Application of soybean GmWAK9 gene in improving soybean resistance to soybean cyst nematode disease

Abstract

This invention relates to the application of the soybean GmWAK9 gene in improving soybean resistance to soybean cyst nematode disease, belonging to the field of genetic engineering technology. To identify genes in soybeans that possess resistance to soybean cyst nematode disease, and subsequently utilize these genes to enhance soybean's resistance to the disease and cultivate new soybean varieties resistant to soybean cyst nematode disease, this invention cloned the GmWAK9 gene from soybean, constructed a recombinant expression vector containing the GmWAK9 gene, and then obtained soybean roots overexpressing the GmWAK9 gene using Agrobacterium-mediated transformation. Inoculation with soybean cyst nematodes demonstrated that overexpression of the GmWAK9 gene can improve soybean resistance to soybean cyst nematodes. Applying GmWAK9 to soybean breeding through hybridization or genetic transformation can improve the disease resistance of soybean varieties, thereby reducing disease incidence and achieving the goals of increased and stable yields.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a soybean. GmWAK9 Application of genes in improving soybean resistance to soybean cyst nematode disease. Background Technology

[0002] Soybeans Glycine max [L.] Merr. is an important economic crop, providing essential oils and plant protein sources for humans and animals. Although China is the world's fourth-largest soybean producer, it has become the world's largest consumer and importer of soybeans over the past few decades. Therefore, it is necessary to further increase domestic soybean production to ensure food security.

[0003] In soybean-growing areas, pests and diseases severely impact yield and quality. Among them, the soybean cyst nematode (SCN) is one of the most destructive pathogens in global soybean production. Between 1996 and 2016, the United States suffered soybean yield losses of up to $32 billion due to SCN (Bandara et al. 2020. Dissecting the economic impact of soybean diseases in the United States over two decades. PLoS One. 2020; 15(4): e0231141). Soybean cyst nematode disease is prevalent in major soybean-producing areas of my country, and has now spread to more than 23 provinces. It is roughly estimated that China suffers economic losses exceeding $120 million annually due to SCN (Ou et al. 2008. Identification of...). Heterodera glycines Using PCR with sequence-characterized amplified region (SCAR) primers. Nematology. 10: 397-403. Typically, in mildly infected fields, the yield loss of up to 30% caused by soybean cyst nematodes is often overlooked because the above-ground parts of soybeans do not show any visible symptoms. However, under conditions such as drought, soybean yields in severely infested fields can decrease by 60-70%. Therefore, effective measures are urgently needed to mitigate the impact of soybean cyst nematodes on soybean yield.

[0004] Currently, the main measures for controlling soybean cyst nematodes both domestically and internationally include: planting resistant varieties, crop rotation with non-host crops, chemical control, and biological control. Among these, utilizing resistant varieties is the most economical and effective measure for controlling soybean cyst nematodes. However, soybean cyst nematodes exist in multiple physiological race populations in the field, and continuous planting of a single type of resistant variety may lead to a change in the virulence of the dominant soybean cyst nematode population. Therefore, discovering new disease-resistant genes and using genetic engineering technology to create high-quality new disease-resistant soybean varieties has become an important research direction for the integrated management of soybean cyst nematode diseases.

[0005] Wall-associated kinases (WAKs) belong to the plant receptor kinase family and are involved in regulating plant perception and response to environmental signals, such as cell elongation and reproductive growth, defense responses against pathogens, and responses to abiotic stresses such as metal ions (He et al., 1996; A cell wall-associated, receptor-like protein kinase, Journal of Biological Chemistry. Kohorn et al., 1992; An Arabidopsis serine / threonine kinase homologue with anepidermal growth factor repeat selected in yeast for its specificity for athylakoid membrane protein, Proceedings of the National Academy of Sciences). Current research confirms that WAK genes are involved in crop disease resistance processes, such as in rice. OsWAK1OsWAK1 plays an important role in rice blast disease resistance (Li H et al., A novel wall-associated receptor-like protein kinase gene, OsWAK1, plays important roles in rice blast disease resistance, Plantmolecular biology, 2009); The interaction between cotton WAKL and DnaJ proteins protects against Verticillium wilt infection (Feng H et al., A cotton WAKL protein interacted with a DnaJ protein and was involved in defense against...). Verticillium dahlia , International Journal of Biological Macromolecules, 2021; GmWAK1 is involved in soybean defense against Phytophthora soybean, the pathogen causing root rot (Zhao M et al., 2023; GmWAK1, Novel Wall-Associated Protein Kinase, Positively Regulates Response of Soybean to Phytophthora sojae (Infection. International Journal of Molecular Sciences). However, the application of soybean cell wall-associated kinases in the fight against soybean cyst nematode disease has not yet been discovered. Summary of the Invention

[0006] To identify genes in soybeans that possess resistance to soybean cyst nematode disease, and to utilize these genes to enhance soybean's resistance to the disease and cultivate new soybean varieties resistant to soybean cyst nematode disease, this invention discovers... (The sentence is incomplete and requires further context to be fully translated.) GmWAK9 The gene was significantly induced by soybean cyst nematode, as well as by the plant hormone salicylic acid (SA) and plant cell wall component oligogalacturonic acid (OGs); it was further cloned from soybean. GmWAK9 Genes, constructing a system containing GmWAK9 Gene recombinant expression vectors were then used to obtain Agrobacterium-mediated transformation. GmWAK9 Gene overexpression in soybean roots was demonstrated by inoculation with soybean cyst nematodes. GmWAK9 Overexpression of the gene can enhance the resistance of soybean to soybean cyst nematode.

[0007] To solve the above-mentioned technical problems and achieve the corresponding technical effects, the present invention provides the following technical solution:

[0008] The first objective of this invention is to provide a soybean GmWAK9 Application of genes in improving the resistance of soybeans to soybean cyst nematode disease, wherein the soybean GmWAK9 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0009] The second objective of this invention is to provide a soybean GmWAK9 The application of genes in breeding soybean varieties resistant to soybean cyst nematode disease, the soybean GmWAK9 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0010] In one embodiment of the present invention, soybeans GmWAK9 The gene encodes the amino acid sequence as described in SEQ ID NO.2.

[0011] The third object of the present invention is to provide a product containing the above-mentioned soybeans. GmWAK9 Application of gene recombinant vectors in improving soybean resistance to soybean cyst nematode disease.

[0012] The fourth object of the present invention is to provide a product containing the above-mentioned soybeans. GmWAK9 Application of gene recombinant vectors in breeding soybean varieties resistant to soybean cyst nematode disease.

[0013] The fifth object of the present invention is to provide a product containing the above-mentioned soybeans. GmWAK9 Application of recombinant bacteria in improving soybean resistance to soybean cyst nematode disease.

[0014] The sixth object of the present invention is to provide a soybean containing the above-mentioned soybean. GmWAK9 Application of recombinant bacteria in breeding soybean varieties resistant to soybean cyst nematode disease.

[0015] In one embodiment of the present invention, the recombinant bacteria includes Agrobacterium.

[0016] The seventh objective of this invention is to provide a method for improving the resistance of soybean to soybean cyst nematode disease, the method comprising constructing a soybean product containing the above-mentioned soybean... GmWAK9 Gene recombination vectors are used to transform the recombinant vectors into the soybean genome.

[0017] In one embodiment of the present invention, the expression vector used to construct the recombinant vector is pG2RNAi2.

[0018] An eighth object of the present invention is to provide a formulation for improving the resistance of soybean to soybean cyst nematode disease, the active ingredient of the formulation comprising the above-mentioned soybean GmWAK9 Gene recombination vectors.

[0019] The beneficial effects of this invention are:

[0020] This invention first discovered through qRT-PCR experiments GmWAK9 The gene was significantly induced by soybean cyst nematode, as well as the defense hormone SA and wall-associated substances OGs, and was cloned from soybean Willam 82. GmWAK9 The gene was overexpressed in soybean roots by constructing an overexpression vector and using Agrobacterium-mediated transformation. GmWAK9 Gene overexpression in soybean roots. Then to... GmWAK9 Soybean roots overexpressing the gene were inoculated with soybean cyst nematodes to induce stress on soybean cyst nematodes. GmWAK9 Observations of the development of soybean cyst nematodes and the number of nematodes at different instars in soybean roots with gene overexpression revealed... GmWAK9 Gene overexpression slowed the development of soybean cyst nematodes in soybean roots and reduced the number of soybean cyst nematodes at all ages. Further statistical analysis... GmWAK9 Overexpression of the gene increased the number of soybean cysts on the surface of soybean roots, and it was found that... GmWAK9 Gene overexpression significantly reduces the number of root surface sporangia. Furthermore, this invention discovered... GmWAK9 Overexpression of the gene can enhance the resistance of soybean to soybean cyst nematode disease, significantly reduce the incidence of disease in the host due to nematode infection, and thus enhance the soybean's resistance to soybean cyst nematode.

[0021] This invention is the first to discover the soybean cell wall-associated receptor kinase gene. GmWAK9 This study enhanced soybean resistance to soybean cyst nematode, providing a theoretical basis for breeding soybean varieties resistant to cyst nematode disease. Through hybridization or genetic transformation... GmWAK9 When applied to soybean breeding, it can improve the disease resistance of soybean varieties, thereby reducing diseases and achieving the goal of increasing and stabilizing yields. GmWAK9 Genes have potential applications as genetic engineering targets in the creation and improvement of soybean nematode-resistant varieties. Attached Figure Description

[0022] Figure 1 This is a flowchart illustrating the overall research approach of this invention.

[0023] Figure 2 For qRT-PCR analysis after inoculation with soybean cyst nematodes GmWAK9 A graph showing gene expression in different soybean varieties; among which, Figure 2 In the figure, A represents the result after inoculation with soybean cyst nematodes. GmWAK9 Figure showing the results of relative expression level analysis of the gene at different time points in the disease-resistant soybean variety HN531. Figure 2B in the text refers to the inoculation with soybean cyst nematodes. GmWAK9 Figure showing the relative expression levels of the gene at different time points in the susceptible soybean variety DS1; * indicates statistical significance. p <0.05;

[0024] Figure 3 For qRT-PCR analysis of the disease-susceptible soybean variety DS1 GmWAK9 The graph shows the gene expression results under SA and OGs treatment; among them... Figure 3 In the text, A represents the soybean variety DS1 susceptible to disease. GmWAK9 The results of gene expression analysis under SA treatment are shown in the figure. Figure 3 In the text, B represents the soybean variety DS1 susceptible to disease. GmWAK9 Figure showing the results of gene expression analysis under OGs treatment; * indicates statistical significance. p <0.05;

[0025] Figure 4 For identification by agarose gel electrophoresis GmWAK9 The result of gene coding region amplification products; where M is the marker, and 1 and 2 are... GmWAK9 Gene amplification products;

[0026] Figure 5 The image shows the results of agarose gel electrophoresis identification of the recombinant plasmid pG2RNAi-GmWAK9-GFP; where M is the marker, 1 and 2 are DNA amplification products of colony PCR performed using *E. coli* transformed with the empty plasmid pG2RNAi2 as a template (negative control), and 3 and 4 are colony PCR results of *E. coli* transformed with the recombinant plasmid pG2RNAi-GmWAK9-GFP. GmWAK9 Amplification products;

[0027] Figure 6 for GmWAK9 The identification results of positive root systems with gene overexpression are shown in the figure; among them, Figure 6 In the image, A represents the fluorescence of a positive root (control) of Agrobacterium rhizogenes K599 after inoculation with the empty plasmid pG2RNAi, under a fluorescent protein excitation light source. Figure 6 B in the image shows the fluorescence of positive roots of Agrobacterium rhizogenes K599 after being transfected with the recombinant plasmid pG2RNAi-GmWAK9-GFP under a fluorescent protein excitation light source.

[0028] Figure 7 Under the stress of soybean cyst nematode GmWAK9 A graph showing the development of soybean cyst nematodes and the statistical results of nematode numbers at different instars in soybean roots with overexpressed genes; among which, Figure 7 In the image, A represents the result of fuchsin staining to observe soybean cyst nematode stress. GmWAK9A diagram showing the developmental stages of soybean cyst nematodes at different instars in soybean roots with overexpressing genes. Figure 7 B in the text refers to the stress caused by soybean cyst nematodes. GmWAK9 The graph shows the statistical results of the number of soybean cyst nematodes at different ages in soybean roots overexpressing the gene; the Empty vector represents soybean root development (control) expressing the empty plasmid, and OE-GmWAK9 represents... GmWAK9 Soybean root system with gene overexpression; ** indicates statistical significance. p <0.01;

[0029] Figure 8 Under the stress of soybean cyst nematode GmWAK9 A statistical result of the number of soybean cysts on the surface of soybean roots due to gene overexpression; among which, Figure 8 Figure A shows the statistical results of the number of soybean cysts on the surface of each soybean root system. Figure 8 In the graph, B represents the statistical results of the number of soybean cyst nematodes per gram of root surface; Empty vector represents soybean root development (control) expressing empty plasmid; OE-GmWAK9 represents... GmWAK9 Soybean root system with gene overexpression; ** indicates statistical significance. p <0.01, *** indicates statistical significance p <0.001. Detailed Implementation

[0030] The present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. These embodiments are intended to facilitate a better understanding of the invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional experimental methods in the art. Unless otherwise specified, the pharmaceuticals, reagents, and materials used in the following embodiments can be purchased commercially.

[0031] The soybean cyst nematode resistant variety Heinong 531 (HN531) used in this invention was provided by the Soybean Research Institute of Heilongjiang Academy of Agricultural Sciences. The soybean cyst nematode susceptible variety Dongsheng 1 (DS1) was provided by the Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences. The soybean variety Willam82 was provided by the Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences. Soybean cyst nematode physiological race 5 (SCN5) is disclosed in the following article: You J, et al. 2021; FMRFamide-Like Peptide 22Influences the Head Movement, Host Finding, and Infection of Heteroderaglycines. Front. Plant Sci. 12:673354.

[0032] Soybeans in this invention GmWAK9 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and it encodes the amino acid sequence shown in SEQ ID NO.2.

[0033] SEQ ID NO.1:

[0034]

[0035] SEQ ID NO.2:

[0036] *

[0037] The research approach of this invention is as follows: Figure 1 The flowchart is shown in the image.

[0038] Example 1: qRT-PCR analysis of soybean cyst nematode inoculation GmWAK9 Gene expression in different soybean varieties

[0039] Twelve days after seed germination, the roots of soybean cyst nematode-resistant variety Heinong 531 (HN531) and susceptible variety Dongsheng 1 (DS1) were infected with second-instar larvae (J2) of physiological race 5 (SCN5) of soybean cyst nematode. A control group and a treatment group were set up. In the treatment group, 500 J2 larvae per seed bag were inoculated with a prepared suspension of J2 larvae. For 48 hours after inoculation, the seed bags were placed horizontally in the dark to help the nematodes establish an infection relationship with the roots. An equal volume of sterile water was added to the control group. After 48 hours, the seed bags were placed vertically on a support and cultured in a light incubator. It was important to replenish the water in the seed bags regularly to maintain a humid environment. Four sampling time points were set up in the experiment. Root samples were taken from the treatment group and the control group on the 3rd, 5th, 8th and 12th day after infection. The treatment group selected the main root containing the feeding site of the nematode for sampling, and removed the root tip and lateral roots. The control group selected root samples from the same location.

[0040] The specific steps for extracting total RNA from soybean root samples are as follows: Fresh root samples were frozen in liquid nitrogen and the grinding container was pre-cooled. The plant samples were ground thoroughly into powder. The samples were transferred to sterile centrifuge tubes and lysis buffer was quickly added to fully lyse the samples. The RNA was extracted using the TIANGEN RNAprep Pure extraction kit according to its instructions.

[0041] First-strand cDNA was synthesized using the 5×HiScript III qRT SuperMix (Vazyme) kit. The reaction system is shown in Table 1. The reaction program was 37℃ for 15 min and 85℃ for 5 sec. After the reaction, the system was diluted 5-fold to a final volume of 100 µL.

[0042] Table 1. cDNA First-Strand Synthesis Reaction System

[0043]

[0044] Note: The RNA sample volume needs to be calculated based on the concentration obtained from RNA extraction.

[0045] After reversing cDNA, quantitative fluorescence detection was performed. GmWAK9 Changes in gene expression levels were analyzed using ChamQ SYBR qPCRMaster Mix (Novizan) on a Light Cycle 480II amplification system. The qRT-PCR reaction system is shown in Table 2, and the primer sequences are shown in Table 3. Gene expression levels were calculated using a 2-1... -ΔΔCT The method. See qRT-PCR results. Figure 2 .

[0046] Table 2 qRT-PCR reaction system

[0047]

[0048] Table 3 qRT-PCR primer sequence information

[0049]

[0050] like Figure 2 A in the data shows that 5 days after HN531 was inoculated with nematodes, GmWAK9 Gene expression was significantly upregulated in nematode-induced expression, showing a trend of initial increase followed by decrease. In DS1, soybean cyst nematode infection could induce... GmWAK9 Expression was upregulated, especially at day 3 of infection when the expression level was highest. GmWAK9 The expression level of the gene decreased with prolonged stress time. Figure 2 (B in the middle).

[0051] Example 2: qRT-PCR analysis GmWAK9 Gene expression under SA and OG treatment

[0052] DS1 soybean roots were treated with plant hormones salicylic acid (SA) and oligogalacturonic acid (OGs). The control group received sterile water, while the treatment groups received 100 µM SA and 50 µg / mL OGs solutions, respectively, for 1 h, 6 h, 12 h, and 24 h. Root samples were taken in triplicate at each time point, and quantitative fluorescence determination of the levels of salicylic acid and OGs in the roots of each treatment group was performed. GmWAK9 Changes in gene expression levels (method as in Example 1). Results are as follows: Figure 3 As shown in A, SA treatment for 12 h and 24 h can induce basal secretion in soybean roots. GmWAK9 Gene expression was significantly upregulated ( p <0.05), while OGs treatment for 24 h GmWAK9 Genes can be significantly induced to express ( Figure 3 (B in the middle).

[0053] Example 3: Soybeans GmWAK9 Gene cloning and containing GmWAK9 Construction of gene overexpression vectors

[0054] (1) Soybeans GmWAK9 Full-length gene cloning

[0055] Using total RNA from the roots of soybean variety Willam82 as a template for reverse transcription to synthesize the first strand of cDNA, according to GmWAK9 Primers were designed based on the gene coding sequence (see Table 4) to amplify the gene. GmWAK9 Gene sequences were analyzed using agarose gel electrophoresis. GmWAK9The size of the amplified product fragments of the gene coding sequence was identified, and the identification results are as follows: Figure 4 As shown. This gene has a complete coding sequence, with a full length of 2220 bp, as shown in SEQ ID NO.1.

[0056] Table 4 GmWAK9 PCR primer sequence information for the gene

[0057]

[0058] (2) GmWAK9 Construction of overexpression vectors

[0059] Soybean RNA was extracted and reverse transcribed into cDNA. Using the cDNA as a template, primers containing Swa I and Avr II restriction sites (upstream primer nucleotide sequence shown in SEQ ID NO.7, downstream primer nucleotide sequence shown in SEQ ID NO.8) were used to cleave the soybean. GmWAK9 Genes are amplified.

[0060] SEQ ID NO.7:

[0061] TATAATTTAAATATGGGATTGAATGTCCCG

[0062] SEQ ID NO.8:

[0063] TATACCTAGGTTAAGCGTAATCTGGAACATCGTATGGGTATCTTCCATCATCGAAAGC

[0064] Will GmWAK9 The amplified product of the gene was inserted upstream of GFP in the expression vector pG2RNAi2 (GenBank: KT954097) to obtain the recombinant plasmid pG2RNAi-GmWAK9-GFP. This plasmid was then transformed into competent E. coli cells and amplified. PCR amplification revealed that it was similar to... GmWAK9 Gene sequences of the same size, such as Figure 5 .

[0065] Example 4: GmWAK9 Genetically modified soybean root construction

[0066] The overexpression vector obtained in Example 3 was extracted from Escherichia coli and introduced into Agrobacterium rhizogenes K599 competent cells using the freeze-thaw method. Specifically, 0.01-1 µg of plasmid was added to each 100 µL of K599 competent cells, and the cells were placed in ice for 5 min, liquid nitrogen for 5 min, water bath at 37°C for 5 min, and ice bath for 5 min in sequence. After that, the cells were taken out and placed at room temperature, and LB liquid medium was added for incubation at 28°C. Then, positive clones were picked from the plate to verify the transformation results.

[0067] Five days after soybean seed germination (before cotyledons open), plant tissue containing the portion above the hypocotyl was harvested using a sterilized scalpel. Transgenic rooting was obtained using Agrobacterium-mediated transformation of the plant tissue. The specific procedures were as follows: K599 Agrobacterium for rooting, containing both an empty plasmid and a recombinant plasmid pG2RNAi-GmWAK9-GFP, was activated, and a bacterial suspension (OD2N) was prepared. 600nm To achieve a growth rate of 0.5-0.6%, the hypocotyl section of soybean seedlings was immersed in Agrobacterium-mediated transformation solution and cultured overnight in a dark, sealed environment. The following day, after washing twice with sterile water, the tissue in contact with the bacterial solution was immersed in sterile water and cultured under light for 1 day. The next day, the plants were transplanted into moist, sterile vermiculite and cultured in an incubator for 6-7 days. Root selection was performed using a LUYOR-3415RG fluorescent protein excitation light source (blue excitation light), retaining positive roots with green fluorescent signals at the root tips and removing roots without fluorescent signals (see...). Figure 6 ).

[0068] Example 5: Overexpression GmWAK9 Application in soybean resistance to soybean cyst nematode

[0069] To observe the effects of soybean cyst nematode treatment GmWAK9 To investigate the resistance of soybean root systems overexpressing the gene (OE-GmWAK9 group) to soybean cyst nematode, this invention involves inoculating OE-GmWAK9 soybean roots with the 5th physiological race of soybean cyst nematode, at a rate of 400 J2 nematodes of SCN5 per soybean plant. The effects of soybean cyst nematode stress were then observed. GmWAK9 The development of nematodes in soybean roots with overexpressing genes (observed by fuchsin staining) and the number of nematodes at each instar were analyzed. Results are as follows: Figure 7 As shown, nematode development in soybean roots of the OE-GmWAK9 group was slower compared to the empty vector control group. Figure 7 (A) Further statistical analysis of nematode numbers at each instar showed that the number of J2 nematodes in the hairy roots of the OE-GmWAK9 group was reduced, and the number of J3 stage nematodes was significantly lower than that in the empty vector control group. Figure 7 (B in the text) Explanation GmWAK9Gene overexpression can reduce the damage caused by soybean cyst nematodes by affecting their development, thereby improving soybean resistance to soybean cyst nematodes.

[0070] Furthermore, this invention provides protection against soybean cyst nematode stress. GmWAK9 The number of soybean cysts on the surface of soybean roots overexpressing the gene was statistically analyzed. The results showed that the number of soybean root cysts in the OE-GmWAK9 group was less than half that of the Emptyvector control group, and the number of cysts per gram of root was significantly reduced, lower than that of the control group. Figure 8 ).visible, GmWAK9 After gene overexpression, soybean plants exhibited resistance to soybean cyst nematode.

[0071] This invention was supported by the Jilin Provincial and Chinese Academy of Sciences Science and Technology Cooperation High Technology Industrialization Special Fund Project (Project No.: 2024SYHZ0051): Demonstration and Application of Crop Growth-Promoting and Stress-Resistant Microbial Agent Technology.

[0072] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A type of soybean GmWAK9 The application of genes in improving soybean resistance to soybean cyst nematode disease is characterized by, soybeans GmWAK9 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. A type of soybean GmWAK9 The application of genes in breeding soybean varieties resistant to soybean cyst nematode disease is characterized by, soybeans GmWAK9 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

3. A type of soybean comprising the soybean described in claim 1 GmWAK9 Application of gene recombinant vectors in improving soybean resistance to soybean cyst nematode disease.

4. A type of soybean containing the soybean described in claim 1 GmWAK9 Application of gene recombinant vectors in breeding soybean varieties resistant to soybean cyst nematode disease.

5. A type of soybean comprising the soybean of claim 1 GmWAK9 Application of recombinant bacteria in improving soybean resistance to soybean cyst nematode disease.

6. A type of soybean comprising the soybean of claim 1 GmWAK9 Application of recombinant bacteria in breeding soybean varieties resistant to soybean cyst nematode disease.

7. The application according to claim 5 or 6, characterized in that, Recombinant bacteria include Agrobacterium.

8. A method for improving the resistance of soybeans to soybean cyst nematode disease, characterized in that, Constructing a structure containing soybeans as described in claim 1 GmWAK9 Gene recombination vectors are used to transform the recombinant vectors into the soybean genome.

9. The method according to claim 8, characterized in that, The expression vector used to construct the recombinant vector was pG2RNAi2.

Images