Application of baicalin in the fight against largemouth bass rhabdovirus

Abstract

The present invention discloses for the first time that the Chinese herbal medicine baicalin has the effect of resisting largemouth bass rhabdovirus, and baicalin exerts the antiviral effect by inhibiting the adsorption of largemouth bass rhabdovirus; the baicalin can significantly improve the survival rate of largemouth bass fry infected with largemouth bass rhabdovirus, and has the preventive and therapeutic effects on the infected virus; and the raw materials of baicalin are abundant and cheap, the preparation process is simple and the cost is low, and the baicalin has good development and application prospects in the preparation of anti-largemouth bass rhabdovirus drugs.

Description

Technical Field

[0001] The present invention belongs to the technical field of aquaculture, and specifically relates to the application of baicalin (CAS: 491-67-8) in products for inhibiting / resisting largemouth bass rhabdovirus, and specifically includes the application of baicalin (CAS: 491-67-8) in the preparation of medicines or feed additives for preventing or treating largemouth bass rhabdovirus disease. Background Art

[0002] Largemouth bass rhabdovirus disease is a very harmful fish rhabdovirus disease caused by largemouth bass rhabdovirus (Micropterus salmoides rhabdovirus, MSRV). Largemouth bass rhabdovirus is highly contagious and has a high mortality rate, with a mortality rate of up to 90% within 1 week. MSRV can be transmitted through a variety of routes. The diseased fish will have black body color, surface bleeding, cessation of feeding, irregular or spiral swimming, ulceration of fins, dragging stool, and enlargement and congestion of liver, spleen, and kidney. In recent years, largemouth bass rhabdovirus has seriously harmed the largemouth bass breeding industry. At present, most of the means for the prevention and control of fish viruses are: adding immune preparations, improving breeding patterns, inactivated vaccine prevention and control, topical drug prevention and control, etc. However, there is no effective drug treatment and prevention for MSRV in my country. Moreover, the use of feed additives such as antibiotics, chemical drugs and hormones is prone to drug abuse, causing water pollution, and many other problems such as drug residues, which seriously endanger human health. Chinese herbal medicines are not easy to produce drug resistance and toxic side effects, and will not pollute the water environment. Moreover, Chinese herbal medicines have the functions of regulating the body's balance and physiological functions, improving the body's specific and non-specific immunity, improving digestion and absorption, strengthening physical fitness, and promoting growth in aquatic animals. In addition, they also have antibacterial and antiviral effects, and have broad application prospects in disease prevention and control in my country.

[0003] Baicalein is an extract of the traditional Chinese medicine Scutellaria baicalensis and is the flavonoid with the highest content in Scutellaria baicalensis. Its structural formula is as follows:

[0004]

[0005] Baicalein has a wide range of pharmacological effects, including antiviral, anti-inflammatory, antibacterial, anti-tumor, antioxidant, anti-aging, hypoglycemic, liver protective, neuroprotective and cardioprotective effects.

[0006] The use of the Chinese herbal medicine baicalein provided in the present invention in the preparation of the prevention and treatment of largemouth bass rhabdovirus disease is reported for the first time. Summary of the invention

[0007] The inventors have found through creative labor and unremitting efforts that baicalein can significantly inhibit the proliferation of MSRV in carp epithelioma cells (EPC) and improve the survival rate of fish infected with MSRV.

[0008] Based on this, the object of the present invention is to provide the use of baicalein in preparing a product for inhibiting / resisting largemouth bass rhabdovirus.

[0009] Furthermore, the products include inhibitors, medicines, feeds, and feed additives.

[0010] The present invention also aims to provide a product for preventing and treating largemouth bass rhabdovirus disease, wherein the active ingredient of the product includes baicalein.

[0011] Preferably, the final concentration of baicalein in the product is 1-100 μM.

[0012] Preferably, the final concentration of baicalein in the product is 40 μM.

[0013] Furthermore, the product includes medicine, feed or feed additive.

[0014] Furthermore, the dosage form of the medicine is an injection, an oral preparation or an immersion preparation.

[0015] The present invention also aims to provide the use of baicalein in preparing medicines for preventing or treating largemouth bass rhabdovirus disease and feed additives.

[0016] Furthermore, the largemouth bass rhabdovirus disease is caused by largemouth bass rhabdovirus.

[0017] In order to achieve the above object, the present invention adopts the following technical solutions:

[0018] The present invention first uses CCK-8 experiment to treat cells with different concentrations of baicalin to clarify the safe dosage of baicalin. The activity of baicalin against MSRV is further analyzed through virus infection experiment, and it is clear which stage of virus proliferation is affected, and finally the feasibility of baicalin for preventing and treating largemouth black bass rhabdovirus disease is confirmed through virus attack experiment. The experimental results show that for EPC cells, the safe dosage range of baicalin is 1-100 μM. In EPC cells, 8 μM baicalin can significantly inhibit the proliferation of MSRV, and baicalin significantly inhibits the activity of MSRV in a dose-dependent manner; it can be clarified through experiments that baicalin has a direct killing effect on MSRV. Time course analysis (time-of-addition assay) shows that baicalin can play an antiviral role by affecting the adsorption of the virus; the virus attack experiment shows that baicalin can significantly reduce the mortality rate of largemouth black bass fry after being infected with MSRV virus.

[0019] Compared with the prior art, the invention has the following beneficial effects: the invention first discovered and proved that baicalin is a Chinese herbal medicine with anti-MSRV activity, and cell experiments show that baicalin exerts antiviral effect by inhibiting the adsorption of MSRV. Through MSRV challenge experiments on young largemouth sea bass, it was found that baicalin can significantly improve the survival rate of largemouth sea bass infected with MSRV, and has obvious antiviral effect. It can be used to prepare antiviral drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The results of the effects of different concentrations of baicalin on EPC cell activity are shown in the figure;

[0021] Figure 2 The results of the effect of baicalin on the proliferation of MSRV on EPC cells are shown in Figure 1; A is the pathological condition of EPC cells 24 hours after infection with MSRV; B is the result of RT-qPCR detection of the relative expression of MSRV G protein mRNA; C is the result of Western blot detection of MSRV G protein expression; D is the result of Plaque assay detection of progeny virus titer; E is the statistical analysis result of D;

[0022] Figure 3 To observe the pathological changes of EPC cells after MSRV infection under a microscope after adding different concentrations of baicalin;

[0023] Figure 4 The results of RT-qPCR detection of MSRV G protein mRNA relative expression after adding different concentrations of baicalein;

[0024] Figure 5 The results of Western blot detection of MSRV G protein expression after adding different concentrations of baicalein;

[0025] Figure 6 The figures are the results of the Plaque assay to detect the titer of progeny viruses after adding different concentrations of baicalin; wherein, A is the plaque diagram of the effect of baicalin on the progeny viruses of MSRV; and B is the statistical analysis result of A.

[0026] Figure 7 After adding baicalein at different time points, the pathological changes of EPC cells after MSRV infection were observed under a microscope;

[0027] Figure 8 The relative expression of MSRV G protein mRNA was detected by RT-qPCR after adding baicalein at different time points;

[0028] Fig. 9 Results of Western blot detection of MSRVG protein expression after adding baicalein at different time points;

[0029] Fig.10 Figure 5 is the result of Plaque assay to detect the titer of progeny virus after adding baicalein at different time points; A is the plaque diagram of the effect of baicalein on MSRV progeny virus; B is the statistical analysis result of A.

[0030] Fig.11 This is the result of RT-qPCR detection of the effect of baicalin on MSRV adsorption and internalization.

[0031] Fig.12 This is the result diagram for detecting the direct killing effect of baicalin on MSRV. The virus titer was detected by plaque assay and the plaque inhibition rate was calculated.

[0032] Fig.13 The effect of baicalin on the mortality of largemouth bass after MSRV infection. DETAILED DESCRIPTION

[0033] The technical solutions in the embodiments of the present invention will be described clearly and completely below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments.

[0034] Unless otherwise defined, all professional terms used hereinafter have the same meanings as those generally understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention; unless otherwise specifically stated, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0035] The invention aims at the existing technical problems and discloses the application of baicalin in preparing a product for inhibiting / resisting largemouth bass rhabdovirus and the application of baicalin in preparing a medicine or feed additive for preventing or treating largemouth bass rhabdovirus disease.

[0036] The present invention preliminarily found that baicalin has antiviral activity through screening from the Chinese herbal medicine library. First, the CCK-8 test was used to incubate cells with different concentrations of baicalin to clarify the safe dosage of baicalin. The virus infection experiment further analyzed the anti-MSRV activity of baicalin and clarified which stage of virus proliferation was affected. Finally, the feasibility of baicalin in preventing largemouth black bass rhabdovirus disease was explored through fish protection experiments. The test results showed that for EPC cells, the safe dosage of baicalin was 1-100 μM; 40 μM baicalin can significantly inhibit the proliferation of MSRV, and inhibit the replication of MSRV in a dose-dependent manner, exerting a significant antiviral effect; time-course analysis (time-of-addition assay) showed that baicalin exerted antiviral activity by affecting the adsorption of MSRV; the attack experiment showed that baicalin can significantly improve the survival rate of largemouth black bass infected with MSRV virus, thereby exerting antiviral activity. The specific implementation method is as follows:

[0037] The sources of materials and reagents involved in the embodiments of the present invention are as follows:

[0038] Materials: Baicalin was purchased from Shanghai Yuanye Biotechnology Co., Ltd.; carp epithelioma cells (EPC) and largemouth bass rhabdovirus (MSRV) were preserved in our laboratory;

[0039] Reagents: M199 culture medium, trypsin, dimethyl sulfoxide (DMSO) and CCK-8 kit were purchased from Biosharp; MSRV-G protein monoclonal antibody was prepared by our laboratory; HRP-labeled goat anti-mouse IgG antibody and β-Actin rabbit monoclonal antibody were purchased from Wuhan Abotek Biotechnology Co., Ltd.; fetal bovine serum was purchased from BI Company.

[0040] Example 1

[0041] Effects of baicalin on cell activity

[0042] (1) Baicalein was prepared into a 10 mM stock solution using DMSO solution. EPC cells in good growth condition were plated in a 96-well cell plate at 1×105 / mL and cultured in 5% CO2 for 24 h. When the cell confluence reached 90%, different concentrations of baicalein dilutions (0, 1, 2, 4, 8, 10, 20, 40, 60, 80, 100, 200 μM) were added and cultured for another 24 h. 100 μL of M199 medium containing 10% CCK-8 was added to each well and cultured at 28°C for 4 h. The OD values ​​were read using a microplate reader at 2 h and 4 h, respectively. 450 The experimental results are as follows Figure 1 shown.

[0043] The specific steps of preparing the baicalin stock solution are as follows: dissolving 20 mg of purchased baicalin powder in 7.4 mL of DMSO to prepare a 10 mM baicalin stock solution;

[0044] Baicalein dilution solutions of different concentrations can be obtained by diluting the baicalein storage solution with culture medium to corresponding concentrations.

[0045] Depend on Figure 1 It can be seen that 1-100 μM baicalein has no significant effect on the activity of EPC cells, and both are safe concentrations for use in EPC cells.

[0046] Example 2

[0047] Effect of baicalein on the proliferation of MSRV in EPC cells

[0048] According to the minimum safe dosage and antiviral effect in Example 1, 40 μM baicalein was selected; antiviral experiments were conducted as follows: EPC cells in good growth state were plated in a 12-well cell plate and cultured at 28°C 5% CO2 for 24 hours until the cell confluence reached 90%; 40 μM baicalein was mixed with 0.005 MOI virus and incubated at room temperature for 2 hours before infecting the cells. After 2 hours of infection, the virus solution was discarded, the serum-free M199 medium was washed twice, and the medium was replaced with a maintenance medium containing the drug. The cells were cultured at 37°C 5% CO2 for 24 hours, and the pathological changes of the cells were observed under a microscope. The cell pellet and supernatant were collected, and the mRNA level was detected by RT-qPCR, the expression of MSRV protein was detected by Western blot, and the virus titer in the supernatant was detected by plaque assay. The test results are as follows: Figure 2 shown.

[0049] Among them, the specific steps of Western blot, RT-qPCR and plaque assay are as follows:

[0050] Western blot: (1) Sample treatment: Blow off the cell sample on the cell plate with PBS, then centrifuge at 3000g for 7 minutes, discard the liquid, add an appropriate amount of PBS according to the size of the precipitate to resuspend, add 5× Loading Buffer at a ratio of 4:1, and boil the sample at 100℃ for 15 minutes; (2) SDS-PAGE: Install the protein gel plate, add 10μL of the treated sample to each well, and run electrophoresis at 120V constant voltage for 120 minutes; (3) Transfer: Install according to filter paper-protein gel-PVDF membrane-filter paper, transfer at 9V for 50 minutes; (4) Blocking: After the transfer is completed, put the membrane into 5% skim milk powder prepared in advance and block it at room temperature for 2 hours; (5) Incubation with primary antibody: MSRV monoclonal antibody 1:5000 dilution, β-actin mouse monoclonal antibody 1:5000 dilution, incubate at room temperature for 2 hours; (6) Incubation with secondary antibody: HRP-labeled goat anti-mouse IgG 1:5000 dilution, incubate at room temperature for 1 hour; (7) Color development: ECL luminescence color development.

[0051] RT-qPCR: (1) Extraction of total RNA from cells: discard the culture medium, add 1 mL of Trizol to lyse the cells and collect them into a 1.5 mL centrifuge tube without RNase, and let it stand at room temperature for 5 min to allow the cells to fully lyse; add 200 μL of chloroform, shake up and down to mix thoroughly, and let it stand at room temperature for 5 min; centrifuge at 4°C, 12,000 g for 15 min, aspirate the supernatant into a new 1.5 mL centrifuge tube, add an equal volume of isopropanol, mix upside down, and let it stand at room temperature for 10 min. A white precipitate is visible at the bottom of the EP tube with the naked eye, and the supernatant is discarded; add pre-cooled 75% ethanol solution to wash twice, blow dry in a fume hood, add DEPC water to dissolve RNA; and measure the concentration of the extracted total RNA using a UV spectrophotometer. (2) Reverse transcription to cDNA: Reaction system: 1 ng total RNA, 4 μL reverse transcription reagent 5×ABS ScriptⅢRT Mix, 1 μL 20×gDNA Remover Mix, and DEPC water to 20 μL. Reverse transcription conditions: 37°C for 2 min, 55°C for 15 min, and 85°C for 5 min. (3) Real-time fluorescence quantitative RT-PCR detection (RT-qPCR): Add 180 μL DEPC water to 20 μL cDNA, flick to mix thoroughly, and place on ice for later use. RT-qPCR reaction system: 10 μL 2×Universal SYBR GreenFast qPCRMix, 2 μL each of upstream and downstream primers, 2 μL cDNA, 2 μL DEPC water, upstream primer of MSRV-G protein: AAAAGACATTTATCACCGTCCAAG, downstream primer: GTTGTTGGGATTGATGTGGCT, internal reference gene 40S The upstream primer of ribosomal protein was CCGTGGGTGACATCGTTACA, and the downstream primer of internal reference gene 40S ribosomal protein was TCAGGACGTTGAACCTCACTGTCT. Reaction conditions: 95℃3min for denaturation; 95℃5sec, 60℃30sec, 39 cycles; 95℃15sec, 60℃1min, 95℃15sec for generating melting curve.

[0052] Plaque assay: (1) Inoculate cells into a 24-well plate, and wait until the monolayer of cells grows to 100% for virus infection; (2) Gradient dilution of virus: Add 900 μL of basal culture medium to each tube, add 100 μL of sample to the first tube, shake and mix, then pipette 100 μL and add it to the second EP tube, and so on, 10-fold gradient dilution of virus. Add 500 μL of virus solution to each well of the 24-well plate, repeat three times for each concentration, and incubate in a 28°C incubator for 2 hours; (3) Wash once with serum-free culture medium, add 500 μL of semi-solid culture medium containing methylcellulose; (4) Continue to culture in a 28°C incubator for 24-48 hours, and fix with 10% formaldehyde for 12 hours after visible plaques are formed, rinse with tap water and dry; (5) Stain with crystal violet stain for 3 hours, rinse with tap water, turn upside down on absorbent paper and dry, and calculate the reading.

[0053] Depend on Figure 2 It can be seen that 40 μM baicalein significantly inhibited the cytopathic effect caused by MSRV (A), reduced the transcription (B) and protein expression (C) of the MSRVG gene, and the production of MSRV progeny viruses (D, E).

[0054] Example 3

[0055] Effects of different concentrations of baicalin on the proliferation of MSRV

[0056] EPC cells in good growth state were plated in 12-well cell plates and cultured at 28°C 5% CO2 until the cell confluence reached 90%. Different concentrations of baicalin dilutions (0, 1, 2, 4, 8, 10, 20, 40 μM) were mixed with 0.005 MOI virus and incubated at room temperature for 2 hours before infecting the cells. After 2 hours of infection, the virus solution was discarded, the cells were washed twice with serum-free M199 medium, and replaced with maintenance medium containing the same concentration of baicalin. The cells were cultured at 37°C 5% CO2 for 24 hours, and the pathological changes of the cells were observed under a microscope (the experimental results are shown in Figure 2). Figure 3 As shown), cell pellets and supernatants were collected, and RT-qPCR was used to detect mRNA levels (the detection results were shown in Figure 4 ), Western blot was used to detect the expression of MSRV protein (the test results are shown in Figure 5 As shown), the virus titer in the supernatant was detected by plaque assay and statistical analysis was performed (the results are shown in Figure 6 As shown); wherein, the specific operation steps of RT-qPCR, Western blot, and plaque assay refer to Example 2.

[0057] Depend on Figure 3-6It can be seen that different concentrations of baicalein inhibited the proliferation of MSRV to a certain extent, and the inhibitory effect increased with the increase of baicalein concentration, which was concentration-dependent. The half inhibitory concentration was 5.467 μM.

[0058] Example 4

[0059] Effects of adding baicalein at different time points on the proliferation of MSRV

[0060] EPCs were plated in 12-well cell plates and cultured at 37°C 5% CO2 until the cell confluence reached 90%. 0.005 MOI MSRV was inoculated on EPC cells, and baicalein with a final concentration of 40 μM was added at 0h, 2h, 4h and 8h after infection. After 2h of infection, the cells were washed twice with serum-free medium and replaced with drug-containing maintenance medium. The cells were cultured at 28°C 5% CO2 for 24h, and the effects of baicalein on the cell pathological changes caused by MSRV at different time points were observed under a microscope. Figure 7 As shown); collect cell pellets and supernatants, and detect mRNA levels by RT-qPCR ( Figure 8 ), Western blot detection of MSRV protein expression ( Fig. 9 As shown), plaqueassay was used to detect the virus titer in the supernatant and statistical analysis was performed (the results are shown in Fig.10 ) Among them, the specific operation steps of RT-qPCR, Western blot and plaque assay refer to Example 2.

[0061] Depend on Figure 7-10 It can be seen that adding baicalein at different time points after infection has a certain inhibitory effect on the proliferation of MSRV, and the inhibitory effect is most obvious when added at 0h. Figure 7 The cytopathic effects of adding baicalein on MSRV at different time points were observed under a microscope; Figure 8 It shows the effect of adding baicalein at different time points on the mRNA level of MSRV-G protein; Fig. 9 It shows the effect of adding baicalein at different time points on the expression of MSRV-G protein; Fig.10 A is a plaque diagram showing the effect of adding Scutellaria baicalensis at different time points on the progeny viruses of MSRV; 10B is the statistical analysis result of 10A.

[0062] Example 5

[0063] Baicalein affects the adsorption and internalization of MSRV

[0064] Adsorption: EPC cells in good growth state were plated in 12-well plates and cultured at 28°C 5% CO2 until the cell confluence reached 90%. They were placed at 4°C for 1 hour for precooling. EPC cells were infected with a mixture of 40 μM baicalein and 0.005 MOI MSRV virus and incubated at 4°C for 2 hours. After washing away the unadsorbed virus with culture medium, cell samples were collected and RT-qPCR (for specific operation steps, refer to Example 2) was performed to detect the effect of baicalein on MSRV adsorption. The test results are as follows: Fig.11 shown.

[0065] Internalization: EPC cells with good growth status were plated in 12-well plates and cultured at 28°C 5% CO2. The cell confluence reached 90%, and the cells were placed at 4°C for 1 hour for precooling. EPC cells were infected with 0.005MOI MSRV virus solution, incubated at 4°C for 2 hours, the virus solution was discarded, and the serum-free medium was washed twice, replaced with the maintenance medium containing the drug, and cultured at 28°C 5% CO2 for 2 hours. The virus that did not enter the cells was washed with PBS at pH = 3, and the cell samples were collected for RT-qPCR (refer to Example 2 for the specific operation steps) to detect the effect of baicalin on MSRV adsorption. The test results are as follows Fig.11 shown.

[0066] Depend on Fig.11 It can be seen that baicalein inhibits the adsorption stage of MSRV and does not affect the internalization of MSRV.

[0067] Example 6

[0068] Effect of baicalin on the infection activity of MSRV

[0069] EPCs with good growth status were plated on 24-well cell plates and cultured at 28℃5%CO2 until the cell confluence reached 100%. A mixture of baicalein (40μM) and virus (0.005MOI) was prepared as the experimental group, and a mixture of DMSO (4μL) and virus (0.005MOI) was prepared as the control group, with three replicates for each concentration. Incubate at room temperature, dilute the mixture to 500PFU / well, 100PFU / well, and 50PFU / well to infect cells at 2h, 4h, and 6h, respectively, and infect at 28℃5%CO2 for 2h, discard the virus solution, add 500μL of semi-solid culture medium containing methylcellulose, and culture at 28℃5%CO2 for 24-48h. After visible plaques are formed, fix with 10% formaldehyde for 12 hours, rinse with tap water, turn upside down on absorbent paper to dry, add 1mL 0.5% crystal violet staining solution to stain for 4 hours, rinse with tap water and dry, and calculate the reading. Fig.12 shown.

[0070] Depend on Fig.12 It can be seen that baicalin can directly kill viruses and reduce their virulence.

[0071] Example 7

[0072] Toxicity test of baicalin on fish and detection of anti-MSRV effect at fish level

[0073] After being temporarily kept at 25℃ for 7 days, 80 largemouth black bass were randomly divided into 4 groups, namely, drug group, control group, challenge group, and treatment group.

[0074] Drug group (baicalin): 20 μL of M199 medium containing 1 mM baicalin was injected along the base of the pectoral fin;

[0075] Control group (DMSO): 20 μL of M199 medium containing 10% DMSO was injected along the base of the pectoral fin;

[0076] Treatment group (ZWY+baicalein): 20 μL of 10 3 PFU MSRV and 20 μL of M199 medium with a final concentration of 1 mM baicalein;

[0077] The challenge group (ZWY) was injected with 20 μL of 10 3 PFU of MSRV in M199 medium.

[0078] The fish were observed for 14 consecutive days, and the mortality of the experimental fish was recorded every day to calculate the relative protection rate. Fig.13 shown.

[0079] Depend on Fig.13 It can be seen that baicalein reduced the lethality of MSRV, with a relative protection rate of 36.8%.

[0080] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.

Claims

1. Application of baicalin in the preparation of products for inhibiting / resisting largemouth bass rhabdovirus.

2. The use according to claim 1, It is characterized in that The product includes an inhibitor.

3. The use according to claim 1, It is characterized in that The products include medicines, feed, and feed additives.

4. The use according to claim 1, It is characterized in that The active ingredients of the product include baicalin.

5. The use according to claim 1, It is characterized in that The final concentration of baicalein in the product is 1-100 μM.

6. The use according to claim 1, It is characterized in that The final concentration of baicalein in the product is 40 μM.

7. The use of baicalin in the preparation of drugs for preventing or treating largemouth bass rhabdovirus disease.

8. Application of baicalin in the preparation of feed additives for preventing or treating rhabdovirus disease in largemouth bass.

9. The use according to claim 7 or 8, It is characterized in that The largemouth bass rhabdovirus disease is caused by largemouth bass rhabdovirus.

Images