A citrus extract, a method for preparing the same, and an application thereof

By preparing citrus extracts with specific components, the problem of the unknown impact of citrus fruit extracts on oral ulcers was solved, and the effects of reducing oral ulcer pain sensitivity, reducing ulcer area and reducing inflammation were achieved. It is specifically used in the field of oral ulcer drugs.

CN118490702BActive Publication Date: 2025-10-21ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410599098.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-15
Publication Date
2025-10-21
Estimated Expiration
2044-05-15

AI Technical Summary

Technical Problem

There is no prior art on the effects of citrus fruit extracts on oral ulcers, especially the effects of citrus flavonoids on the ulcer area and pain sensitivity of oral ulcers.

Method used

A citrus extract containing components in specific concentrations is prepared, including vecinin-2, 6,8-dicarbonyl glucoside, naringin, hesperidin, neohesperidin, melissa officinalis, isosweet orange flavonoids, 4'-hydroxy-5,6,7,8,3'-pentamethoxyflavonoids, sweet orange flavonoids, dihydronobiletin, nobiletin, tratin, 3-methoxynobiletin, tangeretin and 5-demethylnobiletin. The citrus extract is obtained through the steps of ethanol-water extraction, concentration, solid-phase extraction and the like, and is used for preparing a drug for reducing the pain sensitivity, ulcer area and inflammation of oral ulcers.

Benefits of technology

Citrus extract significantly reduced the pain sensitivity of oral ulcers, reduced the ulcer area, and lowered the inflammatory expression of oral ulcers, achieving effective relief of oral ulcers by reducing the expression of inflammatory genes and proteins.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118490702B_ABST
    Figure CN118490702B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of active ingredient extraction, and particularly relates to a citrus extract, a preparation method and application thereof. The citrus extract provided by the application can reduce the pain sensitivity of oral ulcer, reduce the ulcer area, and reduce the inflammatory expression of oral ulcer due to the reasons such as reducing the expression of inflammatory genes and proteins and reducing the accumulation of inflammatory factors.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of effective component extraction, and particularly relates to a citrus extract and a preparation method and application thereof. Background Art

[0002] Citrus fruits not only provide a large amount of vitamin C, minerals and dietary fiber, but are also an important source of natural antioxidants. Among the many bioactive components of citrus fruits, flavonoids are particularly noteworthy.

[0003] Flavonoids are a class of natural compounds with significant biological activity, found widely in the plant kingdom and particularly abundant in citrus fruits. They exist in various forms, such as flavonoids, flavonols, isoflavones, and anthocyanins, each with unique chemical structures and physiological functions. Flavonoids primarily play antioxidant, anti-inflammatory, antibacterial, and growth-regulating roles in plants, making them crucial for maintaining normal plant physiological functions.

[0004] Oral ulcers, also known as canker sores, are a common oral mucosal disease. They typically manifest as small, painful ulcers or lesions on the oral mucosa, which can occur singly or multiple times. These ulcers are generally round or oval in shape, with distinct margins and covered by a white or yellow membrane, often surrounded by a red halo.

[0005] Mouth ulcers can occur for a variety of reasons, including oral trauma, infection, immune system disorders, stress, malnutrition, and side effects of certain medications or illnesses. While most mouth ulcers are benign and heal on their own within a week or two, the pain and discomfort they cause often affect patients' ability to eat, speak, and perform daily activities.

[0006] Currently, there are no reports on the effects of citrus fruit extracts on oral ulcers, especially the effects of citrus flavonoids on the ulcer area and pain sensitivity of oral ulcers are still unknown. Summary of the Invention

[0007] In order to solve the problems existing in the prior art, the present invention provides a citrus extract and its preparation method and application. The citrus extract provided by the present invention can reduce the pain sensitivity of oral ulcers, reduce the ulcer area, and reduce the inflammatory expression of oral ulcers.

[0008] In order to achieve the above objectives, the present invention provides the following technical solutions.

[0009] The present invention provides a citrus extract, wherein the citrus extract comprises the following components at the following concentrations:

[0010] Vetsenin-2: 0.48~1.95mg / g;

[0011] Jinshengcaosu 6,8-dicarbonyl-glucoside: 0.44~1.74mg / g;

[0012] Naringin: 0.16~0.85mg / g;

[0013] Hesperidin: 6.35~16.5mg / g;

[0014] Neohesperidin: 0.84~1.33mg / g;

[0015] Melissa officinalis: 0.15~0.75mg / g;

[0016] Isosweet orange flavonoids: 0.09~0.37mg / g;

[0017] 4'-Hydroxy-5,6,7,8,3'-pentamethoxyflavone: 0.04-0.15 mg / g;

[0018] Sweet orange flavonoids: 0.55~2.43mg / g;

[0019] Dihydronobiletin: 0.07~0.31mg / g;

[0020] Nobiletin: 7.78~13.03mg / g;

[0021] Tratin: 0.17~0.73mg / g;

[0022] 3-methoxynobiletin: 0.06-0.3 mg / g;

[0023] Tangeretin: 5.25~16.61mg / g;

[0024] 5-demethylnobiletin: 0.85-2.41 mg / g;

[0025] 5-Hydroxy-7,8,3',4'-tetramethoxyflavone: 0.15~0.61mg / g.

[0026] The present invention also provides a method for preparing the citrus extract, comprising the following steps:

[0027] The freeze-dried citrus powder is extracted with an ethanol aqueous solution to obtain an extract;

[0028] Concentrating the extract to remove ethanol from the extract to obtain an aqueous phase;

[0029] After the aqueous phase is subjected to solid phase extraction, the obtained solid phase is dried to obtain a citrus extract.

[0030] Preferably, the volume concentration of the ethanol aqueous solution is 80-100%; the usage ratio of the citrus freeze-dried powder to the ethanol aqueous solution is 1 g:20 mL.

[0031] Preferably, the extraction is ultrasonic extraction, the power of the ultrasonic extraction is 40 to 80 W, the time is 15 to 45 minutes, and the number of ultrasonic extractions is 3 times.

[0032] Preferably, after the extraction, centrifugation is further performed, and the centrifugation speed is 8000-12000 rpm and the time is 3-6 minutes.

[0033] Preferably, the extraction column of the solid phase extraction is C18 column.

[0034] Preferably, the steps of solid phase extraction are activation, column equilibration, washing, sample loading and elution performed in sequence;

[0035] The activation reagent is methanol; during the activation, the amount of methanol used is 2BV;

[0036] The reagent for the column equilibration treatment is double distilled water; during the column equilibration treatment, the amount of double distilled water used is 2BV;

[0037] When loading the sample, the sample volume is 0.75BV;

[0038] The elution reagent is double distilled water; during the elution, the amount of double distilled water used is 20BV;

[0039] The elution reagent is methanol; during the elution, the amount of methanol used is 1BV.

[0040] The present invention also provides the use of the citrus extract or the citrus extract obtained by the preparation method in preparing oral ulcer medicine.

[0041] Preferably, the oral ulcer medication includes a medication that reduces pain sensitivity of oral ulcers, a medication that reduces ulcer area, or a medication that reduces inflammation of oral ulcers.

[0042] The citrus extract provided by the present invention can reduce the pain sensitivity of oral ulcers, reduce the ulcer area, and reduce the inflammatory expression of oral ulcers due to the reasons such as reducing the expression of inflammatory genes and proteins and reducing the accumulation of inflammatory factors. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 Liquid phase spectra of extracts from different varieties of citrus;

[0044] Figure 2 Effects of oral administration of citrus extract on mouth wiping time (pain index) (A) and oral inflammatory factors TNF-α (B), IL-1β (C), and IL-6 (D) in rats with oral ulcer model;

[0045] Figure 3 Effects of oral administration of citrus extract on inflammatory genes TNF-α(A), IL-1β(B), IL-6(C) and Jak-Stat pathway(D~I) in rats with oral ulcer model;

[0046] Figure 4 Effects of oral administration of citrus flavonoid monomers on mouth wiping time (pain index) (A) and oral inflammatory factors TNF-α (B), IL-1β (C), and IL-6 (D) in rats with oral ulcer model;

[0047] Figure 5 The effects of oral administration of citrus flavonoid monomers on the inflammatory genes TNF-α (A), IL-1β (B), IL-6 (C) and Jak-Stat pathway (D~I) in rats with oral ulcer model. DETAILED DESCRIPTION

[0048] The present invention provides a citrus extract, wherein the citrus extract comprises the following components at the following concentrations:

[0049] Vetsenin-2: 0.48~1.95mg / g;

[0050] Jinshengcaosu 6,8-dicarbonyl-glucoside: 0.44~1.74mg / g;

[0051] Naringin: 0.16~0.85mg / g;

[0052] Hesperidin: 6.35~16.5mg / g;

[0053] Neohesperidin: 0.84~1.33mg / g;

[0054] Melissa officinalis: 0.15~0.75mg / g;

[0055] Isosweet orange flavonoids: 0.09~0.37mg / g;

[0056] 4'-Hydroxy-5,6,7,8,3'-pentamethoxyflavone: 0.04-0.15 mg / g;

[0057] Sweet orange flavonoids: 0.55~2.43mg / g;

[0058] Dihydronobiletin: 0.07~0.31mg / g;

[0059] Nobiletin: 7.78~13.03mg / g;

[0060] Tratin: 0.17~0.73mg / g;

[0061] 3-methoxynobiletin: 0.06-0.3 mg / g;

[0062] Tangeretin: 5.25~16.61mg / g;

[0063] 5-demethylnobiletin: 0.85-2.41 mg / g;

[0064] 5-Hydroxy-7,8,3',4'-tetramethoxyflavone: 0.15~0.61mg / g.

[0065] In the present invention, each concentration in the citrus extract refers to the dry weight concentration.

[0066] The present invention also provides a method for preparing the above-mentioned citrus extract, comprising the following steps:

[0067] The freeze-dried citrus powder is extracted with an ethanol aqueous solution to obtain an extract;

[0068] Concentrating the extract to remove ethanol from the extract to obtain an aqueous phase;

[0069] After the aqueous phase is subjected to solid phase extraction, the obtained solid phase is dried to obtain a citrus extract.

[0070] The invention adopts ethanol aqueous solution to extract citrus freeze-dried powder to obtain an extract.

[0071] In the present invention, the volume concentration of the ethanol aqueous solution is preferably 80% to 100%, more preferably 95%. In the present invention, the dosage ratio of the citrus freeze-dried powder to the ethanol aqueous solution is preferably 1 g:20 mL.

[0072] In the present invention, the extraction is preferably ultrasonic extraction, and the power of the ultrasonic extraction is preferably 40 to 80 W, more preferably 60 W; the time is preferably 15 to 45 min, more preferably 30 min.

[0073] In the present invention, after the extraction, centrifugation is preferably further performed. The rotation speed of the centrifugation is preferably 8000 to 12000 rpm, more preferably 10000 rpm, and the time is preferably 3 to 6 minutes, more preferably 5 minutes.

[0074] After obtaining the extract, the present invention concentrates the extract to remove ethanol in the extract to obtain an aqueous phase.

[0075] In the present invention, the concentration is preferably performed by rotary evaporation.

[0076] After obtaining the aqueous phase, the present invention performs solid phase extraction on the aqueous phase, and then dries the obtained solid phase to obtain the citrus extract.

[0077] In the present invention, the steps of solid phase extraction are activation, column equilibration, washing, sample loading and elution performed in sequence;

[0078] The activation reagent is methanol; during the activation, the amount of methanol used is 2BV;

[0079] The reagent for the column equilibration treatment is double distilled water; during the column equilibration treatment, the amount of double distilled water used is 2BV;

[0080] When loading the sample, the sample volume is 0.75BV;

[0081] The elution reagent is double distilled water; during the elution, the amount of double distilled water used is 20BV;

[0082] The elution reagent is methanol; during the elution, the amount of methanol used is 1BV.

[0083] The present invention also provides the use of the citrus extract or the citrus extract obtained by the preparation method in preparing oral ulcer medicine.

[0084] In the present invention, the oral ulcer medicine preferably includes a medicine that reduces the pain sensitivity of oral ulcers, a medicine that reduces the ulcer area, or a medicine that reduces the inflammation of oral ulcers.

[0085] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0086] Example 1

[0087] Citrus fruits without mechanical injuries and pests and diseases are selected, washed, freeze-dried and then ground to obtain citrus freeze-dried powder, which is stored for future use.

[0088] Weigh 1 g of citrus freeze-dried powder and add 20 mL of 95% ethanol aqueous solution to ultrasonically extract at 25°C for 30 minutes. Centrifuge at 10,000 rpm for 5 minutes, collect the supernatant, and re-extract the precipitate with 20 mL of 95% ethanol. Repeat this process three times. Remove the ethanol phase from the supernatant by vacuum rotary evaporation, and collect the aqueous phase.

[0089] use Solid phase extraction and impurity removal were performed on a C18 column, and the specific steps were as follows: 2 column volumes (Bed volume, BV) of methanol were used to activate the column, 2BV of double-distilled water was used to balance the column, 0.75BV of aqueous liquid was loaded, 20BV of double-distilled water was used to remove sugar and acid impurities, 1BV of chromatographic methanol was used for elution, the eluate was collected, and the eluate was dried to obtain the citrus extract.

[0090] The present invention also uses UPLC-HRMS to perform qualitative and quantitative detection on the collected eluate, using WatersBEH C 18An Acquity UPLC column (2.1×150 mm) was used as the stationary phase; the mobile phases were water (mobile phase A) and acetonitrile (mobile phase B). The gradient elution program was: 0–5 min, 20% B; 5–8 min, 20–34% B; 8–20 min, 34–60% B; 20–22 min, 60–100% B; 22–23 min, 100% B; 23–24 min, 100–20% B; 24–25 min, 20% B. The scanning wavelength was 280 nm, the flow rate was 0.3 mL / min, the column temperature was 25°C, and the sample load was 2 μL. Mass spectrometry conditions: UPLC-Triple-TOF 5600+ time-of-flight liquid chromatography-mass spectrometry: positive and negative ion scan modes; scan range: m / z 100-1500; nebulizer gas (GS1): 55 psi; nebulizer gas (GS2): 55 psi; curtain gas (CUR): 35 psi; ion source temperature (TEM): 600°C (positive) 550°C (negative); ion source voltage (IS): 5500 V (positive)-4500 V (negative); primary scan: declustering voltage (DP): 100 V; focusing voltage (CE): 10 V; secondary scan: mass spectrometry data were collected using TOF MS-Product Ion-IDA mode with a CID energy of 40±20 eV. Before injection, mass axis calibration was performed using a CDS pump to reduce the mass axis error to less than 2 ppm.

[0091] Among them, vicenin 2, narirutin, hesperidin, neohesperidin, didymin, isosinensetin, sinensetin, nobiletin, tangeretin and 5-demethylnobiletin were compared with standards, and the chromatographic peak area standard curve method was used for content determination. The contents of the remaining compounds were determined relative to the peak area of ​​nobiletin.

[0092] Among them, vicenin 2, stellarin 2, narirutin, hesperidin, neohesperidin, didymin, isosinensetin, 4'-hydroxy-5,6,7,8,3'-pentamethoxyflavone, sinensetin The liquid chromatography information of dihydronobiletin, nobiletin, ternatin, 3-methoxynobiletin, tangeretin, 5-demethylnobiletin and 5-hydroxy-7,8,3',4'-tetramethoxyflavone is shown in Table 1. Figure 1 This is the liquid chromatography spectrum of citrus peel extracts of different varieties.

[0093] The quantitative results are shown in Tables 2 to 4.

[0094] Table 1 Liquid chromatography information of each component in the extract

[0095]

[0096]

[0097] Table 2 Quantitative results of each component in the extract

[0098]

[0099]

[0100] Table 3 Quantitative results of each component in the extract

[0101]

[0102] Table 4 Quantitative results of each component in the extract

[0103]

[0104]

[0105] Note: The results in Tables 2 to 4 are expressed as mean ± SD (n = 3). Different superscript letters indicate that the substance is significantly different among different varieties (p < 0.05).

[0106] After testing, the content range of citrus extract is as follows: vicenin 2: 0.48~1.95mg / g DW, stellarin 2: 0.44~1.74mg / g DW, narirutin: 0.16~0.85mg / g DW, hesperidin: 6.35~16.5mg / g DW, neohesperidin: 0.84~1.33mg / g DW, didymin: 0.15~0.75mg / g DW, isosinensetin: 0.09~0.37mg / g DW, 4'-hydroxy-5,6,7,8,3'-pentamethoxyflavone: 0.04-0.15 mg / g DW, sinensetin: 0.55-2.43 mg / g DW, citromitin: 0.07-0.31 mg / g DW, nobiletin: 7.78-13.03 mg / g DW, ternatin: 0.17-0.73 mg / g DW, 3-methoxynobiletin: 0.06-0.3 mg / g DW, tangeretin: 5.25-16.61 mg / g DW, 5-demethylnobiletin: 0.85~2.41mg / g DW, 5-hydroxy-7,8,3',4'-tetramethoxyflavone: 0.15~0.61mg / g DW.

[0107] Example 2

[0108] 1. Test on the effect of citrus extract on reducing ulcer area:

[0109] Oral ulcer modeling: Male Wistar rats (weighing approximately 250 g) were housed at the Experimental Animal Center of Zhejiang University. The housing environment was maintained at a temperature of 21–23°C, a humidity of 55–65%, and a 12-h light-dark cycle. Rats had free access to food and water. Eight-week-old rats were anesthetized with pentobarbital (50 mg / kg, intraperitoneal injection). A filter paper (3 mm × 3 mm) soaked in 50% acetic acid was placed over the labial fornix of the lower incisors for 30 seconds. Acetic acid treatment induced significant ulcers in the treated oral mucosa starting on day 2. A control group received pentobarbital anesthesia alone, without acetic acid treatment, as a sham procedure. Citrus extract was administered orally via gavage once daily in saline containing 1% Tween 20 at a dose of 100 mg / kg body weight per day. A control group received saline containing 1% Tween 20 via gavage. Oral gavage was started on the second day after model establishment. The diameter of the ulcer was measured with a vernier caliper on the first, third, and fifth days of gavage, and the area was calculated to represent the change in ulcer area. The experimental results are shown in Table 5.

[0110] Table 5 Test results of citrus extract on reducing ulcer area

[0111]

[0112]

[0113] Note: Day 0 refers to the first day after modeling.

[0114] This example evaluated the effect of citrus extract on alleviating oral ulcers. Glacial acetic acid was used to create a model in the rat oral cavity. The results are shown in Table 5. Glacial acetic acid caused ulcers in the rat oral cavity, and the ulcer area continued to increase on the second day. The ulcer area of ​​all groups increased by 1.94 to 7.17 mm compared to the initial modeling. 2 , and there was no significant difference between the groups on the day of gavage treatment. On the third day of gavage treatment, the oral ulcer area of ​​the treatment group began to be significantly lower than that of the model group, and further decreased on the fifth day. Although the oral ulcer area of ​​the model group also decreased on the third and fifth days compared with the day of modeling and the first day of administration, it decreased by 10.16 mm respectively compared with the first day. 2 and 12.43mm 2 However, the ulcer area of ​​the treatment group decreased by 11.58 to 17.25 mm on the third and fifth days respectively compared with the first day. 2 and 15.47~21.77mm 2 All treatment groups showed significant differences on the third and fifth days. Among them, LiPeng No.2 had the best effect, reducing the ulcer area from 24.83 mm on the first day to 2 Reduced to 7.58mm 2(Day 3) and 3.06mm 2 (Day 5) The experimental results showed that citrus extracts can reduce the area of ​​oral ulcers.

[0115] 2. Effects of citrus main flavonoid monomers on the ulcer area after oral ulcer modeling

[0116] The test method is different from that of Example 2 only in that the citrus extract is replaced with the flavonoid monomers in Table 6.

[0117] Table 6 Effects of flavonoid monomers on the ulcer area after oral ulcer modeling

[0118]

[0119] The results are shown in Table 6. On the third day, the ulcer area of ​​the four polymethoxyflavonoids group was significantly reduced compared with the model group, reaching 7.94-9.67 mm. 2 On the fifth day, the ulcer area further decreased, and the ulcer area of ​​tangeretin was the smallest, which was 2.55±0.20mm. 2 The effect was more significant than that of the other treatment groups. On the other hand, although the ulcer area of ​​hesperidin decreased slightly on the third and fifth days, there was no significant difference compared with the model group.

[0120] The above results show that citrus polymethoxyflavonoids have the effect of inhibiting oral ulcers and accelerating the reduction of oral ulcer area.

[0121] Example 3

[0122] 1. Test of citrus extract on reducing pain sensitivity caused by ulcers:

[0123] Experimental methods:

[0124] The oral ulcer modeling method is described in Example 2. Pain sensitivity was assessed as follows: On the first day after treatment, oral instillation was used to assess pain levels by recording the time the rats spent wiping their mouths. A water-soluble capsaicin solution was diluted to 3% and 0.05 mL of the solution was injected into the ulcer wound surface of the rats using a syringe. Five minutes after the first application, the total time the rats spent wiping their mouths within 3 minutes was recorded. Figure 2 Effects of oral administration of citrus extract on the mouth wiping time (pain index) (A) and oral inflammatory factors TNF-α (B), IL-1β (C), and IL-6 (D) in rats with oral ulcer model. * indicates significant difference compared with the model group (p<0.05), and # indicates significant difference compared with the control group (p<0.05).

[0125] This example also records the time the rats spend wiping their mouths after being treated with water-soluble capsaicin as an indicator of pain. Figure 2 As shown in Figure A, the control group spontaneously wiped their mouths for 14.3 ± 1.5 seconds over a 3-minute period, while the model group reached 50.2 ± 7.2 seconds, indicating that modeling significantly increased oral pain sensitivity in rats. In contrast, the group treated with citrus extract experienced spontaneous mouth wiping times ranging from 15.58 to 37.54 seconds, significantly reducing oral pain sensitivity in rats.

[0126] Example 3 shows that citrus extract can reduce the sensitivity of oral ulcers to pain.

[0127] 2. Test of citrus polymethoxyflavonoids on reducing pain sensitivity caused by ulcers:

[0128] The difference between the test method and that of Example 3-1 is that the citrus extract is replaced by Figure 4 Polymethoxylated flavonoids in.

[0129] Figure 4 A shows the effect of oral administration of citrus flavonoid monomers on the mouth wiping time (pain index) of rats with oral ulcer model. * indicates significant difference from the model group (p<0.05), # indicates significant difference from the control group (p<0.05), Figure 4 As shown in Figure A, in terms of pain sensitivity, all four polymethoxyflavonoids can reduce the pain sensitivity of the rat oral cavity, while hesperidin has no significant effect on the improvement of pain sensitivity.

[0130] Example 4

[0131] 1. Test of citrus extracts on reducing inflammatory factors caused by ulcers

[0132] Experimental methods:

[0133] The oral ulcer modeling method is the same as in Example 2.

[0134] Detect gene expression using qRNA method: Total RNA was extracted using Trizol method according to the instructions. T MRT reagent Kit with gDNA Eraser removes genomic DNA and reverse transcribes to synthesize cDNA. qPCR detection was performed using the Supermix kit. The primer sequences are shown in Table 7. Each experiment was performed with three replicate wells and repeated at least three times. β-Actin was used as an internal reference, and the relative gene expression was calculated using 2 -ΔΔCt Method calculation.

[0135] Protein expression was detected using the Elisa method: TNFα, IL-1β, IL-6, Jak2, p-Jak2, Stat3, p-Stat3 and other inflammation-related Elisa assays were determined using commercial kits according to the kit instructions. The test results are shown in the table. Figure 3 , Figure 3 A to C in the figure are the expressions of three inflammatory factor genes by qPCR. Figure 3 As shown in Figures A to C, oral ulcer modeling significantly increased the expression of TNFα, IL-1β, and IL-6, while citrus extracts significantly inhibited the expression of the three inflammatory factor genes; Figure 3 Figures D to I show the expression of Jak2 and Stat3 genes and proteins. From 4D to I, we can see that oral ulcers significantly increase Jak2 and Stat3 gene expression, as well as the expression and phosphorylation levels of Jak2 and Stat3 proteins. Citrus extract significantly inhibits Jak2 and Stat3 gene expression and alleviates Jak2 and Stat3 protein expression and phosphorylation levels.

[0136] Table 7 Primers used in qPCR experiments

[0137] Gene Sequence information serial number TNFα ForwardPrimer(5'to3') CGGGCAGGTCTACTTTGGAG SEQ ID NO.1 TNFα ReversePrimer(3'to5') ACCCTGAGCCATAATCCCCT SEQ ID NO.2 IL-1β ForwardPrimer(5'to3') AGTAAGTTCCTCTCTGCAAGAGACT SEQ ID NO.3 IL-1β ReversePrimer(3'to5') CACTAGGTTTGCCGAGTAGATCTC SEQ ID NO.4 IL-6 ForwardPrimer(5'to3') GAGACTTCCATCCAGTTGCCT SEQ ID NO.5 IL-6 ReversePrimer(3'to5') CAGGTCTGTTGGGAGTGGTA SEQ ID NO.6 Jak2 ForwardPrimer(5'to3') AAGATGCTTTCTGGGTTGG SEQ ID NO.7 Jak2 ReversePrimer(3'to5') ACATTGTCTAAGAGGGAGCAG SEQ ID NO.8 Stat3 ForwardPrimer(5'to3') ACCTCCAGGACGACTTTGAT SEQ ID NO.9 Stat3 ReversePrimer(3'to5') TGTCTTCTGCACGTACTCCA SEQ ID NO.10 β-Actin ForwardPrimer(5'to3') GGCTGTATTCCCCTCCATCG SEQ ID NO.11 β-Actin ReversePrimer(3'to5') CCAGTTGGTAACAATGCCATGT SEQ ID NO.12

[0138] Oral ulcer is a kind of oral inflammation, and the enrichment of inflammatory factors is also a significant feature. Figure 2 B to D are the cumulative graphs of inflammatory factors TNFα, IL-1β and IL-6. Figure 2 As shown in B~D, oral ulcer modeling increased the expression of TNFα, IL-1β and IL-6 by 2.41 times, 8.45 times and 3.09 times respectively, indicating that oral ulcer modeling aggravated oral inflammation, while oral administration of citrus extracts could significantly inhibit the accumulation of oral ulcer inflammatory factors.

[0139] The above examples show that citrus extract can reduce the inflammatory expression and pain sensitivity of oral ulcers.

[0140] 2. Test of citrus polymethoxyflavonoids on reducing inflammatory factors caused by ulcers:

[0141] The method for establishing the oral ulcer model is shown in Example 1, and the method for detecting inflammatory factors is shown in Example 4.

[0142] Figure 5 Effects of oral administration of citrus flavonoid monomers on inflammatory genes TNF-α (A), IL-1β (B), IL-6 (C), and Jak-Stat pathway (D-I) in rats with oral ulcer model. * indicates significant difference compared with the model group (p < 0.05), # indicates significant difference compared with the control group (p < 0.05), Figure 5A to C show the effects of polymethoxylated flavonoids on the expression of inflammatory genes and proteins. Figure 5 From Figures A to C, we can see that PMFs have a significant inhibitory effect on TNFα, IL-1β, and IL-6 genes, while hesperidin has no significant effect on the gene regulation of the three inflammatory factors. Figure 5 D to I represent the gene and protein expression of Jak2 and Stat3. All four PMFs significantly reduced the abnormally elevated Jak2 and Stat3 gene expression, as well as the elevated Jak2 and Stat3 protein expression and phosphorylation levels, caused by oral ulcers. Hesperidin significantly reduced Jak2 and Stat3 gene and protein expression but had no significant effect on Jak2 and Stat3 phosphorylation levels. These results suggest that the four PMFs can regulate the gene and protein expression of inflammatory factors through the Jak-Stat pathway, thereby alleviating oral ulcer symptoms. However, hesperidin did not inhibit Jak2 and Stat3 phosphorylation levels, resulting in a weaker effect on inflammatory factors and oral ulcers.

[0143] Figure 4 B to D are the effects of oral administration of citrus flavonoid monomers on oral inflammatory factors TNF-α (B), IL-1β (C), and IL-6 (D). Figure 4 In the table, * indicates significant difference from the model group (p<0.05), # indicates significant difference from the control group (p<0.05), Figure 4 From B to D, we can see that the four polymethoxyflavonoid monomers can significantly reduce the levels of TNFα, IL-1β, and IL-6, while hepsridin can reduce the content of TNFα, but has no significant improvement on the content of IL-1β and IL-6.

[0144] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. Other embodiments can be obtained based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A use of a citrus extract in preparing a medicament for oral ulcers, characterized in that: The citrus extract contains the following components in the following concentrations: Vetsenin-2: 0.48~1.95mg / g; Jinshengcaosu 6,8-dicarbonyl-glucoside: 0.44~1.74mg / g; Naringin: 0.16~0.85mg / g; Hesperidin: 6.35~16.5mg / g; Neohesperidin: 0.84~1.33mg / g; Melissa officinalis: 0.15~0.75mg / g; Isosweet orange flavonoids: 0.09~0.37mg / g; 4'-Hydroxy-5,6,7,8,3'-pentamethoxyflavone: 0.04-0.15 mg / g; Sweet orange flavonoids: 0.55~2.43mg / g; Dihydronobiletin: 0.07~0.31mg / g; Nobiletin: 7.78~13.03mg / g; Tratin: 0.17~0.73mg / g; 3-methoxynobiletin: 0.06-0.3 mg / g; Tangeretin: 5.25~16.61mg / g; 5-demethylnobiletin: 0.85-2.41 mg / g; 5-Hydroxy-7,8,3',4'-tetramethoxyflavone: 0.15~0.61mg / g; The preparation method of the citrus extract comprises the following steps: The freeze-dried citrus powder is extracted with an ethanol aqueous solution to obtain an extract; Concentrating the extract to remove ethanol from the extract to obtain an aqueous phase; After the aqueous phase is subjected to solid phase extraction, the obtained solid phase is dried to obtain a citrus extract.

2. The use according to claim 1, characterized in that The volume concentration of the ethanol aqueous solution is 80-100%; the usage ratio of the citrus freeze-dried powder to the ethanol aqueous solution is 1g:20mL.

3. The use according to claim 1, characterized in that The extraction is ultrasonic extraction, the power of the ultrasonic extraction is 40 to 80 W, the time is 15 to 45 minutes, and the number of ultrasonic extractions is 3 times.

4. The use according to claim 1, characterized in that After the extraction, the method further comprises centrifugation, wherein the centrifugal speed is 8000-12000 rpm and the time is 3-6 minutes.

5. The use according to claim 1, characterized in that The extraction column of the solid phase extraction is a C18 column.

6. The use according to claim 1, characterized in that The steps of solid phase extraction are activation, column equilibration, washing, sample loading and elution performed in sequence; The activation reagent is methanol; during the activation, the amount of methanol used is 2BV; The reagent for the column equilibration treatment is double distilled water; during the column equilibration treatment, the amount of double distilled water used is 2BV; during the sample loading, the sample loading volume is 0.75BV; The elution reagent is double distilled water; during the elution, the amount of double distilled water used is 20BV; The elution reagent is methanol; during the elution, the amount of methanol used is 1BV.

7. The use according to claim 1, characterized in that The oral ulcer medication includes a medication that reduces pain sensitivity of oral ulcers, a medication that reduces ulcer area, or a medication that reduces inflammation of oral ulcers.