Application and method of knocking out populus tomentosa shou4 gene in improving wood biomass
By knocking out the SHOU4 gene of Populus tomentosa through CRISPR/Cas9 technology, the problem of unclear regulatory mechanism of secondary growth of trees in existing technologies was solved, a significant increase in wood biomass was achieved, and a new poplar variety was created with broad application prospects.
Patent Information
- Application Number
- CN202410920901.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-10
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2044-07-10
AI Technical Summary
In the existing technology, the research on SHOU4 gene in Arabidopsis is limited to primary growth, and little is known about the regulatory mechanism of the secondary growth process of forest trees. There is insufficient research on the impact on the overall biomass of the plant, especially there is no clear report on the increase of secondary wall cellulose in fast-growing tree species.
The CRISPR/Cas9 technology was used to knock out the SHOU4 gene of Populus tomentosa, and transgenic plants with edited SHOU4 gene mutations were obtained through Agrobacterium-mediated genetic transformation to increase wood biomass.
The successful creation of a new poplar variety with significantly improved stem diameter, biomass, number of xylem cell layers and cell wall thickness has laid the foundation for the genetic improvement of forest secondary development and biomass, and provided new genetic resources for plant genetic engineering.
Smart Images

Figure CN118546999B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of plant transgenics, and in particular to application of knocking out the SHOU4 gene of Populus tomentosa in increasing wood biomass; and also to a method for increasing wood biomass. Background Art
[0002] Wood is Earth's most important renewable resource and the primary raw material for industrial products such as pulp, paper, and furniture. Secondary cell walls are the primary component of wood, and cellulose, as the main component of plant cell walls, is the most abundant biopolymer on Earth. Improving wood yield and quality through genetic modification of existing major fast-growing tree species is an important approach to addressing the imbalance between market supply and demand. Poplar, a globally distributed, economically viable, fast-growing tree species, boasts rapid maturity, strong adaptability, wide distribution, diverse varieties, easy hybridization, improved genetics, and propagation, making it widely used in the construction of fast-growing plantations. Compared to conventional hybridization breeding, molecular breeding methods offer a rapid and effective approach. With recent advances in genetics, genomics, and molecular biology, poplar has become a model plant for studying wood formation, seasonal changes in perennial plants, growth and development, flowering, sex determination, and biotic interactions. Therefore, using molecular biology and genetic engineering techniques to increase poplar wood yield holds significant theoretical and practical value.
[0003] Cellulose is synthesized by plasma membrane-localized cellulose synthase (CesA) complexes (CSCs), which are typically arranged in a hexameric rosette structure. Research has shown that the CSC, guided by cortical microtubules, synthesizes cellulose at the plasma membrane using uridine diphosphate glucose (UDP-glucose) as a substrate through β-1,4-glycosidic linkages of glucan chains. These glucan chains then form microfibrils through intra- and intermolecular hydrogen bonds. These microfibrils are crucial for cell wall tensile strength, regulating tissue mechanics, providing a physical barrier against pathogen attack, determining the extent and direction of cell expansion, and controlling plant development and height.
[0004] A 2018 report identified a new group of plant-specific proteins, SHOU4 / 4L, in Arabidopsis. Studies in the root elongation zone of Arabidopsis revealed that these proteins regulate the levels of the cell-surface CESA complex by modulating the rate of CESA exocytosis. Mutants in these proteins cause severe pleiotropic defects, suggesting that they regulate cellulose biosynthesis during plant growth and development. Subsequent studies have also demonstrated that SHOU4 / 4L is a key link in mediating Arabidopsis immunity and cellulose synthesis, crucial for growth, development, and stress resistance.
[0005] However, this study has considerable limitations. First, SHOU4 / 4L was studied in Arabidopsis thaliana, where primary growth is dominant, with a small number of cells undergoing secondary development. In the secondary growth process of developed trees, a large number of cells need to accumulate secondary walls, and the regulatory mechanism is more complex, but current research still knows very little. Whether the SHOU gene affects the secondary development process of trees has not yet been reported. Secondly, the mutants of Arabidopsis thaliana affect root elongation and resistance, but the effects on the overall plant, especially biomass, have not been disclosed. The increase in biomass or secondary wall cellulose in woody plants, especially fast-growing species, is the problem that needs to be solved urgently. Summary of the Invention
[0006] In view of this, one of the objectives of the present invention is to provide an application of knocking out the SHOU4 gene of Populus tomentosa in increasing wood biomass; a second objective of the present invention is to provide a method for increasing the biomass of Populus tomentosa.
[0007] In order to achieve the above object, the present invention provides the following technical solutions:
[0008] 1. Application of knocking out the SHOU4 gene of Populus tomentosa in increasing wood biomass, the nucleic acid sequence of the SHOU4 gene is shown in SEQ ID NO.9.
[0009] Preferably, the method for knocking out the Populus tomentosa SHOU4 gene is to use CRISPR / Cas9 technology.
[0010] Preferably, the knockout of the Populus tomentosa SHOU4 gene is performed by transforming the CRISPR / Cas9 gene editing vector of the SHOU4 gene into Populus tomentosa to obtain a transgenic plant with an edited mutation of the SHOU4 gene, and the wood biomass of the obtained transgenic plant is increased.
[0011] Preferably, the method of increasing wood biomass is to increase the stem diameter, internode length, number of xylem cell layers or cell wall thickness of phloem fiber cells of Populus tomentosa.
[0012] 2. A method for increasing the biomass of Populus tomentosa, wherein the CRISPR / Cas9 gene editing vector of the SHOU4 gene is transformed into Populus tomentosa to obtain transgenic plants with SHOU4 gene editing mutations. The obtained transgenic plants are biomass-enhanced Populus tomentosa.
[0013] Preferably, in the present invention, the method for transforming Populus tomentosa is mediated by Agrobacterium.
[0014] Preferably, the Agrobacterium is GV3101.
[0015] The beneficial effects of this invention include the application of knocking out the SHOU4 gene in Populus tomentosa to increase wood biomass. By knocking out the SHOU4 gene, a new poplar variety with significantly increased stem diameter, biomass, number of xylem cell layers, and cell wall thickness was successfully created. This invention lays a foundation for genetic improvement and directed molecular breeding of secondary development and biomass of forest trees, provides a new genetic resource for plant genetic engineering, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] In order to make the purpose, technical solutions and beneficial effects of the present invention more clear, the present invention provides the following drawings for illustration:
[0017] Figure 1 Schematic diagram of target site construction for PtoSHOU4 knockout vector;
[0018] Figure 2 Macroscopic phenotypes and statistical analysis of PtoSHOU4 knockout plants (A: Complete cross-sections were taken from the lower end of the 12th / 16th / 20th / 24th internodes of the WT and two PtoSHOU4 positive knockout lines (shou4-8 and shou4-18) for comparison; B: Biomass statistics were performed above the marked internodes of each plant in A; C: Diameters of uniform sections in the middle of the 12th / 16th / 20th / 24th internodes of each plant in A were measured using a vernier caliper, repeated three times);
[0019] Figure 3 Figure 3 Microscopic observation and statistics of cross-sectional sections of stem tissues from PtoSHOU4 knockout plants (A: images of cross-sectional sections of tissues from different stem internodes of WT and PtoSHOU4 knockout plants stained with toluidine blue under an optical microscope (objective 10X, scale bar 200 μm); B: statistics of the number of xylem cell layers in different internodes of each strain (n>100, unit: layer); C: images of xylem fiber cells in cross-sectional sections of tissues from different stem internodes of WT and PtoSHOU4 overexpression and knockout plants after gold spraying under a scanning electron microscope (5000X, scale bar 10 μm); D: statistics of the cell wall thickness of xylem fiber cells in different internodes of each strain (n>100, unit: μm); E: images of phloem fiber cells under a scanning electron microscope). DETAILED DESCRIPTION
[0020] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.
[0021] Example 1. Construction of CRISPR / Cas9 editing vector
[0022] Based on the 1458bp length of the CDS sequence of PtoSHOU4 (SEQ ID NO.11), target primers were designed at exons 1 and 2, respectively. The target primer adapters were then ligated and amplified with the sgRNA expression cassette. The sgRNA expression cassette containing the target sequence was amplified and constructed using two rounds of nested PCR. The four targets were digested with Bsa I and ligated to the pUC18 vector containing the AtU3b, AtU3d, AtU6-1, and AtU6-29 promoters. Using the Golden Gate cloning strategy (Engler et al., 2008; 2009), the pUC18 and pYLCRISPR / Cas9P35S vectors were digested with Bsa I, and the four sgRNA expression cassettes were assembled onto the pYLCRISPR / Cas9P35S-H vector backbone. A schematic diagram of the target sites is shown in the attached figure. Figure 1 shown.
[0023] Target site 1 (AtU3b), forward primer: 5′-gtcaTCATGCCTAATGCAGCTGCC-3′ (SEQ ID No. 1), reverse primer: 5′-aaacGGCAGCTGCATTAGGCATGA-3′ (SEQ ID No. 2);
[0024] Target site 2 (AtU3d), forward primer: 5′-gtcaCCTCCTGTTCTTCCTACTAC-3′ (SEQ ID No. 3), reverse primer: 5′-aaacGTAGTAGGAAGAACAGGAGG-3′ (SEQ ID No. 4);
[0025] Target three (AtU6-1), forward primer: attgACTTCCCAAAGCTGATATTG (SEQ ID No. 5), reverse primer: aaac CAATATCAGCTTTGGGAAGT (SEQ ID No. 6);
[0026] Target site four At (U6-29), forward primer: attgACGAGTTTGTACGAGTACAG (SEQ ID No. 7), reverse primer: aaacCTGTACTCGTACAAACTCGT (SEQ ID No. 8).
[0027] Example 2: Genetic transformation of Populus tomentosa
[0028] The material used for poplar genetic transformation in this study was wild-type Populus tomentosa. Agrobacterium-mediated leaf disc infection was used for Populus tomentosa genetic transformation, and hygromycin was the screening marker for transgenic poplar.
[0029] 1) Cultivation of Agrobacterium
[0030] Agrobacterium GV3101 containing the recombinant plasmid was inoculated into YEP solid medium (containing the corresponding antibiotics) and cultured upside down at 28°C; a single clone of bacteria was picked and inoculated into YEP liquid medium containing the corresponding antibiotics and cultured at 28°C until OD 600 0.6~0.8; transfer the live bacterial solution into fresh YEP medium at a ratio of 1:100 and culture at 28℃ until OD 600 The cells were collected by centrifugation at 4°C and resuspended in 30 mL of WPM liquid medium supplemented with acetosyringone. The cells were then shaken and cultured in a shaker at 28°C for 1 h.
[0031] 2) Agrobacterium-mediated leaf disc infection
[0032] Take the sterile leaves of the tissue culture seedlings and cut them into 0.5×0.5 cm pieces on the clean bench. 2 Place leaf discs of different sizes into the resuspended Agrobacterium solution and infect for 10 minutes. Gently shake the solution every 2 to 3 minutes to ensure that the leaf discs are fully infected.
[0033] 3) Co-cultivation of Populus tomentosa
[0034] The infected leaf disc was picked out with sterilized tweezers, placed on sterilized filter paper, and the bacterial solution was absorbed dry. The leaf disc was spread flat on WPM co-cultivation medium and cultured in the dark at 25℃ for 2 days.
[0035] 4) Selective cultivation of Populus tomentosa
[0036] After 2 days of co-culture, the transformed explants were transferred to a selective medium capable of inducing callus tissue and cultured at 25°C in the dark for 3 to 5 weeks, during which time the selective medium was replaced with a new one every 5 days.
[0037] 5) Populus tomentosa bud induction culture
[0038] When white, loose callus tissue appeared around the leaf margin, the callus tissue was transferred to WPM budding medium on a clean bench and cultured at 25°C under light for about 4 to 5 weeks, with new WPM budding medium replaced every 10 days.
[0039] 6) Rooting culture of Populus tomentosa
[0040] When the adventitious buds grew to about 5 cm, they were transferred to WPM rooting medium containing corresponding antibiotics to induce rooting.
[0041] 7) Transplantation of Populus tomentosa
[0042] When the root system of the seedlings is relatively developed, take out the seedlings, rinse off the agar on the roots, transplant them into the greenhouse for cultivation, and cover them with plastic wrap to keep them warm and moist.
[0043] WPM resuspension: (WPM powder + 2.14 g + 30 g sucrose + 100 μmol AS);
[0044] WPM co-culture medium: (WPM powder + 2.14 g + 30 g sucrose + 100 μmol AS + 1.0 mg NAA + 2.0 mg ZT);
[0045] WPM selection medium: (WPM powder + 2.14 g + 30 g sucrose + 9 mg Hyg + 1.0 mg NAA + 2.0 mg ZT + 400 mg Cef);
[0046] WPM budding medium: (WPM powder + 2.14 g + 30 g sucrose + 9 mg Hyg + 0.1 mg NAA + 2.0 mg ZT + 400 mg Cef);
[0047] WPM rooting medium: (WPM + 30 g sucrose + 9 mg Hyg + 0.1 mg NAA + 400 mg Cef);
[0048] YEP medium (L): 10 g yeast extract, 10 g peptone, 5 g NaCl, pH 7.0, autoclaved at 121°C for 20 min. For solid culture media, add 10–12 g agar powder before sterilization.
[0049] LB medium (L): 5 g yeast extract, 10 g peptone, 10 g NaCl, pH = 7.0, autoclave at 121°C for 20 min. For solid culture media, add 10–12 g agar powder before sterilization.
[0050] Example 3, Knockout Identification of PtoSHOU4-Cas9 Transgenic Plants
[0051] (1) DNA extraction from wild-type and PtoSHOU4-Cas9 transgenic Populus tomentosa
[0052] Select 10 to 15 transgenic resistant regenerated plants and extract genomic DNA from Populus tomentosa. The method is as follows:
[0053] 1) Prepare CTAB buffer and preheat in a 65°C water bath.
[0054] 2) Take about 0.5 g of wild type and PtoSHOU4-Cas9 transgenic Populus tomentosa leaves, grind into powder in liquid nitrogen, add to the above preheated CTAB extraction solution 500 μL, mix well;
[0055] 3) 65 ℃ water bath for 45 min, mix well by (gentle) oscillation three times at intervals.
[0056] 4) After water bath, cool to room temperature, add equal volume of chloroform: isoamyl alcohol (24:1), mix well by gentle inversion, then lay flat and emulsify for 10 min. 4 ℃, 12000 rpm / min, centrifuge for 10 min;
[0057] 5) Take the supernatant into a new sterile centrifuge tube, add equal volume of -20 ℃ pre-cooled isopropanol, mix well by inversion, and white flocculent precipitate can be seen;
[0058] 6) 4 ℃, 12000 rpm / min, centrifuge for 10 min. Remove the supernatant, rinse the precipitate with 1 μl of 75% (V / V) ethanol twice, and 500 μl of anhydrous ethanol once, and remove the liquid. Dry the precipitate in a rotary evaporator at 37 ℃ until it becomes translucent;
[0059] 7) Dissolve the precipitate with 25 μL of sterile water to obtain wild type and PtoSHOU4-Cas9 transgenic Populus tomentosa leaf DNA crude extract;
[0060] 8) Add about 1 μl of RNase to the DNA crude extract, and enzymatically hydrolyze the RNA at 37 ℃ for 1 h;
[0061] 9) Store the DNA sample at -20 ℃ for future use.
[0062] (2) PCR amplification and knockout identification of positive plants
[0063] The results are shown in Figure 1 . The results show that knockout occurs in strains 8 and 18, and in strain 8, the first target site increases by 1 base and the fourth target site is deleted by 1 base; in strain 18, the first target site increases by 1 base, and the deletion or increase of these bases will cause a frameshift mutation of the gene.
[0064] Primer sequence for identification:
[0065] Forward primer: CTGAACAGCCGAAGGAGA (SEQ ID No. 9);
[0066] Reverse primer: CCAACTGAAACGACGATG (SEQ ID No. 10).
[0067] Example 4. Observation and statistics of macroscopic and microscopic phenotypes
[0068] After multiple rounds of propagation of the positive strains, we transplanted them, along with the WT plants of the same period, and hardened them in soil for about two weeks. Internodes were then marked and the plants were grown in a greenhouse at 25°C under long-day conditions (16 hours light / 8 hours dark, 10,000 lux) for three months. Macroscopic phenotypes were photographed and sampled for 2-3 months. These included plant height, stem diameter, and biomass. The results are shown in the figure below. Figure 2 The results showed that knocking out the SHOU4 gene blocked the function of regulating the recycling of membranes under the CSCs complex in the cellulose synthesis pathway. Compared with the wild type, the poplar mutant had increased cross-sectional area, internode length, and biomass.
[0069] Then, according to the marked internodes, the appropriate internodes were sampled and sliced, and the toluidine blue staining was used to observe the changes in the number and proportion of xylem cell layers; the thickness of the xylem cell wall was observed and counted by scanning electron microscopy. The results are as follows: Figure 3 The results showed that the number of xylem cell layers increased significantly, indicating that the PtoSHOU4 gene is a key regulatory gene for the formation of poplar wood and has important application value in the fields of forest genetic engineering and asexual forestry.
[0070] The above embodiments are merely preferred embodiments for the purpose of fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are within the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.
Claims
1. Application of knocking out the SHOU4 gene in Populus tomentosa to increase wood biomass, characterized by: The nucleotide sequence of the SHOU4 gene is shown in SEQ ID NO.11; the method of increasing wood biomass is to increase the stem diameter of Populus tomentosa, the number of xylem cell layers, and the thickness of the cell walls of xylem and phloem fiber cells.
2. The use of the knockout gene of Populus tomentosa SHOU4 in increasing wood biomass according to claim 1, characterized in that: The method for knocking out the Populus tomentosa SHOU4 gene is to use CRISPR / Cas9 technology.
3. The use of the knockout gene of Populus tomentosa SHOU4 in increasing wood biomass according to claim 1, characterized in that: The knockout of the Populus tomentosa SHOU4 gene is to transform the CRISPR / Cas9 gene editing vector of the SHOU4 gene into Populus tomentosa to obtain a transgenic plant with an edited mutation of the SHOU4 gene, and the wood biomass of the obtained transgenic plant is increased.
4. A method for increasing the biomass of Populus tomentosa, characterized by: The CRISPR / Cas9 gene editing vector of the SHOU4 gene was transformed into Populus tomentosa to obtain transgenic plants with SHOU4 gene editing mutations. The obtained transgenic plants were Populus tomentosa with increased biomass; the increased biomass of Populus tomentosa was achieved by increasing stem diameter, the number of xylem cell layers, and the thickness of the cell walls of xylem and phloem fiber cells.
5. The method according to claim 4, characterized in that: The method for transforming Populus tomentosa is mediated by Agrobacterium.
6. The method according to claim 5, characterized in that: The Agrobacterium is GV3101.
Citation Information
Patent Citations
Gossypium hirsutum wild germline salt-tolerant gene GhSHOU4 and application thereof
CN119120505A