A set of universal markers for detection of wheat relatives and their application

By designing primer combinations of wheat-specific molecular markers and combining them with PCR and gel electrophoresis techniques, the problem of universality in detecting polyploid wheat relatives was solved, achieving detection results with high specificity and stability, and supporting wheat breeding and germplasm resource screening.

CN118497403BActive Publication Date: 2026-08-25SHANDONG AGRICULTURAL UNIVERSITY
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202410726845.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2023-09-15
Filing Date
2024-06-06
Publication Date
2026-08-25
Estimated Expiration
2044-06-06

AI Technical Summary

Technical Problem

Existing technologies are insufficient for effectively detecting polyploid wheat relatives. Conventional hybridization methods and existing molecular markers lack universality, making it difficult to identify multiple ploidy materials and screen germplasm resources.

Method used

A set of specific molecular markers based on different species of the wheat tribe were developed. Primer combinations were designed using the reference genome and annotation information of Chinese spring wheat. Combined with PCR technology and agarose gel electrophoresis, high specificity and stability of wheat-related species were achieved.

Benefits of technology

It achieves high specificity and stability detection of wheat closely related species, supports the identification of exogenous chromosome fragments and the screening of germplasm resources, and provides a new direction for wheat breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118497403B_ABST
    Figure CN118497403B_ABST
Patent Text Reader

Abstract

The application discloses a set of detection wheat relative species universal markers and application thereof, and belongs to the technical field of plant genetic engineering. The application takes different species of triticeae as research objects, selects specific primers designed on the basis of the length polymorphism information of different introns of the conserved genes of triticeae identified by using the existing Chinese spring wheat reference genome and annotation information and a bioinformatics method, and finally develops the polymorphic DNA molecular markers capable of distinguishing different ploidy materials of triticeae by using PCR technology and agarose gel electrophoresis technology. The molecular markers have high specificity, stability and universality, and provide a new direction for identification of exogenous chromosome fragments of wheat, molecular marker assisted breeding of exogenous genes and screening of germplasm resources.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to a set of universal markers for detecting wheat-related species and their applications. Background Technology

[0002] Wheat family ( Wheat ) is a member of the Poaceae family ( Grasses Triticum is a very important group of plants, with a wide distribution and numerous species. The Triticum tribe genome contains a large number of repetitive sequences, with over 85% of the genome sequence being repetitive, making the genome extremely complex. Currently, progress in Triticum genome research is relatively slow.

[0003] Wheat relatives are important germplasm resources for wheat genetic improvement, possessing many superior traits related to wheat quality, yield, or resistance. However, conventional hybridization methods are difficult for studying exogenous chromosome fragments in common wheat and for identifying germplasm materials. DNA molecular markers, due to their advantages such as a large number of markers, high polymorphism, independence from tissue type and developmental stage, simplicity, speed, and ease of automation, have gained in-depth research, widespread application, and rapid development.

[0004] However, most research on wheat species focuses on diploid species. "CN 112725524 B A set of universal markers for detecting closely related wheat species and their application" designed specific molecular markers, but its detection targets are mainly diploids, with relatively few studies on polyploid species. "CN 110129473 B A species of long-spike drooping wheat..." e "Genomic-Specific Molecular Markers and Their Applications," while capable of identifying diploid to polyploid organisms, requires the inclusion of E. long-spike wheatgrass. e Genes are not universally applicable. Therefore, exploring a universal marker capable of detecting wheat relatives of various ploid types is crucial for future wheat breeding efforts. Summary of the Invention

[0005] To address the aforementioned issues in existing technologies, the purpose of this invention is to provide a set of universal markers for detecting closely related species of wheat and their applications. To resolve the problems associated with traditional techniques, this study uses different species within the wheat tribe as research materials and leverages the latest reference genome and annotation information for Chinese spring wheat to develop wheat tribe-specific molecular markers. These molecular markers exhibit high specificity, stability, and universality, providing new directions for the identification of exogenous chromosome fragments in wheat, marker-assisted breeding of exogenous genes, and the screening of germplasm resources.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a primer composition for detecting closely related species of wheat, said primer composition comprising at least one of the primer pairs described in i) to iii): i) The nucleotide sequence is the primer pair shown in SEQ ID NO.1 and SEQ ID NO.2; ii) The nucleotide sequence is the primer pair shown in SEQ ID NO.3 and SEQ ID NO.4; iii) The nucleotide sequence is the primer pair shown in SEQ ID NO.5 and SEQ ID NO.6.

[0007] A second aspect of the present invention provides the application of primer combinations in the development of specific molecular markers for wheat-related species.

[0008] A third aspect of the present invention provides the application of wheat-related species-specific molecular markers obtained by primer combinations in the breeding of new wheat varieties.

[0009] In a fourth aspect, the present invention provides a PCR reagent for detecting the genome of a closely related wheat species, the PCR reagent comprising the primer combination described above.

[0010] A fifth aspect of the invention provides the use of primer combinations or PCR reagents in any one of 1) to 2): 1) Detecting the genomes of wheat's closest relatives; 2) Detect products containing the genome of wheat-related species.

[0011] In a sixth aspect, the present invention provides a method for detecting the genome of a wheat-related species in a test plant, comprising the following steps: amplifying the test plant using the primer combination described above; if successful amplification is achieved, it indicates that the test plant contains the genome of a wheat-related species.

[0012] Furthermore, the amplification reaction system is as follows: 1.0 μL template DNA (25 ng / μL), 0.3 μL DNATaq polymerase (5 U / μL), 200 μM dNTPs, containing Mg 2 Add 7.2 μL of 10× PCR buffer, 0.5 μL each of 10 μM upstream and downstream primers, and replenish the reaction mixture with sterile double-distilled water to a final volume of 15 μL. The amplification reaction program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 sec, 58℃ annealing for 15 sec, 72℃ extension for 15 sec, followed by 35 cycles: 72℃ extension for 5 min, 15 sec annealing, and storage at 4℃.

[0013] Furthermore, the amplification was detected using 1.5–2% PAGE gel electrophoresis.

[0014] The beneficial effects of this invention are: This study focused on different species within the wheat tribe. Based on the existing Chinese spring wheat reference genome and its annotation information, as well as the length polymorphism information of different introns of conserved genes in the wheat tribe identified using bioinformatics methods, specific primers were designed accordingly. Then, using PCR and agarose gel electrophoresis techniques, a polymorphic DNA molecular marker capable of distinguishing different ploidy types in wheat tribe materials was finally developed. This molecular marker exhibits high specificity, stability, and universality, providing new directions for the identification of exogenous chromosome fragments in wheat, marker-assisted breeding of exogenous genes, and screening of germplasm resources. Attached Figure Description

[0015] Figure 1 Here is a gel electrophoresis image showing the detection results using Triad_103 primers; Figure 2 Gel electrophoresis images showing the detection results of Triad_103 in different ploidy types. Detailed Implementation

[0016] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0017] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0018] The test materials used in the embodiments of this invention, unless otherwise specified, are all conventional test materials in the art and can be purchased through commercial channels.

[0019] This experiment was conducted at the State Key Laboratory of Crop and Biology, Shandong Agricultural University.

[0020] Test materials: Chinese Spring (CS), common wheat (Huixian Red, Aikang 58, Lumai 15, Linmai 9, Jimai 22, Fielder), and short-stalked grass ( brachypodium , 2n=2x=14, DD), Goat grass ( Aegilops tauschii ,2n=2x=14,DD), Comoros goat grass ( Aegilops comosa , 2n=2x=14, DD), Goatgrass ( Aegilops Longissima ,2n=2x=14,DD) and Sauropsis ( Aegilops sharonensis ,2n=2x=14,DD), tetraploid wheat ( Wheat turgid L , 2n=4x=28, AABB) Example 1: DNA Extraction Fresh leaves were taken from the test material, and whole-genome DNA was extracted using the ammonium acetate method. The specific method is as follows: (1) Take multiple centrifuge tubes and put two steel balls into a 2mL centrifuge tube for later use.

[0021] (2) Cut about 2 cm from the tissue material of the wheat leaf with scissors, put it into the prepared 2 mL centrifuge tube, and put the cap on the centrifuge tube. Mark the cap and the wall of the centrifuge tube with a marker.

[0022] (3) After preparing the sample, place the sample centrifuge tube into the adapter, and then place the adapter into liquid nitrogen to freeze. Make sure the adapter lid is tightly closed and secured with two rubber bands. Next, place the adapter containing the sample into liquid nitrogen again for freezing. Then, place the centrifuge tube containing the sample into the grinding machine. During the grinding process, we generally set the frequency to 20Hz and the time to 15S. After grinding, place the ground sample centrifuge tube back into liquid nitrogen for preservation.

[0023] (4) Preheat the DNA extraction solution to 65°C.

[0024] (5) Add 800 μL of the preheated DNA extraction solution to a centrifuge tube and shake it thoroughly on a shaker.

[0025] (6) Heat it in hot water at 65°C for half an hour, then place it on ice for 5-10 minutes.

[0026] (7) Add 400 μL of 6M ammonium acetate stored at 4℃, invert and mix well, then let stand on ice for 15 min, and then centrifuge at 12000 rpm for 10 min.

[0027] (8) Take a new 1.5 mL centrifuge tube and add 450 μL of isopropanol. Take about 750 μL of the supernatant from the centrifuge tube in the above step and add it to the new centrifuge tube. Mix gently. Place in a -20°C refrigerator and let stand for at least 30 minutes.

[0028] (9) Centrifuge at 12000 rpm for 10 min, aspirate and discard the supernatant, add 500 μL of 75% ethanol for washing, shake vigorously up and down, and centrifuge again at 12000 rpm for 10 min without allowing DNA to precipitate at the bottom of the test tube. Repeat this step once.

[0029] (10) Discard the supernatant in the tube, then blow it dry on the clean bench, add 100 μL of TE buffer or ddH2O, perform a short separation, and then place it in a 4°C refrigerator to dissolve the DNA.

[0030] Example 2: PCR amplification (1) The amplification reaction system (total system 15 μL) contains the following components: Table 1. Amplification reaction system (2) Amplification procedure: Table 2. Amplification Procedure Example 3: Agarose gel electrophoresis (1) Gel preparation: Generally, prepare 150 mL or 200 mL of SB system with agarose concentration of 2%, or 150 mL or 200 mL of TAE system with agarose concentration of 1.5%.

[0031] ① Calculate the required weight of agarose powder based on the number of PCR product samples, and accurately weigh the agarose powder using an electronic balance.

[0032] ② Wash the glue-making mold and comb with distilled water, place them on the glue-making plate, and set the comb aside for later use.

[0033] ③ Pour the agarose powder into a dry conical flask, add a measured amount of TAE or SB solution, shake well, and heat in a microwave oven.

[0034] ④ Heat for about 3 minutes, take it out and shake well, then repeat this step until the solution becomes clear and transparent.

[0035] ⑤ Rinse the conical bottle with cold water until its temperature drops to around 65°C.

[0036] ⑥ Add a few drops of EB, mix well, and slowly pour into the molding die. Then insert the comb into the molding die and remove any air bubbles.

[0037] (2) Electrophoresis: ① After the glue has completely cooled, gently pull the comb out.

[0038] ② Add buffer solution to the electrophoresis tank until it covers the gel surface.

[0039] ③ Add marker to the spotting well and then add the sample in sequence.

[0040] ④ Connect the power supply. Red is the positive electrode and black is the negative electrode. Electrophoresis of the SB system gel is performed at a constant voltage of 220V for 45 minutes, and electrophoresis of the TAE system gel is performed at a constant voltage of 170V for 35 minutes.

[0041] ⑤ After electrophoresis is complete, turn off the power.

[0042] (3) Development: Remove the gel from the gel casting mold and place it on a gel imaging system to observe the electrophoresis bands and their positions. Adjust the brightness to make them clearly visible and take a picture to save the image.

[0043] Example 4: Selection of Molecular Markers Using the Chinese spring as a template, markers with significant differences in DNA fragment size were selected from a genome-wide molecular marker library. This simplifies detection. In our experiments, regardless of the electrophoresis method used, the bands were clear and easily distinguishable. Others can directly use these markers instead of more complex electrophoresis or methods requiring more expensive equipment and higher costs, such as fluorescence or altered annealing temperatures. Table 3 lists the molecular markers selected for subsequent validation.

[0044] Table 3. Information on specific molecular markers The primers for Triad_103 are SEQ ID NO.1 and SEQ ID NO.2, respectively. The primers for Triad_370 are SEQ ID NO.3 and SEQ ID NO.4, respectively. The primers for Triad_445 are SEQ ID NO.5 and SEQ ID NO.6, respectively. SEQID NO.1: TGACTTGGGAAGTGGCAGCA; SEQID NO.2: GGGAAGCTCGACTGTTTTCAGG; SEQID NO.3: TTTCAGGGTCCCCACCATCT; SEQID NO.4: TTCGAGTCGACATACCCCACC; SEQID NO.5: AGAGGTCACGGTCGGAAGC; SEQID NO.6: GAGTGCGACCAATGAACCTTT.

[0045] Example 5: Validation of Molecular Markers The selected molecular markers were tested for effectiveness on Chinese CS and Fielder materials. Since the materials are hexaploid, we first selected markers with obvious three bands, and then determined the effectiveness of the molecular markers based on whether the band size was consistent with the size of the target band. Finally, we selected the effective markers. Figure 1The gel electrophoresis image shows the detection of the selected representative primer Triad_103.

[0046] Example 6: Ploid detection of specific molecular markers Through the above steps, we selected qualified markers and conducted effectiveness tests on them in *Aegilops brevipedus*, *Aegilops tangutica*, *Aegilops comosa*, *Aegilops longifolia*, *Aegilops saloidea*, tetraploid wheat, common wheat (Huixian Red, Aikang 58, Lumai 15, Linmai 9, Jimai 22, Fielder), and *C. chinensis*. Markers with clear bands and the correct number of bands were selected based on the ploidy of the material. Through screening, we obtained three qualified specific molecular markers. Applying these specific molecular markers to these three ploidy types of materials can effectively distinguish ploidy types from different sources, demonstrating their versatility. Figure 2 Gel electrophoresis images of the selected representative molecular marker Triad_103 on different ploidy types.

[0047] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A primer combination for detecting closely related species of wheat, characterized in that, The primer combination is a primer pair with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2; the wheat closely related species are short-stalked grass, goatgrass, Comosa goatgrass, long goatgrass, Salo goatgrass, tetraploid wheat and Chinese spring.

2. A PCR reagent for detecting the genome of wheat-related species, characterized in that, The PCR reagent comprises the primer combination as described in claim 1.

3. The application of the primer combination of claim 1 or the PCR reagent of claim 2 in distinguishing ploidy in closely related wheat species, characterized in that, The wheat-related species mentioned are *Aegilops brevipedus*, *Aegilops sambar formosana*, *Aegilops comosa*, *Aegilops longissimus*, *Aegilops salsa*, tetraploid wheat, and *Cegilops chinensis*.

Citation Information

Patent Citations

  • A type of long-spike wheatgrass E e Genome-specific molecular markers and their applications

    CN110129473B

  • A set of universal markers for detecting wheat's closely related species and their applications

    CN112725524B

  • A group of universal markers for detecting wheat related species and application thereof

    CN112725524A

  • Wheat family species Ns genome specific KASP molecular marker primer and application thereof

    CN116083626A