Xylanase IrXyn01 of the rust rot pathogen of ginseng and its application

Knocking out the IrXyn01 gene of CBLJ-3 of the ginseng rust rot bacteria through CRISPR/Cas9 technology has solved the problem of difficulty in preventing and treating ginseng rust rot, and provided effective molecular target genes for drug screening, significantly reducing the severity of the disease.

CN118497233BActive Publication Date: 2025-08-05JILIN AGRICULTURAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410702312.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-02
Publication Date
2025-08-05
Estimated Expiration
2044-06-02

AI Technical Summary

Technical Problem

Ginseng rust rot is difficult to prevent and treat. The existing technology lacks effective molecular target genes for drug screening, resulting in serious diseases and affecting ginseng growth and yield.

Method used

The xylanase IrXyn01 gene was knocked out in the ginseng rust rot bacteria CBLJ-3 by CRISPR/Cas9 technology, and the IrXyn01 gene deletion strain was obtained, and the agent screening was carried out to prove that the IrXyn01 gene was a pathogenic target gene.

Benefits of technology

After the IrXyn01 gene is deletion, the lesions depth and lesions diameter of the mutant are significantly lower than those of the wild type. The agent treatment significantly inhibits the growth of rust rot bacteria, providing effective molecular targets for drug screening and reducing the severity of the disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present invention discloses xylanase of Cylindrocarpon destructans IrXyn01 and its application. The inventors screened out the xylanase gene in the CBLJ-3 genome and named it IrTri01 . The gene was successfully knocked out in CBLJ-3 by CRISPR / Cas9 technology and PEG-mediated genetic transformation. The IrXyn01 gene knockout strain was obtained. This gene is not involved in the regulation of vegetative growth of Cylindrocarpon destructans. The mutants, wild-type and complementary strains were all inoculated into the roots of ginseng through wounds, and it was found that the lesion depth and lesion diameter of the mutants were significantly lower than those of the wild-type and complementary strains, proving that IrXyn01 the gene can be used as a target gene for pathogenicity, providing a molecular target for the screening of effective drugs in the later stage.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to xylanase IrXyn01 of Ilyonectria robusta and its application. Background Art

[0002] Ginseng (Panax ginseng C. A. Meyer) is a perennial herbaceous plant of the Araliaceae family and the Panax genus. It is distributed throughout the country and has very important economic value. Ginseng has the effects of improving eyesight, calming the nerves, tonifying qi and nourishing the heart, and regulating blood pressure, so it is known as the "king of all herbs" and is a dominant characteristic industry in Jilin Province. Ginseng prefers a cool environment, and the most suitable growth temperature is about 20 - 28°C. The climate conditions are harsh, and it is extremely prone to diseases during the planting process. For example, ginseng root rot, rust rot, black spot, damping-off, etc. Among them, ginseng rust rot is one of the most common and serious diseases of ginseng. Ginseng rust rot is difficult to control and is known as the "cancer of ginseng". It is an infectious root disease caused by Ilyonectria robusta, which occurs from sowing to all ages. This disease is a soil-borne disease. During the process of the pathogen infecting ginseng, the main infection sites are the main root, lateral root, rhizome, fibrous root, bud, and stem in the soil of ginseng. Among them, the root part of ginseng is more severely damaged. When the soil humidity is relatively high, it is easy to cause the disease, and the older the ginseng, the more serious the disease. The pathogen can overwinter in the soil and has strong viability. In spring, when the temperature rises and the soil thaws, the chlamydospores begin to gradually germinate and slowly invade the root wounds, resulting in the phenomenon of swelling and rotting of the ginseng roots. In the initial stage of ginseng disease, yellowish-brown or reddish-brown lesions appear on the surface, and gradually expand to form irregular rust-brown lesions, which gradually expand from the outside to the inside. The edge of the lesion is convex, and the middle is concave, and the boundary between the diseased and healthy parts is clear. When the pathogen invades slightly, the surface of the ginseng root is damaged, forming brown or rust-colored scars, and the root hairs begin to rot. When the disease deteriorates, the pathogen will penetrate into the root tissue, causing the lesions to fuse into flakes, accumulating a large amount of rust-colored powder, and may change from dry rot to wet rot, resulting in severe root rot, and the ginseng root gradually rots leaving only the epidermis. When the ginseng root system is infected with the disease, the growth of the plant gradually slows down, becomes short, the leaves are wrinkled and reddish-brown, and finally wither and die. Reddish-brown lesions appear on the stem and gradually spread into large patches. Infection in the overwintering buds will cause serious seedling shortages. Summary of the Invention

[0003] The purpose of the present invention is to provide xylanase IrXyn01 of Ilyonectria robusta and its application to solve the above problems.

[0004] Xylanase IrXyn01 of Ilyonectria robusta, its base sequence is as shown in SEQ No.1 of the sequence list;

[0005] Its amino acid sequence is as shown in SEQ No.2 of the sequence list.

[0006] A CRISPR-Cas9 knockout vector, which is designed for the xylanase gene of Ilyonectria robusta with the base sequence shown in Sequence Table SEQ No.1 IrXyn01 ;

[0007] Its 5ʹ-end homologous recombination fragment primers are:

[0008] IrXyn01-UP-AF: AGCCACGTGTAAGCGATATGAT;

[0009] IrXyn01-UP-AR: GCCGACCGGGAACCAGTTATCGTTTGTAAAAGGAGTGGACTGG;

[0010] Its 3ʹ-end homologous recombination fragment primers are:

[0011] IrXyn01-DOWN-CF: ACCGCCTGACGACTAAACCAAAACGTAATAGACTCAGGCATGG;

[0012] IrXyn01-DOWN-CR: CTTCGCAAAGGCATGCGAT.

[0013] The above-mentioned xylanase gene of Ilyonectria robusta IrXyn01 as the use of a molecular target for Ilyonectria robusta

[0014] The present invention provides an Ilyonectria robusta xylanase IrXyn01 and its application. The inventor screened a xylanase gene from the CBLJ-3 genome and named it IrTri01. The gene was successfully knocked out in CBLJ-3 by CRISPR / Cas9 technology and PEG-mediated genetic transformation. An IrXyn01 gene knockout strain was obtained.

[0015] After the deletion of the IrXyn01 gene, the growth rate, colony morphology, aerial hyphae, spore germination rate and sporulation amount of the mutant strain were observed. There was no significant difference compared with the wild-type strain CBLJ-3. It was speculated that this gene was not involved in the vegetative growth regulation of Ilyonectria robusta. The mutant, wild-type and complementary strains were all inoculated on the wounds of ginseng roots. It was found that the lesion depth and diameter of the mutant were significantly lower than those of the wild-type and complementary strains. And by quantitatively detecting the change of rust rot content, as the inoculation time increased, the rust rot content gradually increased. However, the rust rot concentration of the wild-type was always higher than that of the mutant strain, proving that this gene was related to the pathogenicity of Ilyonectria robusta strain CBLJ-3.

[0016] The deletion of the IrXyn01 gene affects the nitrogen source utilization, salt stress function and xylanase activity of the rust rot pathogen. Under the culture conditions with ammonium sulfate as the sole nitrogen source, the mutant strains △IrXyn01-1, △IrXyn01-2 and △IrXyn01-9 were inhibited to varying degrees, with inhibition rates of 29.32%, 23.45% and 25.08% respectively; during the salt stress process, in the presence of 1M NaCl, 1M KCl and 2 M sorbitol, the mutant strains were significantly inhibited compared with the wild-type CBLJ-3 and the complementary strains, with inhibition rates of 35-40%, 6-12% and 7-10% respectively; in terms of enzyme activity, as the culture time extended, the enzyme activity of the mutant strains was 20-60 nmol / min / mL, while that of the wild-type CBLJ-3 and the complementary strains was 100-120 nmol / min / mL. The enzyme activity of the mutant strains was always lower than that of the wild-type and the complementary strains. It is speculated that this gene is involved in the utilization of selective nitrogen sources by the rust rot pathogen of ginseng and participates in the salt stress function.

[0017] The mutant strains △IrXyn01-1, △IrXyn01-2 and △IrXyn01-9 of this gene were obtained. Based on the chemical agents (carbendazim, fludioxonil, difenoconazole) and biocontrol agents (NJ13, FG14, NT35) screened in the previous stage of the laboratory, through fluorescence quantitative PCR detection and calculation of the Ct value, it was found that taking the wild-type without chemical agent treatment as the control, the relative expression contents of the bacterial solutions treated with carbendazim, fludioxonil, difenoconazole, NJ13, FG14 and NT35 were significantly inhibited, all lower than the control and the relative content was less than 0.1. Through this experiment, it was proved that the IrXyn01 gene can be used as a target gene for pathogenicity, providing a molecular target for the screening of effective agents in the later stage. Description of the Drawings

[0018] Figure 1 Hydrophilicity / hydrophobicity analysis of the IrXyn01 protein;

[0019] Figure 2 Prediction of transmembrane signal of the IrXyn01 protein;

[0020] Figure 3 Analysis of phosphorylation sites of the IrXyn01 protein;

[0021] Figure 4 Prediction of signal peptide of the IrXyn01 protein;

[0022] Figure 5 Prediction of secondary structure of the IrXyn01 protein;

[0023] Figure 6 Prediction of tertiary structure of the IrXyn01 protein;

[0024] Figure 7 Phylogenetic analysis of IrXyn01 and other pathogens;

[0025] Figure 8 RNA electrophoresis;

[0026] Figure 9 Analysis of relative expression of IrXyn01 gene;

[0027] Figure 10 Construction of IrXyn01 gene knockout vector;

[0028] Note: A: Single colony in LB medium; B: Sequence alignment; C: Target fragment amplification; D: Fusion fragment amplification;

[0029] Figure 11 Preparation of protoplasts of the rust fungus CBLJ-3; Note: Bar = 50 μm;

[0030] Figure 12 PCR verification of IrXyn01 gene knockout transformants;

[0031] A: Mutant DNA verification; B: Hyg verification; C: Full-length gene verification;

[0032] Note: A: Lanes from left to right are Maker, WT, and transformants 1-9; B: Lanes from left to right are Maker, WT, transformants 1, 2, and 9; C: Lanes from left to right are Maker, transformants 1, 2, and 9 + the upstream fragment of the hygromycin gene, and transformants 1, 2, and 9 + the downstream fragment of the hygromycin gene;

[0033] Figure 13 Southern blot verification; A: Hybridization diagram; B: Verification diagram;

[0034] Figure 14 Complementation vector construction; A: PCR amplification; B: EGFP double enzyme digestion;

[0035] Figure 15 PCR screening of complementation transformants of ΔIrXyn01-1, ΔIrXyn01-2, and ΔIrXyn01-9;

[0036] Figure 16 Green fluorescence intensity of mutants and complemented transformants;

[0037] Figure 17 Growth of IrXyn01 gene mutant strain of ginseng rust pathogen on PDA medium;

[0038] Figure 18Determination of the sporulation amount of the IrXyn01 gene of the rust rot pathogen of ginseng;

[0039] Figure 19 Determination of the spore germination rate of the IrXyn01 gene of the rust rot pathogen of ginseng;

[0040] Figure 20 Detection of the pathogenicity of the mutant strain of the rust rot pathogen of ginseng;

[0041] Figure 21 Detection of the content of rust rot of ginseng;

[0042] Figure 22 Utilization of different carbon sources by the mutant strain ΔIrXyn01 of the rust rot pathogen of ginseng (1);

[0043] A: Colony morphology of wild type, mutant and complementary strains; B: Comparison of colony diameters of wild type, mutant and complementary strains;

[0044] Figure 23 Utilization of different carbon sources by the mutant strain ΔIrXyn01 of the rust rot pathogen of ginseng (2);

[0045] A: Colony morphology of wild type, mutant and complementary strains; B: Comparison of colony diameters of wild type, mutant and complementary strains;

[0046] Figure 24 Utilization of different nitrogen sources by the mutant strain ΔIrXyn01 of the rust rot pathogen of ginseng (3)

[0047] A: Colony morphology of wild type, mutant and complementary strains; B: Comparison of colony diameters of wild type, mutant and complementary strains;

[0048] Figure 25 Salt stress test of the mutant strain ΔIrXyn01 of the rust rot pathogen of ginseng;

[0049] A: Colony morphology of wild type, mutant and complementary strains; B: Comparison of colony diameters of wild type, mutant and complementary strains;

[0050] Figure 26 Drug target test;

[0051] A: Determination of the inhibitory effects of NJ13, FG14, NT35, carbendazim, difenoconazole and fludioxonil on the CBLJ - 3 strain; B: Determination of the relative expression levels of the IrXyn01 gene under the inhibition of NJ13, FG14, NT35, carbendazim, difenoconazole and fludioxonil;

[0052] Figure 27 Determination of the enzyme activities of wild type, mutant and complementary strains. Specific implementation manners

[0053] The CBLJ-3 strain and EDBH-2 strain of Ilyonectria robusta, the causative agent of ginseng rust rot, were collected, isolated, and purified by the College of Plant Protection, Jilin Agricultural University and stored at -20 °C.

[0054] Example 1

[0055] Bioinformatics analysis of pathogenic genes

[0056] The A05739 gene was selected from the CBLJ-3 genomic database obtained in the early stage of the laboratory, and its nucleotide sequence is shown in SEQ NO.1 of the sequence list. The ExPASy Translate tool software was used to translate this gene sequence to obtain its amino acid sequence. Bioinformatics software was used to predict and analyze the structure, properties, and functions of the IrXyn01 gene.

[0057] In this study, bioinformatics tools were used to predict the properties and functions of the IrXyn01 protein. The MEGA10.0 software was selected in this experiment to screen its homologous genes in the NCBI database and construct a phylogenetic tree to reveal its evolutionary relationship.

[0058] 1. Composition and physicochemical properties of IrXyn01 protein

[0059] The amino acid sequence was analyzed using the ExPASy Translate tool software. The results showed that this gene encodes 636 amino acids, and its amino acid sequence is shown in SEQ NO.1 of the sequence list.

[0060] Through a detailed bioinformatics analysis of the IrXyn01 protein, a series of physicochemical characteristics of its coding sequence were revealed using the ProtParam tool. The calculated results showed that the molecular weight of this protein is approximately 67215.12 kDa, and its theoretical isoelectric point (PI) is located at 4.24, showing a significant acidic tendency. In addition, by comparing the positive and negative charge residues, the number of positive (Asp + Glu) / negative (Arg + Lys) charge residues is 69 and 22 respectively, revealing the bias of the surface charge distribution of the protein. The protein molecular formula is C 2966 H 4539 N 759 O 992 S 16 , and the total number of atoms is 9272. In terms of stability, the instability index is 37.84 (<40 stable; >40 unstable). In summary, according to the calculated result of the aliphatic index of 78.4, this protein is classified as a biomolecule with significant stability, providing an important physicochemical basis for further experimental research.

[0061] 2. Hydrophilicity / Hydrophobicity Analysis of IrXyn01 Protein

[0062] The hydrophilicity and hydrophobicity prediction analysis of IrXyn01 protein was carried out using the ProtScale tool, as Figure 1 The analysis showed that the amino acid at the 8th position in this protein significantly presented higher hydrophobic characteristics with a score of 1.867. On the contrary, at the 321st amino acid, we observed the lowest score of -2.322, where the hydrophilicity performance was particularly prominent. Considering the scores of the entire protein sequence, its overall average hydrophilic value was slightly negatively biased, only -0.002, thus concluding that the IrXyn01 protein is a hydrophilic protein.

[0063] 3. Transmembrane Domain Analysis of IrXyn01 Protein

[0064] The transmembrane domain of this protein was predicted using TMPRED, and the results are as Figure 2 shown. The higher the score, the greater the probability that the IrXyn01 protein is located at a certain site. The purple rectangle is the transmembrane helix structure, the yellow line segment is the structure located inside the membrane, and the red and blue line segments are the structures located outside the membrane. According to the prediction results, this protein is located outside the membrane and has no transmembrane structure region.

[0065] 4. Phosphorylation Site Analysis of IrXyn01 Protein

[0066] Protein phosphorylation mostly occurs at the residues of amino acids such as serine (Serine, Ser), threonine (Threoine, Thr), tyrosine (Tyrosine, Tyr), etc. The phosphorylation sites of IrXyn01 protein were analyzed online using the NetPhos3.1 online software, and the results are as Figure 3As shown, 53 serine kinase phosphorylation sites were found on this protein (amino acids at positions 12, 13, 14, 21, 41, 77, 104, 108, 122, 158, 172, 229, 232, 234, 235, 261, 265, 267, 282, 329, 331, 341, 342, 347, 349, 351, 370, 375, 380, 406, 418, 446, 451, 452, 454, 462, 485, 490, 492, 496, 501, 507, 512, 513, 514, 517, 541, 550, 560, 570, 573, 630), 42 threonine kinase phosphorylation sites (amino acids at positions 34, 72, 101, 154, 199, 230, 238, 270, 298, 307, 328, 339, 346, 348, 356, 357, 361, 362, 369, 374, 387, 388, 392, 393, 401, 405, 414, 425, 431, 435, 445, 456, 466, 472, 473, 530, 534, 542, 551, 565, 566, 580, 584, 614), and 13 tyrosine kinase phosphorylation sites (amino acids at positions 39, 45, 161, 187, 190, 194, 252, 276, 301, 458, 587, 620, 628). This result indicates that it can be phosphorylated by kinases to achieve the regulation of its function.

[0067] 5. Signal peptide of IrXyn01 protein

[0068] The Signal P-4.1 software was used to predict the signal peptide of the target encoded protein, and this software analyzed the C-score (cleavage site prediction score), S-score (signal sequence prediction score), and Y-score (comprehensive prediction score). In this model, the sequence position corresponding to the peak of the three scores was used as the optimal option for predicting the signal peptide cleavage site. According to Figure 4 as shown, no significant signal peptide was observed. It is speculated that the IrXyn01 protein may be a secreted protein.

[0069] 6. Prediction and analysis of the secondary structure of IrXyn01 protein

[0070] The secondary structure of the protein was predicted by SOPMA ( Figure 5The secondary structure of the IrXyn01 protein is composed of 34.75% α-helices, 18.08% extended strands, 5.97% β-sheets, and 41.19% random coils. The IrXyn01 protein has a high concentration of random coils in its secondary structure. This structure provides a certain degree of stability, facilitating the connection between the relatively rigid α-helices and β-sheets, and plays an important role in the coiling and folding of the protein peptide chain.

[0071] 7. Prediction and analysis of the tertiary structure of IrXyn01 protein

[0072] The tertiary structure model of the gene was predicted by SWISS-MODEL ( Figure 6 , GMQE was 0.66 (the closer the value is to 1, the more reliable it is), which was very similar to the tertiary structure of A0A0P7BHA4 (A0A0P7BHA4_9HYPO) Beta-xylanase, with a sequence homology of 78.99%. This gene was predicted to be a xylanase gene and was named IrXyn01 for subsequent verification.

[0073] 8. Phylogenetic analysis of IrXyn01 protein

[0074] Combined with the homologous genes of IrXyn01 in the NCBI database, the phylogenetic analysis of IrXyn01 was performed using MEGA10.0 ( Figure 7 Ilyonectria robusta, Scedosporium apiospermum, and Chrysosporium lucknowense clustered together, while Fusarium solani, Fusarium falciforme, Fusarium keratoplasticum, and Fusarium pseudograminearum clustered together. IrXyn01 is closely related to Scedosporium apiospermum and Chrysosporium lucknowense. Homology analysis suggests that this gene has similar functions to xylanases and may be involved in regulating the pathogenicity of rust pathogens.

[0075] Example 2

[0076] RNA extraction

[0077] Wash the healthy 3-year-old ginseng roots, remove the soil on the surface of the ginseng roots. After washing, disinfect their surfaces successively with 75% alcohol and 2% NaClO solution, wash 3 times with sterile water, use sterilized filter paper to absorb the water on the surface of the ginseng roots, and place them for standby. Inoculate the ginseng root rot pathogen CBLJ-3 bacterial cakes (8 mm) cultured at 25 °C for 7 d on the surface of the ginseng roots respectively. At the same time, place sterilized filter paper in a 25 cm petri dish and add 3 mL of sterile water for standby. Place the inoculated ginseng in a petri dish (diameter 15 cm) containing filter paper moistened with sterile water, seal it and place it in an incubator at 25 °C for culture. Observe and sample at 12 hpi, 24 hpi, 36 hpi, 48 hpi, and 72 hpi respectively. Pure culture (0 h) is used as the control group, and 3 biological replicates are carried out at each time point.

[0078] Use the Ultrapure RNA Kit (DNase I) kit to extract the total RNA of the ginseng root samples of CBLJ-3 at 0 h (pure culture), 12 hpi, 24 hpi, 36 hpi, 48 hpi, and 72 hpi respectively. After extraction, use a nucleic acid protein analyzer to measure the RNA concentration and perform agarose gel electrophoresis detection to ensure the integrity of the extracted RNA.

[0079] The results show that: inoculate the CBLJ-3 bacterial cakes cultured for 7 d on the ginseng roots and culture for 0 h (pure culture), 12 hpi, 24 hpi, 36 hpi, 48 hpi, and 72 hpi, observe and sample, and extract the total RNA under different time point treatments. As Figure 8 shown, it is proved that the RNA extraction is successful and the quality is good, and subsequent fluorescence quantitative PCR verification can be carried out.

[0080] Example 3

[0081] cDNA synthesis

[0082] The synthesis of cDNA is carried out according to the instructions of the HiFiScript gDNA Removal RT MasterMix kit:

[0083] Step 1: Genomic DNA removal reaction

[0084] Add 1 μL of 10×gDNA Remove Mix, 2 μL of RNA samples (0 h (pure culture), 12 hpi, 24 hpi, 36 hpi, 48 hpi, and 72 hpi) to a centrifuge tube in sequence, and add RNase-Free Water to 10 μL (Table 1).

[0085] Table 1 Reaction system for removing genomic DNA

[0086] Reaction Component Volume (μL) 10×gDNA Remove Mix 1 μL <![CDATA[RNA Template 1 > 2 μL RNase-Free Water up to 10 μL

[0087] (2) Use a centrifuge to mix the solution on the tube wall.

[0088] (3) Place it in the instrument at 42 °C for 3 min.

[0089] (4) After the instrument operation is completed, perform centrifugation for 30 s, take it out and cool it in an ice box.

[0090] Step 2: Reverse transcription reaction

[0091] (1) Respectively extract 10 μL from the reaction tubes of the reaction solution for removing gene DNA in Step 1 at 0 h (pure culture), 0 h, 12 hpi, 24 hpi, 36 hpi, 48 hpi, and 72 hpi, and then sequentially add 5×HiFiscript RT Master Mix and RNase-Free Water in the reverse transcription kit to configure a 20 μL reaction system (Table 2).

[0092] Table 2 Reverse transcription reaction system

[0093] Reaction Component Volume (μL) Reaction solution for removing genomic DNA 10 μL 5×HiFiscript RTMaster Mix 4 μL RNase-Free Water 6 μL

[0094] (2) After mixing well, perform centrifugation for 30 s to mix the solution on the tube wall.

[0095] (3) Place it in the instrument at 37 °C for 15 min.

[0096] (4) After the instrument operation is completed, perform brief centrifugation, place it on ice, and then continue the subsequent reaction.

[0097] Example 4

[0098] Fluorescent quantitative PCR verification of pathogenic genes

[0099] Design qRT-PCR primers according to the selected coding gene sequence (IrXyn01). Design primers online through Sangon Biotech (Shanghai) Co., Ltd., and verify the specificity of the primers on NCBI. At the same time, use Act as an internal reference gene. The primer sequences are shown in Table 3, and each primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0100] Table 3 RT-PCR primer sequences

[0101] Primers name Primer sequence (5 '-3') IrXyn01-QF CGTTATCCGCCACTCCACCAC IrXyn01-QR TAGTCGCCCGTCTCCGTAGC

[0102] Using the cDNA under the treatments at 0 h (pure culture), 12 hpi, 24 hpi, 36 hpi, 48 hpi, and 72 hpi as templates, and IrXyn01-F (5’-CGTTATCCGCCACTCCACCAC-3’) and IrXyn01-R (5’- TAGTCGCCCGTCTCCGTAGC -3’) as primers, fluorescence quantitative PCR amplification was performed. The reaction system for qRT-PCR was configured as 20 μL (Table 4), and each was done in 3 replicates.

[0103] qRT-PCR reaction conditions: After equally mixing the cDNA of each sample as a template, the qRT-PCR experiment was carried out using the UltraSYBR Mixture (Low ROX) kit. PCR amplification was performed according to the two-step method.

[0104] Table 4 qRT-PCR reaction system

[0105] Reaction Component Volume (μL) Forward Primer 1 μL Reverse Primer 1 μL <![CDATA[ddH2O]]> 7 μL 2×UltraSYBR Misture 10 μL Template cDNA 1 μL

[0106] qRT-PCR reaction conditions: After equally mixing the cDNA of each sample as a template, the qRT-PCR experiment was carried out using the UltraSYBR Mixture (Low ROX) kit. PCR amplification was performed according to the two-step method.

[0107] Each sample had 3 technical replicates. The 2 -ΔΔCt method was used to calculate and analyze the relative expression level of the IrXyn0l gene

[0108] As Figure 8 shown, with 0 h as the control treatment, compared with the control treatment, the expression level of the IrXyn01 gene at each time point was up-regulated during the pathogenic process of this strain. After inoculation for 12 h, the expression level of the IrXyn01 gene gradually increased, and its expression level was 4.31 times that of the control group. After inoculation for 24 h, the expression level reached the peak, which was 6.33 times that of the control reference group. Although with the prolongation of the disease course, after inoculation for 36 h, the expression level gradually began to slightly decrease, and the expression level was about 5.26 - 5.96 times that of the control group. The expression level of the IrXyn01 gene was always significantly higher than the control treatment, indicating that the IrXynl gene might play a positive regulatory role in the interaction between the fungus and the host.

[0109] Example 5

[0110] Obtaining of pathogenic gene knockout mutants

[0111] Construction of CRISPR-Cas9 vector: According to the CDS sequences of some pathogenic-related genes screened, sgRNA was designed and ligated with the CRISPR empty vector. After transformation of Escherichia coli DH5α, plasmids were extracted and sequenced to verify whether the vector was successfully constructed.

[0112] Using the genomic DNA of strain CBLJ-3 as a template, the 5ʹ homologous recombination fragment and 3ʹ homologous recombination fragment of the target gene were amplified with AF / AR and CF / CR of the IrXyn01 gene as primers respectively; using the hygromycin vector as a template, the hygromycin gene fragment was amplified with BF / BR as primers. The PCR reaction system is shown in Table 5 below. Using 1% agarose gel, 150 V voltage, for 20 min, and then stop running. The target fragments were obtained and gel extraction was performed, and the concentration and purity of the fragment solution were measured using a nucleic acid-protein detector.

[0113] Table 5 Primer sequences of homologous resistance fragments

[0114] Primers Primer sequence (5 '-3') IrXyn01-UP-AF AGCCACGTGTAAGCGATATGAT IrXyn01- UP-AR GCCGACCGGGAACCAGTTATCGTTTGTAAAAGGAGTGGACTGG IrXyn01-Hyg-BF CCAGTCCACTCCTTTTACAAACGATAACTGGTTCCCGGTCGGC IrXyn01-Hyg-BR CCATGCCTGAGTCTATTACGTTTTGGTTTAGTCGTCAGGCGGT IrXyn01-DOWN-CF ACCGCCTGACGACTAAACCAAAACGTAATAGACTCAGGCATGG IrXyn01-DOWN-CR CTTCGCAAAGGCATGCGAT

[0115] Construction of fusion fragments: The UP, DOWN of the successfully amplified IrXyn01 gene in the previous step, and the Hyg fragment were subjected to PCR fusion ligation using Vazyme's Phanta Max Super-Fidelity DNA Polymerase×Phanta Master Mix. Using the above three fragments as templates, PCR ligation amplification was performed with IrXyn01-UP-AF and IrXyn01-DOWN-CR as the upstream and downstream primers. The ligation system is shown in Table 6 below. Using 1% agarose gel, 150 V voltage, for 20 min, and then stop running. The correct target fragments were obtained and gel extraction was performed, and the concentration and purity of the fragment solution were measured using a nucleic acid-protein detector.

[0116] Table 6 Soeing PCR ligation system

[0117] Reagent Volume (μL) Fragment A 400 / concentration × 4 Fragment B 400 / concentration × 4 Fragment C 400 / concentration × 4 Forward Primer 2 μL Reverse Primer 2 μL Phanta Max Super-Fidelity DNA polymerase 4 μL dNTP Mix 4 μL 2×Phanta Max Buffer 100 μL <![CDATA[ddH2O]]> up to 200 μL

[0118] PEG-mediated genetic transformation:

[0119] A. Mycelium preparation: I. robusta was cultured in PDB for 7 d at 25 °C and 150 r / min, and spores were collected. The spore suspension was cultured in 100 mL of PDB for 22 h at 25 °C and 150 r / min, and mycelium was collected.

[0120] B. Plasmid extraction: For the cas9 vector of the constructed candidate gene, plasmids were extracted and the concentration and purity were detected.

[0121] C. Preparation of enzymatic hydrolysis solution: Mix 0.5 g of mycelium with every 5 mL of protoplast buffer (0.15 g of driselase, 0.1 g of lysing enzyme); the protoplast buffer is 5 mL, with an osmotic stabilizer (0.7 mol / L KCl + 0.7 mol / L MgSO4·7H2O), shake at room temperature for 30 min, then centrifuge at 3500 rpm for 10 min, collect the supernatant, and filter through a microporous filter membrane.

[0122] D. Filtration of mycelium: Collect the mycelium after 22 h of spore germination and transfer it to 10 mL of protoplast buffer, and perform enzymatic hydrolysis at 32 °C and 150 rpm for 3 h.

[0123] E. Filtration of enzymatic hydrolysis solution: Filter the enzymatic hydrolysis mixture through three layers of lens paper into a 50 mL centrifuge tube.

[0124] F. Centrifuge at 3500 rpm for 10 min at room temperature;

[0125] E. Remove the supernatant, add 10 mL of STC Buffer to resuspend, and centrifuge at 3500 rpm for 10 min;

[0126] G. Remove the supernatant, add 1 mL of STC Buffer to resuspend, transfer to a 2 mL centrifuge tube, and centrifuge at 3500 rpm for 10 min at room temperature;

[0127] H. Detect the protoplast concentration after resuspension, and the best concentration is above 1×10 7 protoplasts / mL;

[0128] I. Add 5 μg each of the CRISPR vector and the amplified homologous resistance fragment to 200 μL of protoplasts, mix well, and let stand for 20 min;

[0129] J. Add 1 mL of 40% PTC8000, mix well, and let stand for 20 min;

[0130] K. Add 5 mL of TB3 (containing 50 μg / mL ampicillin), and culture overnight at 25 °C and 100 rpm;

[0131] L. Mix 45 mL of Bottom Agar with the overnight-cultured protoplasts and pour into a petri dish;

[0132] M. Culture at 25 °C for 24 h, then pour Top Agar containing hygromycin, culture at 25 °C for about 7 d, and pick the transformants for subsequent experiments.

[0133] Identification of positive transformants: After transformants grew on the upper-layer medium, each transformant was transferred to PDA basal medium for culture and preservation. Mycelia of each transformant were collected, genomic DNA was extracted, and the target fragment and hygromycin resistance gene were amplified.

[0134] Positive transformants preliminarily screened by conventional PCR and qPCR were verified by Southern blot. The specific experimental steps were carried out according to the kit instructions.

[0135] The results showed that: through procedures such as single enzyme digestion and ligation of the CRISPR vector, single colonies were successfully obtained. By sequencing and alignment, it was found that the sequence was successfully aligned with the previously designed sgRNA sequence, proving that the Cas9 vector of the gene IrXyn01 was successfully constructed ( Figure 10 as shown in A and B). The knockout vectors constructed for this gene were amplified by PCR using IrXyn01-UP-AF / AR, Hyg-BF / BR, and IrXyn01-DOWN-CF / CR primers, and the amplified sizes were 1000 bp, 1347 bp, and 1000 bp respectively ( Figure 10 C), which was consistent with the expected results. Fusion PCR amplification (Soeing PCR) was used to fuse the upstream and downstream flanking fragments of the IrXyn01 gene and the Hyg marker gene. After correct fusion of the 1000 bp upstream of the IrXyn01 gene, the marker gene fragment, and the 1000 bp downstream, the fragment size was 3347 bp ( Figure 10 D). The construction of the IrXyn01 gene knockout vector was completed.

[0136] One CRISPR / Cas9 knockout vector was constructed, and the homologous fragment containing the hygromycin resistance gene and the knockout vector were simultaneously transformed into I. robusta protoplasts through PEG-mediated genetic transformation ( Figure 11 ); transformants were screened on the medium containing hygromycin B, and were verified by PCR ( Figure 12 A, B, C) and Southern blot ( Figure 13 , and 3 deletion mutants were obtained for subsequent experiments.

[0137] Example 6

[0138] Complementary vector construction and transformation

[0139] In the functional complementation experiment of the IrXyn01 gene knockout strain, the primer design requirements are as follows: First, a sequence should be selected approximately 2000 bp upstream of the target gene to design the upstream primer to ensure that an adequate promoter region is included, which helps with subsequent expression. Second, a 18-25 bp sequence at the end of the gene coding region without a stop codon is selected as the basis for designing the downstream primer. To achieve fusion cloning with specific sites on the OE-egfp of the target vector, sequences homologous to the EcoRV and PstI restriction enzyme sites are added to the 5′ ends of the upstream and downstream primers respectively. The Primer Premier 5.0 software is used for primer design. After completing the primer design, it is entrusted to Sangon Biotech (Shanghai) Co., Ltd. for synthesis, and this sequence can be referred to Table 7.

[0140] Table 7 Primers for PCR amplification of complementary fragments

[0141] Primer name Primer sequence (5 '-3') C-IrXyn01-F AACGCCAACAAGCTTGATATCATGTACAAATCAGCTCTC C-IrXyn01-R GAATTCGATATCAAGCTGCAGTTAATTGCTCTCAACACA

[0142] Extract the plasmid of the OE-egfp complementary vector and perform a double digestion reaction using the restriction enzymes EcoR V / Pst I. Using the CBLJ-3 genomic DNA as a template, and C-IrXyn01-F / C-IrXyn01-R as primers respectively, amplify the complementary fragment using the Vazyme's Phanta Max Super-Fidelity DNA Polymerase×Phanta Master Mix kit. Recombine the recombinant fragment and the linearized vector (the reaction system is shown in Table 8 below). Perform protoplast transformation.

[0143] Table 8 Recombination reaction system

[0144] Reagent Volume(μL) Linearized vector X Insert fragment Y 5×CEⅡBuffer 4 μL ExnaseⅡ 2 μL <![CDATA[ddH2O]]> up to 20 μL

[0145] In this experiment, the ΔIrXyn01-1, ΔIrXyn01-2, and ΔIrXyn01-9 strains were used as the research objects for subsequent construction of the complementary vector. Using the primers C-IrXyn01-F / C-IrXyn01-R respectively, amplify the cDNA of the IrXyn01 gene ( Figure 14 A), and at the same time use EcoR V and Pst I to double digest the expression vector OE-egfp (such as Figure 14 B). Using the principle of homologous recombination in seamless cloning, recombine the above two fragments and perform heat shock transformation of Escherichia coli competent cells to construct a complementation vector. Obtain single colonies, extract the plasmids, perform colony PCR detection, and successful sequencing alignment proves that the construction of the complementary vector for the mutant strain is successful.

[0146] For the ΔIrXyn01-1, ΔIrXyn01-2, and ΔIrXyn01-9 strains, transformants were picked and PCR detection was performed using the IrXyn01-F / IrXyn01-R primers. The results are as follows Figure 15 As shown, the target band appeared at 1911 bp in the complementary transformants, while no target band was amplified in the mutants. This proved that the gene was successfully complemented into the mutant strain. Through preliminary screening by PCR technology in this study, it was determined that a total of 18 complementary transformants were obtained from the ΔIrXyn01-1, ΔIrXyn01-2, and ΔIrXyn01-9 strains, namely transformants No. 1 and 3 in ΔIrXyn01-1, transformants No. 1, 3, 5, 6, 7, 8, 9, 11, 12, 13, 14, and 15 in ΔIrXyn01-2, and transformants No. 3, 7, 8, and 9 in ΔIrXyn01-9. In this study, transformants C-ΔIrXyn01-1-1, C-ΔIrXyn01-1-3, C-ΔIrXyn01-2-9, C-ΔIrXyn01-2-15, C-ΔIrXyn01-9-7, and C-ΔIrXyn01-9-8 were selected for subsequent green fluorescence microscopy observation experiments.

[0147] For the 6 selected complementary transformants C-ΔIrXyn01-1-1, C-ΔIrXyn01-1-3, C-ΔIrXyn01-2-9, C-ΔIrXyn01-2-15, C-ΔIrXyn01-9-7, and C-ΔIrXyn01-9-8, fluorescence signals were observed under a microscope. As Figure 16 shown, both hyphae and conidia emitted stable green fluorescence, proving that the OE-egfp vector was successfully complemented into the mutant strain, enabling both hyphae and conidia to carry green fluorescence. The above 6 complementary transformants were preserved for future use.

[0148] Example 7

[0149] Verification of the phenotype of the knockout mutant

[0150] 1. Growth characteristics of the knockout mutant

[0151] Hyphal growth rate: The mycelial discs of the wild-type CBLJ-3 strain, mutants ΔIrXyn01-1, ΔIrXyn01-2, and ΔIrXyn01-9 that had been cultured for 7 d were respectively inoculated on the surface of PDA medium and cultured at 25 °C. After 9 d of culture, the colony diameter was measured by the cross-cross method, and the colony morphology was observed by taking pictures. Each treatment was repeated 3 times. The experimental data were statistically analyzed for differences using SPSS software.

[0152] Determination of sporulation amount: Pick fresh cultures of the wild-type CBLJ-3, mutants, and complementary strains C-△IrXyn01-1-1, C-△IrXyn01-1-3, C-△IrXyn01-2-9, C-△IrXyn01-2-15, C-△IrXyn01-9-7, and C-△IrXyn01-9-8, and inoculate the mycelial cakes into PDB medium. Incubate at 25 °C and 150 rpm in a shaker for 7 days. After the incubation, filter through three layers of lens paper, collect the liquid, dilute the spore suspension with distilled water, and count the number of conidia using a hemocytometer (A). The formula for calculating the sporulation amount is: A × 80 / 400 × 10 4 . Repeat each treatment 3 times, and count each sample 5 times for each experiment.

[0153] Determination of spore germination rate: Spread the spore suspension on WA, place it in an incubator at 25 °C for 12 h, examine the spore germination under a microscope, and calculate the spore germination rate according to the formula. Repeat 3 times, with 3 replicates for each treatment and 200 spores in each field of view. Observe at 2 h, 4 h, 6 h, 8 h, and 10 h respectively. Calculate according to the following formula:

[0154] Germination rate (%) = [Number of germinated spores (pcs) / Number of observed spores (pcs)] × 100%

[0155] After observing the growth status and colony structure characteristics of each strain, this study found that the cultivation was carried out at 25 °C for 9 days. Through comparative analysis, there were no obvious differences in the growth on the medium, colony morphology, and aerial hyphae produced among the mutants, wild-type, and complementary strains after knocking out the IrXyn01 gene (see Figure 17 ). Based on this, it is preliminarily inferred that the IrXyn01 gene does not participate in the regulatory function of the pathogenic fungus of ginseng root rot during vegetative growth.

[0156] During the study on the gene function of the pathogenic fungus of ginseng root rot, the sporulation ability of the gene mutant strain (ΔIrXyn01) was detected. The results showed that there were no statistically significant differences in the sporulation amount between ΔIrXyn01 and the wild-type and its complementary strains, which was stably maintained at the level of 1.6 - 1.7 × 10 6 cfu / mL, as Figure 18 intuitively reflected. In the dynamic observation of the spore germination rate, the spore suspension with a concentration of 1 × 10 6 cfu / mL was used as the starting concentration. Through cultivation under moisturizing conditions, the spore germination was measured every 2 h using an optical microscope. As Figure 19As shown, during the initial 2 hours of culture, the spore germination rates of the wild-type, mutant, and complemented strains were similar, approximately 20%. Subsequently, between 4 and 8 hours, the spore germination rate gradually increased to over 70%, reaching near full germination and exceeding 90% by 10 hours. This experiment concluded that the IrXyn01 gene does not regulate conidial germination in the ginseng rust fungus.

[0157] 2. Determination of pathogenicity of knockout mutants

[0158] Three-year-old ginseng roots were used as inoculation materials and cleaned and disinfected using the same method as described in 2.2.2 above. Using the wound inoculation method, 8 mm cakes of wild-type, mutant, and complemented strains cultured at 25°C for 7 days were inoculated into the wounds of the ginseng roots. The culture plates were placed in pre-sterilized Petri dishes, sealed, and incubated at 25°C. After 24 hours of incubation, the cakes were removed from the wounds, sealed, and incubated further. Images were taken and data were measured at 1, 3, 5, 7, and 9 days. Each treatment was replicated six times.

[0159] To further verify the pathogenicity of this gene, the rust content of ginseng after inoculation was quantitatively detected. Conidia of wild-type CBLJ-3 and mutants were collected and the concentration was adjusted to 1×10 7 cfu / mL. Spores were inoculated into ginseng root wounds using the wound inoculation method. Samples were collected at 12, 24, 36, 48, 72, and 96 hpi. Samples were thoroughly ground, and DNA was extracted from plant tissues for quantitative analysis using q-PCR. The Ct values obtained for each treatment were used to calculate concentrations, and differential analysis was performed using SPSS software.

[0160] Table 9 Quantitative detection reaction system

[0161] Reagent Volume(μL) Forward Primer 0.2 μL Reverse Primer 0.2 μL <![CDATA[ddH2O]]> 7.6 μL 2×FastSYBR Misture 10 μL Template DNA 1 μL MSOD 1 μL

[0162] q-PCR reaction conditions: Equal amounts of DNA from each treatment were mixed and used as templates for q-PCR experiments using the UltraSYBR Mixture (Low ROX) kit.

[0163] The wild type, mutant and complemented strains were inoculated on ginseng roots to analyze their pathogenicity. Figure 20As shown in the figure, it was found that after 9 days of inoculation with ΔIrXyn01-1, ΔIrXyn01-2, and ΔIrXyn01-9, the lesion diameters were significantly smaller than those of the wild type CBLJ-3 and the complementary strains C-ΔIrXyn01-1-1, C-ΔIrXyn01-1-3, C-ΔIrXyn01-2-9, C-ΔIrXyn01-2-15, C-ΔIrXyn01-9-7, and C-ΔIrXyn01-9-8. When dissected along the inoculation wound site, it was found that the lesion depth of the mutants was significantly lower than that of the wild type and the complementary strains. To further verify the relationship between this gene and the regulation of the pathogenicity of the rust rot pathogen, fluorescence quantitative PCR detection was carried out and the results were as follows ( Figure 21 , Table 10) shown that the rust rot content of the mutant strains ΔIrXyn01-1, ΔIrXyn01-2, and ΔIrXyn01-9 was significantly lower than that of the wild type strain CBLJ-3. Moreover, as the inoculation time increased, the rust rot concentration gradually increased, but the rust rot content of the mutant strains remained low. The results indicated that the deletion of the IrXyn01 gene led to a significant reduction in pathogenicity, and the IrXyn01 gene was involved in the positive regulation of the pathogenicity of the rust rot pathogen of Panax ginseng. Through the observation of the results of in vitro inoculation, the disease severity of ΔIrXyn01-1 and C-ΔIrXyn01-1-3 was relatively stable in three biological replicates, and these strains were selected for subsequent functional verification.

[0164] Table 10 Detection of the rust rot content of Panax ginseng

[0165] Strain WT ΔIrXyn01-1 [[ID=5 ​ 12 86.38±0.51 a 32.49±0.17 c 31.05±0.08 c 48.82±0.14 b 24 133.11±0.46 a 60.28±0.13 c 43.92±0.03 c ​ 36 158.19±0.44 a ​ 73.62±0.05 c ​ 48 262.72±0.28 a 96.92±0.24 c 102.95±0.10 c 178.52±0.13 b 72 369.49±0.23 a 124.58±0.10 b 150.21±0.80 b ​ 96 408.06±0.33 a 139.58±0.12 c ​ 274.31±0.33 b

[0166] 3. Utilization of carbon and nitrogen sources by the IrXyn01 gene

[0167] The wild type strain CBLJ-3, ΔIrXyn01-1, and the complementary strains that had been cultured for 7 days were respectively inoculated onto the center of Czapek medium containing a sole carbon source: xylan, fructose, glucose, sucrose, sorbitol, mannitol, galactose, soluble starch. They were cultured at 25 °C for 9 days, and the colony diameters were measured for differential analysis and photographed. Each treatment was set with 3 replicates, and each experiment was independently repeated 3 times.

[0168] The wild-type strain CBLJ-3, ΔIrXyn01-1, and the complementary strain were again inoculated onto the center of Czapek medium containing the sole nitrogen source: glycine, glutamine, ammonium sulfate, and sodium nitrate. They were cultured at 25 °C for 9 days, and the colony diameters were measured for differential analysis and photographic recording. Each treatment had 3 replicates, and each experiment was independently repeated 3 times.

[0169] Seven carbon sources were tested, as ​ shown. Cultured at 25 °C for 9 days, compared with the wild-type CBLJ-3 and the complementary strain, the colony diameter of the mutant ΔIrXyn01-1 strain was only significantly inhibited under xylan culture conditions, with an inhibition rate reaching 12.81%. Under other carbon source medium conditions, there were no significant differences among the strains, and there were no aerial hyphae in the colony morphology of the wild-type, mutant, and complementary strains. The results indicate that the IrXyn01 gene is involved in regulating the utilization of xylan in the carbon source by the rust rot pathogen of ginseng.

[0170] Four nitrogen sources were tested, as ​ shown. The wild-type CBLJ-3 utilized ammonium sulfate best. Cultured at 25 °C for 9 days, compared with the wild-type CBLJ-3 and the complementary strain, on Czapek medium with ammonium sulfate as the sole nitrogen source, there was a significant difference in the colony diameter of the ΔIrXyn01-1 strain, and the colony diameter decreased by 29.32%. The results indicate that the IrXyn01 gene is involved in regulating the utilization of nitrogen sources by the rust rot pathogen of ginseng and is particularly important for the utilization of ammonium sulfate.

[0171] 4. Sensitivity determination under hyperosmotic stress

[0172] Hyperosmotic stress was divided into salt stress and cell wall stress. Stress media were prepared according to the literature: NaCl, KCl, sorbitol, SDS, and Congo red (CR) were added to PDA medium, and their final concentrations were: 1 mol / L, 1 mol / L, 2 mol / L, 0.1%, and 250 μg / mL, respectively. PDA medium was used as a blank control. They were cultured at 25 °C for 9 days, and the colony diameters were measured for differential analysis and photographic recording. The stress growth inhibition rate was calculated to analyze the effects of osmotic stress on the morphology and growth of the pathogen. Each treatment had 3 replicates, and each experiment was independently repeated 3 times.

[0173] Stress growth inhibition rate (%) = (control colony diameter - treatment colony diameter) / control colony diameter × 100%.

[0174] On PDA medium containing salt stress factors NaCl, KCl, and Sorbitol, culture at 25 °C for 9 days. Observe the colony growth. The results are as ​ shown. In PDA medium containing 1 mol / L KCl, 1 mol / L NaCl, and 2 mol / L Sorbitol, there are significant differences in the growth rate of the mutant strain ΔIrXyn01-1 compared with the wild type and the complementary strain. Under the condition of containing the KCl stress factor, the inhibition rate of the mutant strain is 37.20%; under the condition of containing the NaCl stress factor, the inhibition rate of the mutant strain is 48.20%; however, under the condition of containing the Sorbitol stress factor, the inhibition rate of the mutant strain is about 0.73%, and the inhibition rate is lower than that of the wild type and the complement, and the inhibition rate decreases. This indicates that the IrXyn01 gene only participates in the response of Cylindrocarpon destructans to the external osmotic pressure salt stress factors NaCl and KCl, and the inhibition rate increases significantly during the culture process, while the inhibition rate decreases under the condition of containing the Sorbitol stress factor.

[0175] On PDA medium containing cell wall stress factors SDS and CR, culture at 25 °C for 9 days, and observe the colony growth. The results are as ​ shown. In PDA medium containing 0.1% SDS, there is no significant difference in the growth rate of the mutant strain ΔIrXyn01-1 compared with the wild type and the complementary strain; while in the medium containing 250 μg / mL CR, the inhibition rate of this mutant reaches 14.62%, proving that the sensitivity of this mutant to the CR stress factor increases and it is inhibited, indicating that the IrXyn01 gene participates in the response of Cylindrocarpon destructans to the external osmotic pressure cell wall stress factor CR.

[0176] 5. Determination of the relative expression level of the IrXyn01 gene under different chemical treatments

[0177] Based on the types and concentrations of the chemical agents and biocontrol agents that have shown the best inhibitory effects on Cylindrocarpon destructans in the previous laboratory studies, which are carbendazim, fludioxonil, difenoconazole, NJ13, FG14, and NT35. Culture the spore suspension at 25 °C and 150 rpm for 72 hpi, add the prepared chemical agents to the spore suspension respectively, and culture again until 7 days. Collect the mycelia, extract the RNA under each treatment, and perform fluorescence quantitative detection to detect the inhibitory effect of the chemical agents on this gene.

[0178] The results show that:

[0179] Through fluorescence quantitative PCR detection and calculation of the Ct values, the results are as ​As shown, it was found that when the untreated wild type with ck was used as the control, the relative expression levels of the bacterial suspensions treated with carbendazim, fludioxonil, difenoconazole, NJ13, FG14, and NT35 were significantly inhibited, all lower than those of the control treatment and the relative levels approaching 0. Through this experiment, it was preliminarily analyzed that the IrXyn01 gene could be used as a target gene for pathogenicity, providing a molecular target for the screening of effective agents in the later stage.

[0180] 6. Determination of xylanase activity

[0181] The mycelial plugs of the wild-type strain CBLJ-3, mutants, and complementary strains were inoculated into PDB medium and cultured at 25 °C and 150 rpm for 12 hpi, 24 hpi, 36 hpi, 48 hpi, and 72 hpi. Then, they were filtered through three layers of lens paper and the filtrates were collected. According to the neutral xylanase (Neutral Xylanase, NEX) assay kit of Suzhou Mengxi Biomedical Technology Co., Ltd., the enzyme activities of the filtrates at different time points under each treatment were detected.

[0182] The NEX activity (nmol / min / mL) was calculated by the formula: = (ΔA - 0.0058) ÷ 1.6904 ÷ 150 ÷ T ÷ V sample × V total sample × 10 6

[0183] where T: reaction time, 30 min; V sample: volume of the supernatant (0.21 mL); V total sample: volume of the extraction solution added (1 mL); 10 6 : 1 mg / mL = 10 6 ng / mL.

[0184] The results showed that:

[0185] As ​ shown, the enzyme activities of the mutant ΔIrXyn01-1 strain were significantly lower than those of the wild-type CBLJ-3 and complementary strains, and the enzyme activity of the mutant strain was 35 - 46 nmol / min / mL. It was shown that the IrXyn01 gene was consistent with the previously predicted xylanase genes and the gene was successfully knocked out, resulting in a significant decrease in enzyme activity.

Claims

1. Ginseng rust fungus ( Ilyonectria robusta ) Xylanase IrXyn01 Use of genes as molecular targets for screening chemical agents that reduce the toxicity of ginseng rust fungi; The ginseng rust fungus xylanase IrXyn01 Gene, its base sequence is shown in SEQ No.1; The chemical agent is used to inhibit the xylanase of ginseng rust fungus IrXyn01 Chemical agents that regulate gene expression.