Method and application for site-directed mutagenesis of Brassica napus negative regulation drought and salt tolerance gene BnUSDR

Abstract

The present invention provides a method for site-directed mutagenesis of the negative regulatory drought and salt tolerance gene BnUSDR in Brassica napus and its application, belonging to the technical fields of plant gene editing and plant breeding. By comparison, the present invention discovers the BnUSDR gene in Brassica napus that negatively regulates plant drought and salt tolerance, and uses the CIRSPR / Cas9 system to perform site-directed mutagenesis on the BnUSDR gene in Brassica napus for breeding. The specific steps are as follows: Design specific targeting sgRNA according to the conserved region of the BnUSDR gene, and simultaneously construct a dual-target CIRSPR / Cas9 site-directed mutagenesis vector, and transform it into Brassica napus Y127 through Agrobacterium-mediated transformation to create new germplasms with site-directed mutagenesis of this gene that are drought-resistant and salt-tolerant. The present invention uses gene editing technology to knockout the gene that negatively regulates drought and salt tolerance to create new germplasms, greatly improving the efficiency of rapeseed breeding and shortening the rapeseed breeding cycle, providing new ideas for drought and salt-tolerant rapeseed breeding.

Description

Technical Field

[0001] The present invention belongs to the technical fields of plant gene editing and plant breeding, and particularly relates to providing a BnUSDR gene for negatively regulating plant drought and salt tolerance in Brassica napus, a method for site-directed mutagenesis of the BnUSDR gene through the CIRSPR / Cas9 system, and an application for improving the drought and salt tolerance of Brassica napus. Background Art

[0002] Brassica napus belongs to the genus Brassica of the Brassicaceae family, and is the largest oil source of self-produced vegetable oil in China. The oil production accounts for about 55% of the oil production of domestic oil crops, and it is an important guarantee for ensuring the supply of vegetable oil. However, at present, the sown area and yield of rapeseed have increased slightly, while the consumption and trade volume have continued to increase, and the overall supply and demand situation of rapeseed is relatively tight. Moreover, with the continuous optimization and adjustment of the agricultural industrial structure, rapeseed has gradually developed from mainly being used for oil to an important cash crop integrating multiple functions such as energy, vegetables, green manure, feed, and ornamental. Rapeseed occupies an important position in agricultural products and has great development potential.

[0003] The problem of soil salinization seriously restricts the sustainable development of agriculture. According to incomplete statistics, the area of saline-alkali land in China is about 0.35 billion hectares, accounting for 3.67% of the global saline-alkali land area, and the soil salinization still shows an increasing trend. Rapeseed belongs to moderately salt-tolerant plants and is one of the important crops in the development and utilization of saline-alkali land. Moreover, the climates in the five major saline-alkali areas in Northeast China, Northwest China, coastal areas, the middle and upper reaches of the Yellow River, and the Huang-Huai-Hai Plain and the saline-alkali land of coastal beaches in Jiangsu are all suitable for growing rapeseed. If salt-tolerant rapeseed varieties can be cultivated and the saline-alkali land resources can be reasonably developed and utilized to grow rapeseed, the oil production capacity of China will be greatly improved. Rapeseed has a wide range of suitable planting areas, and 80% of the currently planted rapeseed is Brassica napus. Brassica napus has a higher yield compared to Brassica rapa and Capsella bursa-pastoris, but it is more sensitive to drought stress and is extremely prone to drought damage. As the main rapeseed production area, the Yangtze River Basin has uneven precipitation throughout the year and is prone to seasonal drought, reducing the rapeseed yield. Therefore, carrying out rapeseed stress resistance research, reducing and preventing the harm of drought and salt stress to rapeseed, and breeding drought-resistant and salt-tolerant rapeseed varieties can not only increase the rapeseed yield, but also make more full use of land resources, expand the planting area of rapeseed, and is also an urgent need for the development of the rapeseed industry, which has important significance.

[0004] The CRISPR (clustered regularly interspaced short palindromic repeats) gene editing and knockout technology, which won the Nobel Prize in Chemistry in 2020, can precisely and rapidly edit target genes in crops without introducing other foreign genes, making it indistinguishable from crop varieties bred based on natural variation or mutagenesis. However, it has the advantages of precise editing, simple operation, short time consumption, and low cost, greatly improving the breeding efficiency and thus creating new germplasms. It has also become a new high ground for breeding technologies that many countries are vying for. Brassica napus, as an allopolyploid crop with a relatively complex genome, has many homologous copies, and there is gene redundancy among different homologous copies. The CRISPR / Cas9 system site-directed mutagenesis technology, due to its high efficiency and convenience, and its ability to knockout multiple genes simultaneously, has played an important role in enhancing plant stress resistance, plant genetic improvement, analyzing plant gene functions, and improving crop quality. Therefore, finding regulatory genes that negatively regulate plant salt tolerance and drought resistance and using the CRISPR / Cas9 system site-directed mutagenesis technology for innovative breeding in rapeseed will have important application prospects.

[0005] As an enzyme, the small molecule glycosyltransferase UGTs (Plant secondary metabolite UDP-dependent glycosyltransferases) can catalyze the transfer of the glycosyl group on UDPG to important signal small molecule substrates in plants, thereby changing the activity of small molecules. The main characteristic of UGTs is the presence of a conserved element, the PSPG box (Plant secondary product glycosyltransferase box). The UGTs protein family is very conserved in evolution. Studies have found that UGTs can glycosylate various plant hormones such as ABA, SA, and JA, thus playing an important role in plant growth and development and various stress responses. Summary of the Invention

[0006] In view of the above technical problems, the present invention provides a method and application for site-directed mutagenesis of the negative regulatory drought and salt tolerance gene BnUSDR in Brassica napus. By comparison, the present invention discovers the BnUSDR gene in Brassica napus that negatively regulates plant drought and salt tolerance, and uses the CRISPR / Cas9 system to perform site-directed mutagenesis on the BnUSDR gene in Brassica napus for breeding. The specific steps are as follows: Design specific targeting sgRNAs according to the conserved region of the BnUSDR gene, and simultaneously construct a double-target CRISPR / Cas9 site-directed mutagenesis vector, and transform it into Brassica napus Y127 through Agrobacterium-mediated transformation to create new germplasms with site-directed mutagenesis of this gene that can be drought-resistant and salt-tolerant. The present invention uses gene editing technology to knock out the gene that negatively regulates drought and salt tolerance to create new germplasms, greatly improving the efficiency of rapeseed breeding and shortening the rapeseed breeding cycle, providing new ideas for drought and salt-tolerant rapeseed breeding.

[0007] In the BnUSDR gene of the present invention, Bn represents the English abbreviation of rapeseed, and U, S, D, and R are the first letters of UGTs, Salt, Drought, and Resistance respectively.

[0008] To achieve the above object, the present invention adopts the following technical means:

[0009] The present invention first provides the application of the BnUSDR gene in regulating drought and / or salt tolerance in Brassica napus. The BnUSDR gene includes BnUSDR-C05 and BnUSDR-A10. The nucleotide sequence of BnUSDR-C05 is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2;

[0010] The nucleotide sequence of BnUSDR-A10 is shown in SEQ ID NO.3, and the amino acid sequence is shown in SEQ ID NO.4.

[0011] Preferably, the application is to improve the drought and / or salt tolerance ability of Brassica napus by knocking out or silencing BnUSDR-C05 and BnUSDR-A10; preferably, gene site-directed mutagenesis is used to knock out or silence BnUSDR-C05 and BnUSDR-A10.

[0012] The present invention also provides a CRISPR / Cas9 system sequence element group for site-directed mutagenesis of the above-mentioned BnUSDR gene in Brassica napus. The sequence element group includes U6-26p-Target1-gRNA, U6-26p-Target2-gRNA, and the codon-optimized Cas9 gene;

[0013] The U6-26p-Target1-gRNA includes the promoter U6-26p, the gRNA backbone structure, and Target1;

[0014] The U6-26p-Target2-gRNA includes the promoter U6-26p, the gRNA backbone structure, and Target2;

[0015] The Brassica napus BnUSDR gene includes BnUSDR-C05 and BnUSDR-A10, and Target1 and Target2 are the target sequences of the genes BnUSDR-C05 and BnUSDR-A10;

[0016] The nucleotide sequence of Target1 is: 5’-CCCGGAGATCCAAGACCCGC-3’ (SEQ ID NO.5);

[0017] The nucleotide sequence of Target2 is: 5’-TGTTCCGGCTAAGGTTCTGC-3’ (SEQ ID NO.6);

[0018] The nucleotide sequence of the sgRNA is: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO.7).

[0019] The present invention also provides a gene editing vector pKSE401-BnUSDR-CRISPR, which contains the above CRISPR / Cas9 system sequence element group for site-directed mutagenesis of the Brassica napus BnUSDR gene.

[0020] The present invention also provides a genetically engineered bacterium for site-directed mutagenesis of the Brassica napus BnUSDR gene, which is obtained by transforming a host bacterium with the above gene editing vector pKSE401-BnUSDR-CRISPR.

[0021] The present invention also provides a kit for site-directed mutagenesis of the Brassica napus BnUSDR gene, which contains the above gene editing vector or genetically engineered bacterium.

[0022] The present invention also provides the application of the above sequence element group, gene editing vector pKSE401-BnUSDR-CRISPR, genetically engineered bacterium or kit, and the application includes:

[0023] (A) Application in site-directed mutagenesis of the above Brassica napus genes BnUSDR-C05 and / or gene BnUSDR-A10;

[0024] (B) Use in the breeding of Brassica napus with salt resistance and drought tolerance; and / or

[0025] (C) Use in the breeding of Brassica napus with increased yield under salt and drought conditions.

[0026] The present invention also provides a method for site-directed mutagenesis of the BnUSDR gene in Brassica napus using the CIRSPR / Cas9 system, including:

[0027] (1) Design and screen target sites Target1 and Target2 for the BnUSDR gene in Brassica napus, design the sgRNA sequence, connect the two target sites Target1 and Target2 with the sgRNA sequence respectively, and construct a dual-target gene editing vector pKSE401-BnUSDR-CRISPR;

[0028] (2) Transform the gene editing vector pKSE401-BnUSDR-CRISPR into Agrobacterium tumefaciens GV3101 to obtain Agrobacterium containing the gene editing expression vector pKSE401-BnUSDR-CRISPR;

[0029] (3) Expand the culture, and transfer the pKSE401-BnUSDR-CRISPR vector into the hypocotyls of rapeseed by the Agrobacterium-mediated method;

[0030] (4) Culture the hypocotyls of rapeseed, induce callus, redifferentiate, root culture, harden off seedlings, and transplant to obtain transgenic rapeseed;

[0031] (5) Identify transgenic plants with mutations in the BnUSDR gene;

[0032] The nucleotide sequence of the said Target1 is as shown in SEQ ID NO.5,

[0033] The nucleotide sequence of the said Target2 is as shown in SEQ ID NO.6,

[0034] The nucleotide sequence of the said sgRNA is as shown in SEQ ID NO.7.

[0035] Preferably, the said Target1 and Target2 are the target sequences of the genes BnUSDR-C05 and BnUSDR-A10.

[0036] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0037] Abscisic acid (ABA) is an important plant hormone that plays a crucial role in plant stress responses such as drought resistance and salt tolerance. UGT71C5, a small-molecule glycosyltransferase in Arabidopsis thaliana, can glycosylate ABA, thereby inactivating the ABA responsible for drought and salt tolerance and negatively regulating the drought and salt tolerance of Arabidopsis thaliana.

[0038] In this invention, Brassica napus was homologously aligned with Arabidopsis thaliana UGT71C5, and two genes, BnUSDR-A10 and BnUSDR-C05, which are most similar to Arabidopsis thaliana, were obtained. Sequencing revealed that both genes have the conserved element PSPG box of UGTs. For the first time in this invention, the CRISPR / Cas9 system was used to perform site-directed mutagenesis on the Brassica napus UGTs BnUSDR-A10 and BnUSDR-C05 genes, and drought- and salt-tolerant Brassica napus germplasms were obtained. The new germplasms created in this invention can tolerate drought for 27 days and up to 600 mM NaCl. Therefore, these germplasms can possess both drought and salt tolerance, two stress resistance characteristics, and have more promotion value compared to germplasms with only one type of resistance, either drought or salt tolerance.

[0039] The two targets, Target 1 and Target 2, selected in this invention can both target the two genes BnUSDR-A10 and BnUSDR-C05 simultaneously, and the target targeting sequences are both in front of the conserved element PSPG box of glycosyltransferase. This ensures that any one or both of the two targets, Target 1 and Target 2, can function to generate base modifications in front of the conserved element PSPG box on both the BnUSDR-A10 and BnUSDR-C05 genes, thus enabling the selection of base modifications that cause the simultaneous loss of function of these two genes. Therefore, the selection of the two targets, Target 1 and Target 2, ensures the simultaneous knockout of BnUSDR-A10 and BnUSDR-C05.

[0040] This invention discovered a gene, BnUSDR, that can negatively regulate the drought and salt tolerance of Brassica napus. By constructing a CRISPR gene editing vector for this gene and transforming Brassica napus Y127, this gene was successfully knocked out, thereby improving the drought and salt tolerance of Brassica napus. The transformed plants obtained after transforming Brassica napus with the gene editing vector pKSE401-BnUSDR-CRISPR constructed in this invention provide experimental materials for studying the function and mechanism of action of the gene BnUSDR and can also be used as new drought- and salt-tolerant germplasm resources. This invention has broad application prospects in the breeding of drought- and salt-tolerant Brassica napus. Brief Description of the Drawings

[0041] Figure 1This is a differential alignment map of the BnUSDR-A10 and BnUSDR-C05 protein sequences.

[0042] Figure 2 This is a schematic diagram of the selected target sites for BnUSDR-A10 (a) and BnUSDR-C05 (b) and the position of the PSPG box (Plant secondary product glycosyltransferase box) in the sequence.

[0043] Figure 3 This is the off-target score and actual off-target situation of the predicted off-target sites in the CDS coding region of the off-target genes.

[0044] Figure 4 This is a schematic diagram of the positions of the selected Target1 and Target2 target sites on the gene (a). In the figure, LB: left border; RB: right border; Kan: kanamycin resistance gene; P-CaMV35S: CaMV35 promoter; U6-26p-Target1-gRNA: gRNA expression element group, including promoter U6-26p, gRNA backbone structure and target 1 (Target1); U6-26p-Target2-gRNA: gRNA expression element group, including promoter U6-26p, gRNA backbone structure and target 2 (Target2); Cas9: Cas9 gene optimized according to codons (b) and a schematic diagram within the LB and RB ranges in the pKSE401-BnUSDR-CRISPR plasmid.

[0045] Figure 5 This is a PCR identification gel image of the genomic DNA extracted from the leaves of 2 positive strains obtained by transformation; in the figure, Marker: Takara DL5000 DNA Marker; usdr-1, usdr-2: mutant transgenic plants; +: positive control, pKSE401-BnUSDR-CRISPR plasmid; -: negative control, ddH2O; WT: wild type.

[0046] Figure 6 This is an identification gel image of 4 selected plants from which the Cas-9 protein has been separated; +: positive control, pKSE401-BnUSDR-CRISPR plasmid; -: negative control, ddH2O.

[0047] Figure 7 This is a schematic diagram of the sequencing result analysis of the BnUSDR-A05 gene (a) and BnUSDR-C10 gene (b) in the usdr mutant compared with the wild type; figure (c) is a summary of the editing types of the four individual plants 3-7, 4-2, 4-9, and 5-19.

[0048] Figure 8 This is a comparison chart for drought treatment of wild type and usdr mutants at different times (a) and rehydration after drought treatment (b).

[0049] Figure 9 This is a comparison chart for salt treatment (600 mM NaCl) of wild type and usdr mutants at different times.

[0050] Figure 10 This shows the expression of BnUSDR at different times after treating wild type Y127 plants with 10 μM ABA.

[0051] Figure 11 This shows the expression of BnUSDR at different times after treating wild type Y127 plants with 250 mM NaCl. Detailed implementation mode

[0052] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, but the protection scope of the present invention is not limited thereto. In the following embodiments, the technical means used are all conventional means well known to those skilled in the art. Various processes and methods not described in detail are all conventional methods well known in the art. The sources, trade names of the reagents used and those for which it is necessary to list their components are indicated when they first appear. For the same reagents used later, without special instructions, they are the same as those indicated for the first time; for the reagents, materials, etc. involved, without special instructions, they are obtained through commercial channels.

[0053] The culture media and their formulations used in the present invention are as follows:

[0054] LB liquid medium (1 L): 5 g of yeast extract, 10 g of tryptone, 10 g of sodium chloride (NaCl), sterilized at 121 °C under high temperature and high pressure for 15 min, and stored in a 4 °C refrigerator after cooling for standby.

[0055] LB solid medium (1 L): 5 g of yeast extract, 10 g of tryptone, 10 g of sodium chloride (NaCl), 15 g of agar powder. Then it is divided into 10 conical flasks, sealed with sealing film, sterilized at 121 °C under high temperature and high pressure for 15 min, and stored in a 4 °C refrigerator after cooling for standby. When in use, it is heated in a microwave oven until melted. After the liquid cools to about 50 °C, antibiotics are added, shaken well and immediately poured into a sterile petri dish.

[0056] M0 Medium (1 L): 4.4 g of MS powder, 30 g of sucrose, adjust the pH value to 5.84 - 5.88 with 1 mol / L KOH, 10 g / L of coagulant Agar, and dispense after sterilization.

[0057] DM Medium (1 L): 4.4 g of MS powder, 30 g of sucrose, adjust the pH value to 5.84 - 5.88 with 1 mol / L KOH, sterilize, add AS when in use, add 1 mL of AS (stock solution 100 μmol / mL) to 1 L, and store in a 4°C refrigerator for later use.

[0058] M1 Medium (1 L): 4.4 g of MS powder, 30 g of sucrose, 18 g of mannitol, 1 mg of 2,4-D, 0.3 mg of KT, adjust the pH value to 5.84 - 5.88 with 1 mol / L KOH, 10 g / L of coagulant Agar, add AS when the medium is almost cooled after sterilization, add 1 mL of AS (stock solution 100 μmol / mL) to 1 L, quickly dispense into sterile petri dishes, and store in a 4°C refrigerator for later use.

[0059] M2 Medium (1 L): 4.4 g of MS powder, 30 g of sucrose, 18 g of mannitol, 1 mg of 2,4-D, 0.3 mg of KT, adjust the pH value to 5.84 - 5.88 with 1 mol / L KOH, 10 g / L of coagulant Agar, add the following when the medium is almost cooled after sterilization: 300 mg / L of Timentin (TMT), 150 μmol / L of STS, 25 mg / L of kanamycin, and then dispense into sterile petri dishes and store in a 4°C refrigerator for later use.

[0060] M3 Medium (1 L): 4.4 g of MS powder, 10 g of glucose, 0.25 g of xylose, 0.6 g of MES, make up the volume with double-distilled water, adjust the pH value to 5.84 - 5.88 with 1 mol / L KOH, 10 g of coagulant Agar, add the following when the medium is almost cooled after sterilization: 2 mg of ZT, 0.1 mg of IAA, 300 mg of Timentin (TMT), 150 μmol of AgNO3, 25 mg of kanamycin, and then dispense into sterile petri dishes.

[0061] M4 Medium (1 L): 4.4 g of MS powder, 10 g of sucrose, make up the volume with double-distilled water, adjust the pH value to 5.84 - 5.88 with 1 mol / L KOH, 8 g of coagulant Agar, add 300 mg of Timentin (TMT) when the medium is almost cooled after sterilization, and then dispense.

[0062] Example 1: Identification and Obtaining of BnUSDR Gene

[0063] Through comparative screening, the present invention discovered the gene BnUSDR that regulates the drought resistance and salt tolerance of Brassica napus. BnUSDR contains a total of two genes, BnUSDR-A10 and BnUSDR-C05. Since the similarity between these two genes is relatively high, in this example, PCR combined with sequencing was used to distinguish BnUSDR-A10 and BnUSDR-C05.

[0064] Primers were designed according to the coding sequences of the BnUSDR gene on the rapeseed website (https: / / www.genoscope.cns.fr / brassicanapus / ). The primer sequences are as follows:

[0065] USDR-CO5-F (SEQ ID NO.10): CCGAGCCTGGTATACGACT

[0066] USDR-CO5-R (SEQ ID NO.11): CCTGATAGGGTTACCACCGT;

[0067] USDR-A10-F (SEQ ID NO.12): TGTCAACGATCGAAT

[0068] USDR-A10-R (SEQ ID NO.13): AAGCACGCGGGTAATCT

[0069] Then, using the leaf cDNA of rapeseed variety Y127 (from the State Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University) as a template, the high-fidelity enzyme 2*Phanta MAX Master Mix (purchased from Nanjing Novoprotein Biological Technology Co., Ltd.) was used to amplify the CDS sequence of the BnUSDR gene. The PCR reaction is shown in Table 1.

[0070] Table 1. High-fidelity enzyme PCR amplification reaction system

[0071] PCR Reaction System Volume <![CDATA[ddH2O]]> 20 μL 2*Phanta Max Master Mix 25 μL Forward Primer (10 μM) 2 μL Reverse Primer (10 μM) 2 μL Template DNA (50 - 400 ng) 1 μL

[0072] The PCR reaction procedure was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 2 min, for a total of 35 cycles; final extension at 72°C for 5 min. After the PCR reaction was completed, the PCR products were subjected to gel electrophoresis at 120 V in a 1% agarose gel (mass / volume) for 30 min, and then photographed under an ultraviolet gel imager to record the results. The results showed that the sizes of the target fragments amplified by these primers, namely the BnUSDR-A10 and BnUSDR-C05 gene fragments, were approximately 1476 bp.

[0073] Referring to the operation instructions in the FastPure Gel DNA Extraction Mini Kit (purchased from Nanjing Novoprotein Scientific Inc.), the PCR amplified product of the BnUSDR gene was recovered from the agarose gel. Then, the recovered PCR amplified product of the BnUSDR gene was ligated to the pMD19-T vector (purchased from TaKaRa Bio Inc. (Dalian)). The ligation system was as follows: 4.5 μL of the gel recovery product, 0.5 μL of the pMD-19T vector, and 5 μL of SolutionⅠ (purchased from TaKaRa Bio Inc. (Dalian)). The ligation was carried out overnight at 16 °C to obtain the ligation product.

[0074] 10 μL of the ligation product was added to 50 μL of Escherichia coli competent cells (purchased from Sangon Biotech (Shanghai) Co., Ltd.). According to the steps in the instruction manual, the ligation product was transformed into Escherichia coli and spread on a solid LB plate with Amp (30 mg / mL) resistance. After about 12 h, 10 single colonies were picked and cultured with shaking for 12 - 16 h. 2 μL of the bacterial liquid was taken as the template for PCR amplification for identification. The primers for the PCR reaction were:

[0075] M13-F (SEQ ID NO.14): TGTAAAACGACGGCCAGT

[0076] M13-R (SEQ ID NO.15): CAGGAAACAGCTATGACC.

[0077] The PCR amplification reaction system is shown in Table 2. The PCR reaction program was: pre-denaturation at 94 °C for 3 min; denaturation at 94 °C for 30 s, annealing at 50 °C for 30 s, extension at 72 °C for 1 min, for a total of 28 cycles; final extension at 72 °C for 5 min.

[0078] Table 2. PCR amplification reaction system for bacterial liquid

[0079] PCR Reaction System Volume <![CDATA[ddH2O]]> 6 μL R-Taq 10 μL Forward Primer (10 μM) 1 μL Reverse Primer (10 μM) 1 μL Bacterial Solution 2 μL

[0080] The result of the PCR amplification was detected on a 1% agarose gel. It was found that the obtained DNA fragment was about 1500 bp, indicating successful transformation. 100 μL of each of the 10 successfully transformed bacterial liquids was taken and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. By analyzing the sequencing results, the sequences of BnUSDR-A10 and BnUSDR-C05 were obtained. Their nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.3 respectively, and the amino acid sequences are shown in SEQ ID NO.2 and SEQ ID NO.4 respectively.

[0081] Figure 1This is a differential alignment map of the BnUSDR-A10 and BnUSDR-C05 protein sequences. It can be seen from the figure that the amino acid sequences of the two genes are highly homologous, with a homology as high as 97.27%.

[0082] Example 2: Construction of editing vectors for systematic directed mutagenesis of Brassica napus genes BnUSDR-A07 and BnUSDR-C06

[0083] The BnUSDR-A10 and BnUSDR-C05 gene sequences were submitted to the website CRISPR-P v2.0 (hzau.edu.cn) to screen for target sites. The target sequences were located in front of the conserved element PSPG box of the BnUSDR-A10 and BnUSDR-C05 genes, ensuring that the BnUSDR-A10 and BnUSDR-C05 genes would lose their functions due to base modification.

[0084] Figure 2 This is a schematic diagram of the target sites selected for BnUSDR-A10 (a) and BnUSDR-C05 (b) and the position of the PSPG box (Plant secondary product glycosyltransferase box) in the sequence. It can be seen from the figure that through sequencing, it was found that both genes have the conserved element PSPG box of UGTs. Therefore, it was verified that BnUSDR-A10 and BnUSDR-C05 can indeed perform the UGTs function, and knockout or frameshift mutations caused by selecting the target sites in front of UGTs can ensure frameshift or deletion of the PSPG box, resulting in the loss of UGTs function of BnUSDR-A10 and BnUSDR-C05.

[0085] During the gene editing process of CRISPR / Cas9, in addition to achieving precise gene modification, there is also a potential off-target effect. The Cas9 protein may recognize non-target DNA sequences, leading to mutations in non-target genes. In this invention, the top three possible off-target sites with the highest off-target scores for the target sites Target1 and Target2 were selected for experimental verification of whether they are off-target. Among these 6 possible off-target sites, the maximum number of single nucleotide variations (SNPs) is 4. This invention performed PCR sequencing on these 6 sites to verify whether they are off-target, and the results are as Figure 3 shown. It can be seen from Figure 3 that Target1 and Target2 were only edited at BnUSDR-C05 and BnUSDR-A10, and no off-target occurred.

[0086] After screening the editing effect and off-target rate of the target, in this example, target sites Target1 and Target2 were selected. The sequence of Target1 is: 5’-CCCGGAGATCCAAGACCCGC-3’ (SEQ ID NO.5), and the sequence of Target2 is 5’-TGTTCCGGCTAAGGTTCTGC-3’ (SEQ ID NO.6). The above two target sequences were respectively ligated to the 5’ end of two identical sgRNA sequences: [(20bp target)GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAA AAGTGGCACCGAGTCGGTGCTTTTTTT] (SEQ ID NO.7), where (20bp target) are the lengths of Target1 and Target2 respectively, so that the constructed dual-target gene editing vector pKSE401-BnUSDR-CRISPR can knockout the target sequence twice to ensure effective editing.

[0087] According to the screened targets, CRISPR / Cas9 vector target primers were designed, and the primer sequences are shown in Table 3 to ensure that the two designed targets can knockout BnUSDR-A10 and BnUSDR-C05 simultaneously.

[0088] Table 3. CRISPR / Cas9 vector target primers

[0089] Primer Sequence 5’-3’ USDR-DT1-F0 (SEQ ID NO.16) TGCGGGTCTTGGATCTCCGGGGTTTTAGAGCTAGAAATAGC USDR-DT2-R0 (SEQ ID NO.17) AACTGTTCCGGCCAAGGTTCTGCAATCTCTTAGTCGACTCTAC USDR-DT1-Bs (SEQ ID NO.18) ATATATGGTCTCGATTGCGGGTCTTGGATCTCCGGGGTT USDR-DT2-BsR (SEQ ID NO.19) ATTATTGGTCTCGAAACTGTTCCGGCCAAGGTTCTGCAA

[0090] Subsequently, the template entry vector pCBC-DT1T2 was amplified by PCR using the four primers in Table 3. The PCR reaction system was the same as that in Table 1. The PCR reaction program was: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 52°C for 15 s, extension at 72°C for 30 s, for 35 cycles; final extension at 72°C for 5 min. Among them, the normal primer concentration of USDR-DT1-BsF and USDRDT2-BsR was 10 μM; USDR-DT1-F0 and USDR-DT2-R0 were diluted 20 times, and the primer concentration should be 5 μM. The above PCR products were purified and recovered. The length of this PCR product was 626 bp. Then, a digestion-ligation reaction system was established. The specific reaction system is shown in Table 4, and the reaction conditions were maintained at 37°C for 5 h, 50°C for 5 min, and 80°C for 10 min.

[0091] Table 4. Digestion-ligation reaction system

[0092] Component Volume PCR Product 2 μL pKSE401 2 μL 10*NEB T4 Buffer 1.5 μL 10*BSA 1.5 μL Bsa I (NEB) 1 μL T4 Ligase (NEB) / High Concentration 1 μL <![CDATA[ddH2O]]> 6 μL

[0093] After the reaction was completed, 5 μL of the ligation product was used to transform competent Escherichia coli DH5α. Screening was carried out using solid LB plate medium containing 50 mg / mL Kan. After overnight culture at 37 °C, positive clones were picked and cultured with shaking in 400 μL of liquid LB medium containing 50 mg / mL Kan for 4 - 6 h. 2 μL of the bacterial solution was taken as a template for PCR amplification for identification. Primers for identification were designed using the sequence in the U6 promoter on the pKSE401 vector, and the annealing temperature was changed to 57 °C. Other PCR amplification reaction systems and conditions were the same as those for the bacterial solution PCR amplification in Table 2. The specific primer sequences are as follows:

[0094] U626-IDF: TGTCCCAGGATTAGAATGATTAGGC (SEQ ID NO.20)

[0095] U629-IDR: AGCCCTCTTCTTTCGATCCATCAAC (SEQ ID NO.21);

[0096] After PCR identification and gel electrophoresis, the size of the obtained fragment was 726 bp. 100 μL of the positive clone bacterial solution with the correct fragment size was taken and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Then, forward sequencing primers were designed using the sequence in the U6 promoter on the pKSE401 vector. The primer sequences are as follows:

[0097] U626-IDF: TGTCCCAGGATTAGAATGATTAGGC (SEQ ID NO.20)

[0098] U629-IDF: TTAATCCAAACTACTGCAGCCTGAC (SEQ ID NO.21);

[0099] The positive clone bacterial solution containing the two designed targets, Target1 and Target2, in the sequencing results was amplified for plasmid extraction to obtain the pKSE401 - BnUSDR - CRISPR plasmid. Finally, the plasmid was transferred into Agrobacterium tumefaciens GV3101, amplified and preserved for future use. Figure 4Schematic diagram of the locations of the selected Target1 and Target2 targets on the gene (a) and a simplified schematic diagram of the LB and RB regions in the pKSE401-Bn USDR-CRISPR plasmid (b). In the figure, LB: left border; RB: right border; Kan: kanamycin resistance gene; P-CaMV35S: CaMV35 promoter; U6-26p-Target1-gRNA: includes the U6-26p promoter, gRNA backbone structure, and target 1 (Target1); U6-26p-Target2-gRNA: gRNA expression element set, including the U6-26p promoter, gRNA backbone structure, and target 2 (Target2); Cas9: Cas9 gene after codon optimization.

[0100] Example 3: Transformation of Brassica napus with the pKSE401-BnUSDR-CRISPR gene editing recombinant vector

[0101] A. Seeding:

[0102] Select rapeseed seeds, approximately 30 per bottle, and place them in a 12mL centrifuge tube for later use. In a clean bench, sterilize the seeds with 75% alcohol by volume for 30 seconds. Rinse with sterile water to remove the alcohol, then add a 15% bleach solution (8.115mL sterile water + 1.875mL sodium hypochlorite + 10μL Triton, prepared fresh) for 4 minutes and 30 seconds. Rinse with sterile water until foam is removed. After absorbing the sterile water, the seeds are evenly distributed on M0 medium and cultured in the dark. Hypocotyls of appropriate length can be obtained in about 6 days. To shorten the breeding cycle, this experiment selected Brassica napus Y127 seeds, which have a short growth cycle and do not require vernalization.

[0103] B. Bacterial liquid preparation:

[0104] Add 6 mL of resistant LB (50 mg / L Kan + 50 mg / L Gen + 50 mg / L Rif) to a 50 mL centrifuge tube, add 6 μL of Agrobacterium containing the pKSE401-BnUSDR-CRISPR plasmid obtained in Example 2, and culture in a shaker at 28°C and 180-220 rpm for about 14-16 hours. 600 When the value reaches between 0.4-0.6, the next step of infection can be carried out.

[0105] C. Infection and Co-cultivation:

[0106] Prepare the co-culture medium M1 and DM solution. After sterilizing the M1 medium at 121°C for 15 min, quickly cool it (to about 50°C) and add acetosyringone AS (final concentration 100 μM). Also add AS (final concentration 100 μM) to the DM solution, denoted as DM(AS + ), and set aside for later use.

[0107] Transfer 2 mL of the cultured bacterial liquid into a sterile centrifuge tube, centrifuge at 5000 rpm for 10 min, and discard the supernatant; then add 2 mL of DM(AS + ) solution to resuspend (add 1 mL first, and then add another 1 mL after resuspending the bacterial liquid), centrifuge at 5000 rpm for 10 min, and discard the supernatant; add 2 mL of DM(AS + )(add 1 mL first, and then add another 1 mL after resuspending the bacterial liquid) solution to resuspend, and store it in the refrigerator at 4°C for later use.

[0108] Use sterile dissecting scissors to cut the hypocotyls of the rape plants grown after sowing in step A into small segments of 0.8 cm - 1.0 cm, place them in a petri dish containing 18 mL of DM liquid. After all the hypocotyls are cut into small segments, pour 2 mL of the bacterial liquid resuspended with DM(AS + ) solution. At this time, the total volume of the liquid in the dish is 20 mL, and soak for 10 - 15 min (the time should not be too long, otherwise the explants are prone to death), and shake 4 - 5 times during this period. When soaking for 8 min, start to suck out the DM(AS + ) bacterial liquid with a pipette, carefully pick up the explants with sterile forceps and place them on sterile filter paper for a while to suck away the excess bacterial liquid on the explants, and then transfer the explants to the M1 solid medium, and place the explants in the dark at 24°C or in the light culture room in the dark.

[0109] D. Selection culture and callus induction:

[0110] Culture the explants in the M1 medium for 36 - 48 h, 36 h is the most suitable. After 36 h, transfer the explants to the M2 medium, and culture them in the light at 24°C (16 h light, 8 h dark), and culture them upside down for 2 - 3 weeks to induce callus.

[0111] E. Redifferentiation:

[0112] Transfer the explants to the M3 medium, and subculture them every 2 weeks in the light at 24°C (16 h light, 8 h dark) until green buds appear.

[0113] F. Rooting culture

[0114] Transfer the green shoots with intact growing points into the M4 rooting medium and culture them upright at 24°C under light conditions (16 h light, 8 h dark) until rooting, which takes about 20 days. After rooting, the plants can be directly placed in the culture room for hardening. After the seedlings are in a stable state, take them out of the medium without damaging the roots of the plants. Then transfer the seedlings to the nutrient soil (vermiculite: nutrient soil = 1:1) for cultivation. During cultivation, keep them moist with plastic wrap for 1 - 2 weeks to obtain the transgenic rapeseed plants waiting for identification.

[0115] Example 4: Identification of Transgenic Brassica napus and Detection of Gene Editing Sites

[0116] After the transgenic rapeseed plants in Example 3 grew stably, the CTAB (cetyltrimethylammonium bromide) method was used to extract DNA from the leaves of transgenic rapeseed. The specific steps are as follows:

[0117] A. Put a small amount of leaves into a 1.5 mL centrifuge tube, grind them with liquid nitrogen until they become dry powder, then add 600 μL of CTAB, and incubate the sample in a water bath at 65°C for 60 min.

[0118] B. After incubation, add 600 μL of chloroform / isoamyl alcohol (volume ratio 24:1) solution to the tube, shake vigorously to fully remove proteins, and then centrifuge at 12000 g for 10 min in a centrifuge.

[0119] C. After centrifugation, gently take out the centrifuge tube. At this time, the solution is divided into three layers: the aqueous phase, the leaf fragment impurity layer, and the organic phase. Pipette 400 - 500 μL of the upper aqueous phase and transfer it to a new centrifuge tube. Then add 400 - 500 μL of isopropanol to the supernatant, gently invert and mix well. Then place the sample in a -20°C refrigerator for at least 10 min to make the isopropanol more effectively precipitate DNA.

[0120] D. Place the centrifuge tube in a centrifuge and centrifuge at 12000 g for 10 min at room temperature.

[0121] E. After centrifugation, discard the supernatant, add 700 μL of pre-cooled 70% ethanol for washing, flick the precipitate to suspend it, gently invert for washing, and centrifuge at 12000 g for a short spin.

[0122] F. After centrifugation, discard the supernatant, pipette off the ethanol solution with a pipette, and then air-dry the precipitate in a laminar flow hood to remove volatile organic solvents.

[0123] G. Add 50 - 100 μL of ddH2O to the centrifuge tube to dissolve the precipitate, and place it in a 37°C water bath for 30 min to obtain the genomic sample.

[0124] H. Take 1 μL of the genomic sample to measure the concentration. After passing the detection, store the genomic sample in a -20°C refrigerator for later use.

[0125] Using the genomic sample obtained in the above steps as a template, the pKSE401-BnUSDR-CRISPR plasmid as a positive control, and the DNA of the receptor material without genetic transformation and ddH2O as negative controls, PCR identification was carried out. Identification primers were designed according to the Cas9 protein sequence on the pKSE401 vector, with an annealing temperature of 62°C. Other PCR amplification reaction procedures and conditions were the same as those of the bacterial liquid PCR reaction in Table 2. The primer sequences are as follows:

[0126] Primer set: The amplified fragment length is 701 bp

[0127] Cas9-F: TGCAGGAGATTTTCTCCAACGA(SEQ ID NO.8)

[0128] Cas9-R: AGCCTTCGTAATCTCGGTGTTCA(SEQ ID NO.9)

[0129] After PCR was completed, the amplified products were electrophoresed in 1% agarose gel, and photographed using an ultraviolet gel imager to record the results. Figure 5 PCR identification gel image of the leaf genome extracted from 2 positive strains obtained by transformation; in the figure, WT: wild type; usdr-1, usdr-2: mutant transgenic plants; +: positive control, pKSE401-BnUSDR-CRISPR plasmid; -: negative control, ddH2O; Marker: Takara DL5000 DNA Marker.

[0130] Figure 5 It can be confirmed that the gene editing vector constructed in Example 3 was successfully transferred into rapeseed, and positive strains with successful identification were obtained through the process of plant tissue culture.

[0131] In order to further determine the gene editing situation of the positive strains, in this step, the above-mentioned identified positive plants were self-crossed to obtain the T1 generation, the T1 generation. After the T1 generation of transgenic rapeseed plants grew stably, the CTAB method was used to extract the DNA in the leaves of transgenic rapeseed. The extraction process was the same as the extraction method in this implementation case. Using the genomic sample obtained in the above steps as a template, the pKSE401-BnUSDR-CRISPR plasmid as a positive control, and the DNA of the receptor material without genetic transformation and ddH2O as negative controls, PCR identification was carried out. Identification primers were designed according to the Cas9 protein sequence on the pKSE401 vector, with an annealing temperature of 62°C. Other PCR amplification reaction procedures and conditions were the same as those of the bacterial liquid PCR reaction in Table 2. The primer sequences are as follows:

[0132] Primer set: The amplified fragment length is 701 bp

[0133] Cas9-F: TGCAGGAGATTTTCTCCAACGA (SEQ ID NO.8)

[0134] Cas9-R: AGCCTTCGTAATCTCGGTGTTCA (SEQ ID NO.9)

[0135] After the PCR is completed, the amplified product is electrophoresed in 1% agarose gel, photographed using a UV gel imager, and the results are recorded. Figure 6 For the 4 plants without the Cas-9 vector identified in the T1 generation; in the figure, WT: wild type; plasmid: pKSE401-BnUSDR-CRISPR vector as a positive control,; water: negative control, ddH2O; M: Takara DL5000 DNA Marker. Each individual plant in the T1 generation is numbered. Four individuals, 3-7, 4-2, 4-9, and 5-19, were identified by primers on the Cas-9 vector and found to have no amplified bands, indicating that they have separated the Cas-9 vector. Therefore, the Cas-9 vector exists in the usdr-1 and usdr-2 positive rapeseed lines and is then separated in their self-crossed offspring, the T1 generation, ensuring that the Cas-9 is successfully separated after editing the target site.

[0136] The four individuals of the T1 generation lines 3-7, 4-2, 4-9, and 5-19 that have separated the Cas-9 protein were used to perform PCR amplification, gel running, gel extraction, and ligation to the pMD19-T vector using a high-fidelity enzyme, transformed into Escherichia coli, and the bacteria were identified. The monoclonal bacterial liquid was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The specific experimental operations and methods were the same as those in Example 1.

[0137] The obtained sequencing results were analyzed. The sequencing results are as Figure 7 shown, and the sequencing results were compared with the wild types of BnUSDR-A05 and BnUSDR-C10 obtained in Example 1. It was found that there are 5 types of base editing. Type 3 caused a deletion of 9 bases while type 4 caused an addition of 3 bases, resulting in only a few amino acid deletions and additions, while types 1, 2, and 5 caused frameshift mutations, which would lead to the loss of protein function. At the same time, the editing types of the four individuals 3-7, 4-2, 4-9, and 5-19 were summarized. It was found that the 4-2 individual had editing types 1 and 5, while the 5-19 individual had editing types 1, 2, and 5 ( Figure 7c). Therefore, the 4-2 strain was selected as the usdr strain in which the BnUSDR-A05 and BnUSDR-C10 genes were successfully edited, and seeds were harvested.

[0138] Example 5: Drought Resistance and Salt Tolerance Phenotype Analysis of Transgenic Brassica napus

[0139] To verify whether the BnUSDR knockout strain improves the drought resistance and salt tolerance of rapeseed, in this example, Y127 (gene editing receptor material) was used as the wild-type control group, and the T2 generation plants obtained in Example 4 that had separated the Cas-9 vector (denoted as usdr plants) were used as the mutant experimental group. Plants with consistent growth of the mutant and wild-type were selected for drought treatment, and the treatment results are as Figure 8 shown.

[0140] As Figure 8 can be seen, the wild-type control Y127 was naturally drought-stressed for 27 days, the plants lost water severely, and the leaves wilted severely. After rehydration for 3 days, the surviving plants recovered slowly; while after the usdr plants were naturally drought-stressed for 27 days, the water loss was less than that of the wild-type, and they quickly recovered their growth state after rehydration for 3 days. This indicates that the usdr strain in which the BnUSDR-A05 and BnUSDR-C10 genes were successfully edited is more tolerant to drought stress and can also recover growth faster after rehydration following stress.

[0141] To investigate the salt tolerance of the usdr plants, in this example, the control group Y127 and the usdr plants were also treated with 600 mM NaCl respectively, and the results are as Figure 9 shown. As Figure 9 can be seen, compared with the usdr plants, the leaves of the control group Y127 wilted after being treated with 600 mM NaCl for 6 days, and the plants lodged more severely than the mutant plants. This indicates that the usdr strain is more tolerant to salt stress. Therefore, the BnUSDR gene negatively regulates the drought resistance and salt tolerance of rapeseed.

[0142] In this example, the wild-type Y127 plants were also used as the control group, and the Y127 plants treated with abscisic acid (ABA) were used as the experimental group to investigate the response of the BnUSDR gene to the drought- and salt-tolerant hormone ABA. The specific steps are as follows:

[0143] Select 50 plump rapeseed seeds and place them on a petri dish (9 cm in diameter) containing moist filter paper. Cultivate at 24 °C (16 h light, 8 h dark) for 2 - 3 days. ABA treatment: Add 25 mL of sterilized ddH2O and 10 μM ABA to the petri dishes with filter paper respectively. Repeat each treatment three times. Transfer the seedlings to a new petri dish, with 18 germinated seedlings on each dish. Sample at 0, 3, 12, and 24 h, with 6 seedlings taken as one biological replicate, for a total of three biological replicates. Immediately freeze in liquid nitrogen and store at -80 °C. Then extract RNA and reverse transcribe it into cDNA. Design primers for the BnUSDR gene. BnUSDR forward primer: TGGTGAAAGAGCTGGGCTTAG (SEQ ID NO.22); BnUSDR reverse primer: CCATCGAATAACCACCGTTGC (SEQ ID NO.23). Use real-time fluorescence quantitative PCR to detect the expression changes of USDR after 3 h, 12 h, and 24 h of ABA treatment; the control is water treatment.

[0144] The results of real-time fluorescence quantitative PCR after ABA treatment are as Figure 10 shown. As can be seen from the figure, the expression level of the BnUSDR gene is induced by ABA treatment, and the expression level gradually increases with the treatment time, reaching the maximum expression level at 24 h of ABA treatment. In addition, to study the response of the BnUSDR gene to salt stress. In this example, wild-type Y127 plants were used as the control group, and Y127 plants after NaCl treatment were used as the experimental group. The specific steps were similar to the above ABA treatment steps, but the treatment solution was 250 mM NaCl. The results of real-time fluorescence quantitative PCR after NaCl treatment are as Figure 11 shown. As can be seen from the figure, the expression level of the BnUSDR gene is induced by NaCl treatment, and the expression level gradually increases with the treatment time, reaching the maximum expression level at 24 h of NaCl treatment.

[0145] In summary, the BnUSDR gene is likely to be induced by ABA and salt stress, thereby inhibiting the salt tolerance and drought resistance functions of ABA to avoid affecting plant growth due to excessive accumulation of ABA in plants and maintaining the balance between plant stress resistance and growth. Through comparison, the present invention discovers the BnUSDR gene in Brassica napus that negatively regulates plant drought tolerance and salt tolerance, and uses the CIRSPR / Cas9 system to perform site-directed mutagenesis on the BnUSDR gene in Brassica napus for breeding. The specific steps are as follows: Design specific targeting sgRNA according to the conserved region of the BnUSDR gene and construct a dual-target CIRSPR / Cas9 site-directed mutagenesis vector, and transform it into Brassica napus Y127 through Agrobacterium-mediated transformation to create a new germplasm with drought and salt tolerance through site-directed mutagenesis of this gene; The present invention uses gene editing technology to knock out the gene that negatively regulates drought and salt tolerance to create new germplasms, greatly improving the efficiency of rapeseed breeding and shortening the rapeseed breeding cycle, providing new ideas for rapeseed breeding with drought and salt tolerance.

[0146] Although a specific embodiment is given in the text, the protection scope of the present invention is not limited thereto. Without departing from the core idea of the present invention, those skilled in the art can reasonably improve, replace or optimize the implementation methods, and these variant schemes all belong to the protection scope of the present invention.

Claims

1. BnUSDR Use of a gene in regulating drought resistance and / or salt tolerance of Brassica napus, the BnUSDR gene comprising BnUSDR-C05 and BnUSDR-A10 , the BnUSDR nucleotide sequence of -C05 is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2; BnUSDR-A10 Its nucleotide sequence is shown in SEQ ID NO.3, and its amino acid sequence is shown in SEQ ID NO.4; By knocking out or silencing BnUSDR-C05 and BnUSDR-A10 to improve the drought and / or salt tolerance of Brassica napus.

2. Use of a sequence element group, a gene editing vector pKSE401-BnUSDR-CRISPR , a genetically engineered bacterium or a kit, said use comprising: (A)Use in the breeding of Brassica napus with salt tolerance and drought tolerance; and / or (B)Use in the breeding of Brassica napus with increased yield under salt and drought conditions; It is characterized in that the sequence element group includes U6-26p-Target1-gRNA, U6-26p-Target2-gRNA and the codon-optimized Cas9 gene; The U6-26p-Target1-gRNA includes the promoter U6-26p, the gRNA backbone structure and Target1; The U6-26p-Target2-gRNA includes the promoter U6-26p, the gRNA backbone structure, Target2; The nucleotide sequence of Target1 is 5’- CCCGGAGATCCAAGACCCGC-3’(SEQ ID NO.5); The nucleotide sequence of Target2 is: 5’-TGTTCCGGCTAAGGTTCTGC-3’(SEQ ID NO.6); The nucleotide sequence of the gRNA backbone structure is: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO.7); The gene editing vector contains the sequence element group; The genetically engineered bacterium is obtained by transforming a host bacterium with the gene editing vector; The kit contains the gene editing vector or the genetically engineered bacterium; The host bacterium includes Agrobacterium tumefaciens GV3101.

Images