb-140Mb segment on chromosome 7D.

[0052] 4. PCR amplification and genotyping were performed on 352 single plants of JMC47 x Simai 54 F2 population using the above 6 markers, and the genotyping results were introduced into Join map v4.0 software to calculate the genetic distance between the 6 markers and PmSYH, and the calculation results were introduced into MapDraw v2.1 to draw a genetic linkage map. Figure 2 It can be seen that the powdery mildew resistance gene PmSYH is located between Sxau7DS-37 and Sxau7DS-48, the genetic distances between Sxau7DS-37, Sxau7DS-48 and PmSYH are 1.8 cM and 3.1 cM respectively, and PmSYH is located between 132565414 and 137465141 on the 7D chromosome.

[0053] The nucleotide sequence of Sxau7DS-37 is:

[0054] caacacactcccctctcgttcctatgcatcaccatgatcttgtgtgtgtgtgtgtgcgtaggaaattttttgaaattac tacgttctccaacagatatgcatgagtagaacacaaagagttgtggg, SEQ ID NO: 1.

[0055] The primer sequence of Sxau7DS-37 is:

[0056] Sxau7DS-37-F: 5'-CAACACACTCCCCTCTCGTT-3', SEQ ID NO: 3;

[0057] Sxau7DS-37-R: 5'-CCCACAACTCTTTGTGTTCT-3', SEQ ID NO: 4.

[0058] The nucleotide sequence of Sxau7DS-48 is:

[0059] tctctctttcttagtggggaacgacgttcgagggttcgtgagcgacagagagagggtgccgccgccgccgccc cggcgaacaaacacgatgtcttgctcctccggtgattcatcggcttctcgaggcggtgggctccgaaggagaggc, SEQ ID NO: 2.

[0060] The primer sequence of Sxau7DS-48 is:

[0061] Sxau7DS-48-F: 5'-TCTCTCTTTCTTAGTGGGGA-3', SEQ ID NO: 5;

[0062] Sxau7DS-48-R: 5'-GCCTCTCCTTCGGAGCCCAC-3', SEQ ID NO: 6.

[0063] Example 2

[0064] In order to verify the selection effect of molecular markers Sxau7DS-37 and Sxau7DS-48 in actual breeding, we randomly selected resistant plants and susceptible plants from the F2 population of Simohuang x Jinmai 47 according to the results of resistance to powdery mildew identification, and used SSR primers for PCR amplification verification, with the resistant parent Simohuang (containing the powdery mildew resistance gene) and the susceptible parent Jinmai 47 (without the powdery mildew resistance gene) as controls.

[0065] The specific steps are as follows:

[0066] Using molecular marker Sxau7DS-37 for identification, including the following operation steps:

[0067] (1) Preparation of PCR reaction system: using the genomic DNA of the wheat plant to be detected as the template, using the primers of molecular marker Sxau7DS-37 for PCR amplification; the PCR reaction system is 10 μL, which contains 50-80 ng / μL wheat genomic DNA 1.0 μL, 2×PCR Mix 5.0 μL, 2 μM primers each 1.0 μL, and sterile deionized water 2.0 μL;

[0068] (2) The PCR amplification program is as follows: 95°C pre-denaturation for 4 min; 95°C denaturation for 30 s, 60°C recombination for 30 s, 72°C extension for 30 s, a total of 34 cycles; 72°C extension for 10 min; 4°C storage for standby;

[0069] (3) Detection of PCR amplification products: electrophoresis on 8% denatured polyacrylamide gel (acrylamide / bisacrylamide=19 / 1), uniformly mix the above PCR products and 3 μL loading buffer, take 3 μL of the mixture for sample loading, electrophoresis at 220 V constant voltage for 50 min, silver nitrate staining and photography;

[0070] (4) Analysis and identification: if a specific band of 126 bp can be amplified, it indicates that the wheat germplasm to be tested contains the powdery mildew resistance gene PmSYH, otherwise, the wheat germplasm to be tested does not contain the powdery mildew resistance gene PmSYH.

[0071] The results are shown in Figure 3 .

[0072] The identification using the molecular marker Sxau7DS-48 includes the following operation steps:

[0073] (1) Preparation of PCR reaction system: using the genomic DNA of the wheat plant to be detected as a template, and using the primers of the molecular marker Sxau7DS-48 to perform PCR amplification; the PCR reaction system is 10 μL, and the reaction system comprises 50-80 ng / μL wheat genomic DNA 1.0 μL, 2×PCR Mix 5.0 μL, 2 μM primers each 1.0 μL, and sterile deionized water 2.0 μL;

[0074] (2) The PCR amplification program is: 95°C pre-denaturation for 4 min; 95°C denaturation for 30 s, 55°C recombination for 30 s, 72°C extension for 30 s, a total of 34 cycles; 72°C extension for 10 min; 4°C storage for standby;

[0075] (3) Detection of PCR amplification product: electrophoresis is performed on an 8% denaturing polyacrylamide gel (acrylamide / bisacrylamide=19 / 1), the above-mentioned PCR product and 3 μL loading buffer are uniformly mixed, 3 μL of the mixture is spotted, electrophoresis is performed at 220 V constant voltage for 50 min, silver nitrate staining is performed, and then a photograph is taken;

[0076] (4) Analysis and identification: if a specific band of 148 bp can be amplified, it indicates that the wheat germplasm to be detected contains the wheat powdery mildew resistance gene PmSYH, otherwise, the wheat germplasm to be detected does not contain the wheat powdery mildew resistance gene PmSYH.

[0077] The results are shown in Table 1. Figure 4

[0078] The above amplification results are consistent with the actual powdery mildew resistance identification results. Therefore, it is indicated that the molecular markers Sxau7DS-37 and Sxau7DS-48 can be used as molecular markers for screening the wheat powdery mildew resistance gene PmSYH, and can be used for molecular marker assisted breeding of the wheat powdery mildew resistance gene PmSYH.

[0079] The embodiments in the specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the embodiments can be referred to each other.

[0080] ​The foregoing description of the disclosed embodiments enables a person skilled in the art to make or use the application. Modifications of these embodiments will occur to persons of skill in the art, and that the appended claims are intended to cover all such modifications that do not depart from the true spirit and scope of the application. Therefore, the application is not limited to the embodiments shown but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Use of primer pairs of molecular markers linked to the wheat powdery mildew resistance gene in the identification of powdery mildew resistance in wheat, characterized in that, The molecular markers are Sxau7DS-37 and Sxau7DS-48, the genetic distance of the molecular markers from the wheat powdery mildew resistance gene is 1.8 cM and 3.1 cM respectively, wherein the nucleotide sequence of Sxau7DS-37 is shown as SEQ ID NO:1, and the nucleotide sequence of Sxau7DS-48 is shown as SEQ ID NO:2; The primer pair sequence for detecting Sxau7DS-37 is shown as SEQ ID NO:3 and SEQ ID NO:4; The primer pair sequence for detecting Sxau7DS-48 is shown as SEQ ID NO:5 and SEQ ID NO:6; The genomic DNA of the wheat plant is amplified by the primer pair, and when the 126 bp band of the Sxau7DS-37 molecular marker appears, or when the 148 bp band of the Sxau7DS-48 molecular marker appears, it indicates that the wheat powdery mildew resistance gene exists in the plant; The wheat is Jinmai 47, Siminghuang and F2 generations thereof.

2. Use of primer pairs for detecting molecular markers tightly linked to the wheat powdery mildew resistance gene in wheat powdery mildew resistance breeding, characterized in that, The molecular markers are Sxau7DS-37 and Sxau7DS-48, the genetic distance of the molecular markers from the wheat powdery mildew resistance gene is 1.8 cM and 3.1 cM respectively, wherein the nucleotide sequence of Sxau7DS-37 is shown as SEQ ID NO:1, and the nucleotide sequence of Sxau7DS-48 is shown as SEQ ID NO:2; The primer pair sequence for detecting Sxau7DS-37 is shown as SEQ ID NO:3 and SEQ ID NO:4; The primer pair sequence for detecting Sxau7DS-48 is shown as SEQ ID NO:5 and SEQ ID NO:6; The genomic DNA of the wheat plant is amplified by the primer pair, and when the 126 bp band of the Sxau7DS-37 molecular marker appears, or when the 148 bp band of the Sxau7DS-48 molecular marker appears, it indicates that the wheat powdery mildew resistance gene exists in the plant; The wheat is Jinmai 47, Siminghuang and F2 generations thereof.

Images