Screening method and application of a Pseudomonas fluorescens strain capable of degrading shells and producing chitinase at low temperature

Abstract

The present invention relates to a strain of Pseudomonas fluorescens that can degrade shells and produce chitinase at low temperature. The classification name of Pseudomonas fluorescens is Pseudomonasfluorescens. The preservation institution of Pseudomonas fluorescens is the General Microbiological Center of the China Microbiological Culture Collection Administration Committee, with a preservation number of CGMCCNo.26060 and a preservation date of November 7, 2022. The present invention collects low-temperature beach soil in the Northeast region, enriches low-temperature culture, and screens microbial strains that efficiently degrade chitin polysaccharides at low temperatures. Efficient chitinase can be produced at low temperatures (15°C), which can be used for the decomposition of chitinous organic materials in low-temperature and cool areas in the Northeast. The chitin polysaccharides are degraded by low-temperature fermentation of the above-mentioned bacterial agent, and the soil aggregate structure is improved after returning to the field, creating a beneficial bacterial advantage, promoting the formation of soil aggregate structure, greatly improving the soil micro-ecological system, enhancing soil permeability, and improving the soil water and fertilizer retention capacity.

Description

Technical Field

[0001] The invention relates to a method for screening a strain of fluorescein Pseudomonas that can degrade shells and produce chitinase at low temperature and an application thereof to perform low-temperature degradation of chitin polysaccharide, belonging to the field of microbiology, and more specifically to a method for screening a strain of fluorescein Pseudomonas that can degrade shells and produce chitinase at low temperature and an application thereof. Background Art

[0002] Shells and other materials contain a large amount of chitin, which belongs to the category of agricultural waste. They are common in coastal areas in the Northeast, but due to the lack of microorganisms that can effectively decompose them, they cannot be effectively utilized. Especially under the perennial low temperature conditions in the Northeast, it is particularly important to screen low-temperature microbial strains that can decompose shells. Low-temperature microorganisms refer to microbial groups that have the ability to grow and reproduce in low-temperature environments. They grow and reproduce in various low-temperature environments. According to the selection of the growth temperature of microorganisms, low-temperature microorganisms are divided into two categories, cold-loving microorganisms and cold-tolerant microorganisms. Among them, cold-loving microorganisms can grow and reproduce, and the optimal temperature is about 115°C, and the temperature at which they can survive is about 20°C; cold-tolerant microorganisms are microorganisms that can survive at a temperature of about 0°C and can grow and reproduce at an optimal temperature of about 20°C. There are very rich microbial resources and low-temperature microbial resources in the biosphere, so the microbial resources are fully used in life and production practices, and the temperature for the growth and reproduction of low-temperature microorganisms can generally be carried out at room temperature, without the use of other energy sources, and are very easy to obtain and widely distributed. So far, there is relatively little development and utilization of low-temperature microorganisms. Judging from the research progress at home and abroad, most of the research is still on medium and high temperature microorganisms, and there is very little research on low-temperature microbial degradation bacteria of shells.

[0003] So far, most of the microbial species that can secrete chitinase that have been recorded at home and abroad are some fungal flora, such as Trichoderma, Aspergillus, etc. There are very few reports on Pseudomonas fluorescens that can produce chitinase at low temperature.

[0004] In addition, the types of enzyme-producing strains studied at this stage are limited, and most of them have defects such as high production cost, insufficient and stable enzyme production capacity and enzyme production, and narrow pH adaptation range. Therefore, it is necessary to continue to explore and develop new strains with high activity and a wider range of action, and further expand the source of chitinase. However, scholars at home and abroad pay more attention to medium and high temperature chitinase, and have little research on bacteria that produce chitinase under low temperature conditions. Low temperature chitinase has more advantages and potential in energy saving and cost reduction, and has great development prospects.

[0005] In conclusion, the screening method and application of a low-temperature chitinase-producing Pseudomonas fluorescens that can degrade shells have not been reported. Summary of the invention

[0006] The purpose of the present invention is to solve the above problems and provide a screening method and application of a fluorescent Pseudomonas strain that can degrade shells and produce chitinase at low temperature.

[0007] In order to achieve the above-mentioned purpose of the present invention, the present invention adopts the following technical scheme:

[0008] A strain of Pseudomonas fluorescens that can degrade shells and produce chitinase at low temperature. The classification name of Pseudomonas fluorescens is Pseudomonas fluorescens The depository institution of Pseudomonas fluorescens is the General Microbiology Center of China Microbiological Culture Collection Administration, the deposit number is CGMCC No.26060, and the deposit date is November 7, 2022.

[0009] The 26S rDNA sequence of Pseudomonas fluorescens was published in GenBank with the accession number MHAWCVBB014. Its 16S rDNA sequence is:

[0010]

[0011] TCCAGAAGTAGCTAGTCTAACCGCAAGGGGGACGGTTACCACGGAGTGATTCATGACTGGGGTGAAGTC.

[0012] The biological characteristics of Pseudomonas fluorescens are: pale yellow round colonies on LB culture medium, which are flat, moist, and easy to pick up, showing typical Pseudomonas fluorescens colonies.

[0013] Isolation method of Pseudomonas fluorescens strains:

[0014] The shell powder suspension collected from the seashore of Northeast China was inoculated at a 10% inoculation amount into an inorganic salt culture medium containing 100 mg / L chitin polysaccharide, and shaken at 150 r / min at 10°C. After culturing for 3 days, it was transferred to an inorganic salt culture medium with a chitin polysaccharide concentration of 300 mg / L at 15°C at a 10% inoculation amount and continued to be cultured; this method was repeated for 3 times, and the chitin polysaccharide concentrations in the inorganic salt culture medium used for the three times were 300 mg / L, 600 mg / L, and 1000 mg / L, respectively, and then the plate was spread, and the culture dish was placed in a constant temperature incubator at 15°C for 72 hours, and a single colony was picked and transferred into an inorganic salt culture medium with a chitin polysaccharide concentration of 1000 mg / L to obtain a chitin-degrading bacterial suspension.

[0015] The composition of the inorganic salt medium is (NH ４ ) ２ SO ４ 2g / L, KH ２ PO ４ 2g / L, Na ２ HPO ４ 1.3 g / L, chitin 100-1000 mg / L, NaCl 5 g / L, the balance is water; the pH of the culture medium = 4.8-7.2.

[0016] Screening of Pseudomonas fluorescens strains:

[0017] a. Preliminary screening: Inoculate the purified strains onto Congo red shell powder medium and culture at 15℃ for 4 days. Perform preliminary screening based on the ratio of the hydrolysis zone diameter D to the colony diameter d, i.e., the larger the D / d value, the better;

[0018] b. Rescreening: Add 50 ml of 1000 mg / L inorganic salt culture medium into a 250 ml Erlenmeyer flask, sterilize at 121°C for 30 min, and then cool to room temperature. Inoculate 1 mL of the bacterial suspension of the chitin polysaccharide-degrading strain obtained in the initial screening into 1000 mg / L inorganic salt liquid fermentation medium, culture at 15°C for 3 days, measure the chitinase activity, and conduct rescreening.

[0019] Fermentation conditions for Pseudomonas fluorescens strains:

[0020] a Effects of different carbon sources on the growth and chitinase of Pseudomonas fluorescens strains;

[0021] Glucose, maltose, sucrose, corn flour, glycerol, lactose, fructose, mannitol, citric acid and soluble starch were used as carbon sources in the culture medium to prepare liquid culture medium; 1 mL of Pseudomonas fluorescens seeds were inoculated in the carbon source culture medium; in 1000 mg / L inorganic salt liquid chitin polysaccharide powder fermentation medium, at 20°C, 120 rpm shaking culture for 2 days, centrifuged at 13000 rpm for 15 min, the chitinase content in the supernatant was determined, and the carbon source was screened;

[0022] b Effects of different nitrogen sources on the growth and chitinase of Pseudomonas fluorescens strains;

[0023] Peptone, yeast extract, soybean powder, casein, urea, ammonium sulfate, potassium nitrate and beef extract were used as nitrogen sources in the culture medium, and nitrogen source liquid was prepared as culture medium; in 1000 mg / L inorganic salt liquid chitin polysaccharide powder fermentation medium, after shaking culture at 120 rpm for 2 days at 20°C, centrifuged at 3000 rpm for 5 minutes, the chitinase content in the supernatant was determined to screen the nitrogen source;

[0024] c Effects of different inorganic salts on the growth and chitinase of Pseudomonas fluorescens strains

[0025] MgSO4, NaCl and KH2PO4 were used as inorganic salts in the culture medium, and liquid culture medium with different inorganic salts was prepared; in 1000 mg / L inorganic salt liquid chitin polysaccharide powder fermentation medium, after shaking culture at 120 rpm for 2 days at 20°C, centrifuged at 3000 rpm for 5 minutes, and the chitinase content in the supernatant was determined to screen the inorganic salts;

[0026] d Effects of different initial pH on the growth and chitinase of Pseudomonas fluorescens strains

[0027] Prepare liquid culture medium with pH values ​​of 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11; ferment the medium with 1000 mg / L inorganic salt liquid chitin polysaccharide powder, shake and culture at 120 rpm for 2 days at 20°C, centrifuge at 3000 rpm for 5 minutes, determine the chitinase content in the supernatant, and screen the initial pH value;

[0028] e Effects of different temperatures on the growth and chitinase of Pseudomonas fluorescens strains

[0029] Prepare h liquid culture medium; take 1mL of Pseudomonas fluorescens seed culture solution and inoculate it into liquid culture solution, place it in an shaking incubator at temperatures of 115℃, 20℃, 25℃, 30℃, 35℃, and 40℃, respectively, in 1000mg / L inorganic salt liquid chitin polysaccharide powder fermentation medium, at 20℃, shake and culture at 120rmp for 2 days, centrifuge at 3000rmp for 5min, determine the chitinase content in the supernatant, and screen the temperature.

[0030] The advantages of the present invention are:

[0031] 1. The present invention collects low-temperature soil in the Northeast region, enriches and decomposes chitin polysaccharides for low-temperature cultivation, and screens out microbial strains that can efficiently degrade chitin polysaccharides at low temperatures. The microbial strains can produce efficient chitinase at low temperatures (15°C) to decompose chitin, and can be used as a decomposing agent for chitin-containing organic materials in low-temperature and cold areas in the Northeast. The chitin polysaccharides are degraded by low-temperature fermentation of the above-mentioned microbial agent, and the soil aggregate structure is improved after returning to the field, creating a beneficial bacterial advantage, promoting the formation of soil aggregate structure, greatly improving the soil micro-ecological system, enhancing soil permeability, and improving the soil's ability to retain water and fertilizer.

[0032] 2. The present invention enables the soil to have the potential for sustainable production and income increase. It can also effectively transform the active ingredients in chitin, release small molecule nutrients and active factors, improve soil fertility, and enrich the soil.

[0033] 3. The fertilizer product produced by the present invention has the unique characteristic of low-temperature decomposition of chitin polysaccharide and is low in cost. After application, it can effectively improve the physical and chemical properties of soil, increase the seed germination rate, and enhance the ability of seedlings to resist drought, cold, diseases and insect pests. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is a graph showing changes in T38 chitinase under different carbon source conditions of the present invention.

[0035] Figure 2 This is a graph showing changes in T38 chitinase under different nitrogen source conditions of the present invention.

[0036] Figure 3 It is a graph showing the changes of T38 chitinase under different inorganic salt conditions of the present invention.

[0037] Figure 4 It is a diagram showing changes of T38 chitinase under different pH conditions of the present invention.

[0038] Figure 5 It is a graph showing changes in T38 chitinase under different temperature conditions of the present invention.

[0039] Figure 6This is a diagram of the enzymatic kinetic changes of T38 chitinase under liquid culture conditions at 15°C of the present invention. DETAILED DESCRIPTION

[0040] The following is attached to the instruction manual Figure 1-6 The present invention is further described in detail with reference to the accompanying drawings and embodiments.

[0041] A method for screening fluorescing Pseudomonas fluorescens producing chitinase at a low temperature and its application, the classification name of fluorescing Pseudomonas fluorescens is Pseudomonas fluorescens The depository institution of Pseudomonas fluorescens is the General Microbiology Center of China Culture Collection Administration, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing. The deposit number is CGMCC No. 26060, and the deposit date is November 7, 2022.

[0042] Isolation method of Pseudomonas fluorescens strains:

[0043] The shell powder suspension collected from the seaside of Northeast China was inoculated at a 10% inoculation amount into an inorganic salt culture medium containing 100 mg / L chitin polysaccharide, and shaken at 150 r / min at 10°C. After culturing for 3 days, it was transferred to an inorganic salt culture medium with a chitin polysaccharide concentration of 300 mg / L at 15°C at a 10% inoculation amount and continued to be cultured; this method was repeated for 3 times, and the chitin polysaccharide concentrations in the inorganic salt culture medium used for the three times were 300 mg / L, 600 mg / L, and 1000 mg / L, respectively, and then the plate was spread, and the culture dish was placed in a constant temperature incubator at 15°C for 72 hours, and a single colony was picked and transferred into an inorganic salt culture medium with a chitin polysaccharide concentration of 1000 mg / L to obtain a chitin polysaccharide degrading bacterial suspension.

[0044] The composition of the inorganic salt medium is (NH ４ ) ２ SO ４ 2g / L, KH ２ PO ４ 2g / L, Na ２ HPO ４ 1.3 g / L, chitin 100-1000 mg / L, NaCl 5 g / L, the balance is water; the pH of the culture medium = 4.8-7.2.

[0045] Screening of Pseudomonas fluorescens (T38) strains:

[0046] a. Preliminary screening: Inoculate the purified strains onto Congo red chitin medium and culture at 15°C for 4 days. Perform preliminary screening based on the ratio (D / d) of the hydrolysis zone diameter (D) to the colony diameter (d), i.e. the larger the D / d value, the better.

[0047] b. Rescreening: Add 50 ml of 1000 mg / L inorganic salt culture medium into a 250 ml Erlenmeyer flask, sterilize at 121°C for 30 min, and then cool to room temperature. Inoculate 1 mL of the bacterial suspension of the chitin polysaccharide-degrading strain obtained in the initial screening into 1000 mg / L inorganic salt liquid fermentation medium, and culture at 15°C for 3 days. Measure the chitinase activity and conduct rescreening.

[0048] Optimization of fermentation conditions for Pseudomonas fluorescens (T38) strain:

[0049] a Effects of different carbon sources on the growth and chitinase of Pseudomonas fluorescens T38 strain;

[0050] Use (glucose, maltose, sucrose, corn flour, glycerol, lactose, fructose, mannitol, soluble starch) as the carbon source in the culture medium to prepare the liquid culture medium. Take 1mL of the fluorescein Pseudomonas T38 seed culture medium and inoculate it into the culture medium (1000mg / L inorganic salt liquid chitin polysaccharide powder fermentation medium). After shaking culture at 20℃ and 120rmp for 2 days, centrifuge at 13000rmp for 15min, determine the chitinase content in the supernatant, and screen the carbon source.

[0051] b Effects of different nitrogen sources on the growth and chitinase of Pseudomonas fluorescens T38 strain;

[0052] The nitrogen source liquid culture medium was prepared with (peptone, yeast extract, soybean powder, casein, urea, ammonium sulfate, potassium nitrate, beef extract) nitrogen source as the nitrogen source in the culture medium. The rest of the method was the same as above, and the chitinase content in the supernatant was determined to screen the nitrogen source.

[0053] c Effects of different inorganic salts on the growth and chitinase of Pseudomonas fluorescens T38 strain;

[0054] MgSO4, NaCl, KH ２ PO ４ , CaCO3 as inorganic salts in the culture medium, liquid culture medium with different inorganic salts was prepared. The rest of the method was the same as above, the chitinase content in the supernatant was determined, and the inorganic salts were screened.

[0055] d Effects of different initial pH on the growth and chitinase of Pseudomonas fluorescens T38 strain;

[0056] Liquid culture medium with pH values ​​of 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11 was prepared. The rest of the method was the same as above, and the chitinase content in the supernatant was determined to screen the initial pH value.

[0057] e Effects of different temperatures on the growth and chitinase of Pseudomonas fluorescens T38 strain;

[0058] Prepare h liquid culture medium. Take 1 mL of Pseudomonas fluorescens T38 seed culture solution and inoculate it into liquid culture solution, and place it in a shaking incubator at 5°C, 10°C, 15°C, 30°C, 35°C, and 40°C. The rest of the method is the same as above. Determine the chitinase content in the supernatant and select the temperature.

[0059] The fluorescing Pseudomonas strain of the present invention reaches a chitinase peak in 72 hours in terms of enzymatic kinetics, has an optimum carbon source of sucrose, an optimum nitrogen source of beef extract, an optimum inorganic salt of calcium carbonate, an optimum pH of 7, and an optimum fermentation temperature of 15-25°C. Example

[0060] (1) Preparation of seed solution;

[0061] The T38 fluorescent Pseudomonas strain was inoculated from a test tube mother under sterile conditions into a 500 ml liquid Erlenmeyer flask with a liquid volume of 150 ml, and cultured in a beef extract peptone medium with an inoculation volume of 1%, a temperature set at 20°C, and cultured in a shaking incubator at 140 r / min for 72 hours.

[0062] Beef extract peptone culture medium: beef extract 3g / L, peptone 8g / L, sucrose 2g / L, NaCl5g / L, CaCO31g / L, shell powder 5g / L.

[0063] (2) Field trials;

[0064] Peanut variety tested: Fuhua 12. T38 was used as the test material, and the seed solution was adsorbed by peat, with an adsorption ratio of 1:2. The number of microorganisms in the final fertilizer reached 1×10 8 CFU / g.

[0065] The experiment was conducted from May 13, 2021 to September 22, 2021 at the home of farmer Yang Hong in Houdangbao Village, Qiandangbao Town, Xinmin City, Liaoning Province.

[0066] The test soil was sandy loam soil that had been planted with peanuts for more than 15 years.

[0067] Table 1 Physical and chemical properties of the tested soil

[0068] The experiment set up 5 treatments: treatment 1 was a control without fertilizer CK1; treatment 2 was a conventional fertilization CK2; treatment 3 was a conventional fertilization CK2 + T38 bacterial fertilizer (300kg / hm 2 ) M1, treatment 4 conventional fertilization CK2 + T38 bacterial fertilizer (600kg / hm 2 ) M2, treatment 5 conventional fertilization CK2 + T38 bacterial fertilizer (1200kg / hm 2 The experiment adopted a randomized block design with three replicates and a plot area of ​​30 m 2Conventional fertilization treatment applied nitrogen fertilizer 112.5 kg / hm 2 , P2O5112.5 kg / hm 2 , K2O 112.5 kg / hm 2 , nitrogen, phosphorus and potassium are applied as base fertilizer at one time. Planting density 27 7000 plants / hm 2 , 2 seeds per hole, sown in the open field on May 13, seedlings emerged on May 24, and harvested on October 10. Various soil-related indicators (soil available nitrogen, available potassium, available phosphorus, pH, etc.) during the pod maturity period were measured. After harvest, 10 plants were selected from each treatment to measure the number of pods per plant, fruit weight per plant (yield), 100-fruit weight, 100-kernel weight, and kernel rate. 10 square meters were taken for each replicate to measure and calculate the yield.

[0069] result:

[0070] 1 Effect of microbial fertilizer on continuous peanut field experiment

[0071] 1.1 Effects of microbial fertilizer on the physical and chemical properties of peanut continuous cropping soil

[0072] As for nitrogen, it can be seen from Table 2 that with the increase of microbial dosage, the available nitrogen in the soil showed an obvious upward process, M3 was significantly higher than CK and other treatments, followed by M2. The change of soil total nitrogen and the addition of microbial agents can increase soil total nitrogen, among which M3 increased the most, by 13.1%. As can be seen from Table 2, with the increase of microbial dosage, the available phosphorus in the soil showed an obvious upward trend, M3 was significantly higher than CK and other treatments, and increased by 1.8 times, which had a greater impact on the available phosphorus. As can be seen from Table 2, with the increase of microbial dosage, the available potassium in the soil showed a slight upward trend, M3 was higher than CK and other treatments. Analyzing the reasons, the chitinase secreted by T38 bacterial fertilizer can activate chitin in the soil, achieving an effect of improving soil fertility.

[0073] Table 2. Effects of microbial fertilizer on the physical and chemical properties of soil under continuous peanut cropping.

[0074]

[0075] 1.2 Effect of microbial fertilizer on peanut continuous cropping yield

[0076] It can be observed from Table 3 that different dosages of microbial preparations have significant differences in the agronomic shape and yield of continuous cropping peanuts. With the increase in the dosage of microbial preparations, the yield of peanuts showed an increasing process. The number of pods per plant was M3>M1>M2>CK2>CK1, among which the number of pods per plant of M3 was 32.6% higher, which may be the main reason for the increase in peanut yield due to the application of microbial fertilizers. The single-plant fruit weight was the highest in M1, followed by M3, and there was no significant difference between the treatments. The changes in 100-fruit weight and the number of pods per plant were consistent, and the 100-kernel weight and kernel rate were the highest in M3, followed by M2, among which M3 increased by 13.81% compared with CK2, reaching a significant level. From the results, it can be observed that the T38 strain has a significant effect on increasing the yield of continuous cropping peanuts.

[0077] Table 3. Effect of microbial fertilizer on continuous cropping peanut yield.

[0078]

Claims

1. A strain of Pseudomonas fluorescens that can degrade shells and produce chitinase at low temperature, characterized in that: Pseudomonas fluorescens is classified as Pseudomonas fluorescens The preservation institution of Pseudomonas fluorescens is the General Microbiology Center of China Microbiological Culture Collection Administration, the preservation number is CGMCC No.26060, and the preservation date is November 7, 2022.

Images