A primer and probe combination and kit for detecting JAK2 V617F mutation

Abstract

The present invention discloses a primer and probe combination and a kit for detecting JAK2V617F mutation. The present invention obtains a primer and probe combination for detecting JAK2V617F mutation based on the sequence of the V617F site on the antisense strand of the JAK2 gene. Using the primer and probe combination of the present invention, the JAK2V617F mutation can be specifically detected, and the minimum mutation frequency detected is 0.01%. The minimum DNA input required is 100pg, which can meet the needs of detecting minor residual mutations. Compared with the detection of JAK2V617F mutation using the ordinary PCR-Sanger method, the present invention has the advantages of high detection sensitivity and good repeatability, which is conducive to the accurate detection of JAK2V617F minor residual mutations, and is also conducive to the formulation of diagnosis and treatment decisions for myeloproliferative tumors and the development of related therapeutic drugs.

Description

Technical Field

[0001] The present invention belongs to the field of gene detection technology and more specifically relates to a primer and probe combination and a kit for detecting the JAK2 V617F mutation. Background Art

[0002] Myeloproliferative neoplasms (MPNs) are a type of hematopoietic neoplasm caused by the relentless clonal proliferation of one or more relatively mature bone marrow cells. These include polycythemia vera (PV), essential thrombocythemia (ET), and primary myelofibrosis (PMF). Studies have shown that the JAK2 V617F mutation is common in 67-97% of PV patients, 30-50% of ET patients, and 35-67% of PMF patients, and is closely associated with the development of MPNs. The World Health Organization (WHO) included the JAK2 V617F mutation in the diagnostic criteria for PV, PT, and PMF in 2008 and, in 2016, established JAK2 V617F mutation testing as a primary criterion for the diagnosis of MPNs.

[0003] The JAK2 V617F mutation refers to a valine (V) to phenylalanine (F) amino acid mutation at codon 617 in the pseudokinase (JH2) domain of Janus kinase 2 (JAK2). This mutation causes the JH2 domain, which catalyzes the "inactive kinase state," to negatively regulate JAK2, autoactivating the JAK2 kinase domain and overactivating cytokine signaling pathways. Cells harboring the JAK2 V617F mutation are more sensitive to hematopoietic cytokine stimulation, leading to abnormal proliferation of red blood cells, white blood cells, platelets, and other blood cells, and the development of myeloproliferative neoplasms. With the increasing understanding of MPNs and the development of targeted therapies, the JAK kinase inhibitor ruxolitinib has been approved by the FDA for the treatment of high-risk myelofibrosis and polycythemia vera. The requirements for detecting the depth of minimal residual mutations in the JAK2 V617F mutation will also become increasingly stringent. Therefore, it is necessary to establish a highly sensitive and reliable method for detecting JAK2 V617F mutation to meet the needs of detecting minor residual mutations, which is also of great guiding significance for the formulation of MPN diagnosis and treatment decisions.

[0004] Currently, numerous methods are available for detecting the JAK2 V617F mutation, including next-generation sequencing (NGS), digital PCR, high-resolution melting curve analysis, loop-mediated isothermal amplification, allele-specific PCR, and real-time fluorescence quantitative PCR. NGS can simultaneously detect mutations in multiple genes, including low-frequency, minor residual mutations. However, its high cost, cumbersome operation, and time-consuming nature, coupled with stringent quality control requirements and complex data analysis and interpretation, make it unsuitable for detecting a small number of mutation sites. While allele-specific PCR and other methods offer high sensitivity for detecting the JAK2 V617F mutation (with a minimum detectable mutation frequency of 0.025%), these methods are not the gold standard for detecting the JAK2 V617F mutation, or the most reliable method for detecting the JAK2 V617F mutation.

[0005] Sanger sequencing for mutation detection offers advantages such as intuitive and reliable results, high accuracy, good reproducibility, and low cost, making it the gold standard for detecting JAK2 V617F mutation sites. However, conventional PCR combined with Sanger sequencing has low sensitivity and can only detect mutations with a mutation frequency of more than 10%, greatly limiting its clinical application. Therefore, how to leverage the advantages of Sanger sequencing to improve the sensitivity of PCR combined with Sanger sequencing for detecting JAK2V617F mutations, so that it can meet the needs of detecting minor residual mutations, has become an urgent problem to be solved. To address the low sensitivity of Sanger sequencing, a technician has provided a specific probe and detection method for JAK2 gene mutation detection. By designing a probe that specifically binds to the wild-type gene sequence, selective amplification and enrichment of the mutant sequence is achieved, increasing the sensitivity of Sanger sequencing to 0.5% to 1%. However, compared with other methods for detecting the JAK2 V617F mutation, its sensitivity still needs to be improved. Summary of the Invention

[0006] The present invention aims to address the shortcomings of low detection sensitivity and difficulty in clinical application of PCR combined with Sanger sequencing for detecting JAK2 V617F mutation, and provides a primer and probe combination and a kit for detecting JAK2 V617F mutation.

[0007] The first object of the present invention is to provide a primer and probe combination for detecting JAK2 V617F mutation.

[0008] The second object of the present invention is to provide the use of the primer and probe combination in preparing a detection product for the JAK2 V617F mutation.

[0009] The third object of the present invention is to provide a kit for detecting the JAK2 V617F mutation.

[0010] The fourth object of the present invention is to provide the use of the primer and probe combination or the kit in the preparation of auxiliary diagnostic products for myeloproliferative neoplasms.

[0011] A fifth object of the present invention is to provide a product for assisting in the diagnosis of myeloproliferative neoplasms.

[0012] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0013] Based on the sequence of the V617F site on the antisense strand of the JAK2 gene, the present invention has developed a primer and probe combination for detecting the JAK2 V617F mutation. Using this primer and probe combination, the JAK2 V617F mutation can be specifically detected with a minimum mutation frequency of 0.01% and a minimum DNA input of 100 pg, meeting the requirements for detecting minor residual mutations. Therefore, the present invention claims protection for the primer and probe combination, kit, and use thereof for detecting the JAK2 V617F mutation.

[0014] The present invention provides a primer and probe combination for detecting JAK2 V617F mutation, which comprises a primer pair shown in SEQ ID NO.1-2 and a probe shown in SEQ ID NO.3.

[0015] The primer and probe combination of the present invention can sensitively and specifically detect the JAK2 V617F mutation. Therefore, the present invention claims protection for the use of the primer and probe combination in preparing a product for detecting the JAK2 V617F mutation.

[0016] The present invention also provides a kit for detecting the JAK2 V617F mutation, which contains the primer and probe combination of the present invention.

[0017] Optionally, the kit further contains reagents required for PCR amplification reaction, negative quality control products and positive quality control products.

[0018] Specifically, the reagents required for the PCR amplification reaction include PCR buffer, amplification enzyme and dNTPs; the amplification enzyme does not have 3'-5' exonuclease activity.

[0019] In a specific embodiment of the present invention, the amplification enzyme is HotStarTaq DNA Polymerase.

[0020] Specifically, the negative control product is a plasmid containing the antisense chain fragment of the wild-type JAK2 gene; and the positive control product is a plasmid containing the antisense chain fragment of the mutant JAK2 gene.

[0021] Optionally, the nucleotide sequence of the wild-type JAK2 gene antisense chain fragment is shown as SEQ ID NO.4.

[0022] Optionally, the nucleotide sequence of the antisense strand fragment of the mutant JAK2 gene is shown in SEQ ID NO.5.

[0023] Since JAK2 V617F mutation detection is a major criterion for diagnosing myeloproliferative neoplasms, the present invention also seeks to protect the use of the primer and probe combination or the kit in preparing a product for auxiliary diagnosis of myeloproliferative neoplasms.

[0024] The present invention also provides a product for assisting in the diagnosis of myeloproliferative neoplasms, which contains the primer and probe combination or the kit of the present invention.

[0025] The myeloproliferative neoplasms include chronic myeloid leukemia, polycythemia vera, essential thrombocythemia, and primary myelofibrosis.

[0026] The present invention also provides a method for detecting the JAK2 V617F mutation, comprising the following steps:

[0027] S1. Extract DNA from the sample to be tested;

[0028] S2. PCR amplification using the primer and probe combination of the present invention;

[0029] S3. Perform direct sequencing analysis on the amplified product obtained in step S2.

[0030] Specifically, when the primer and probe combination of the present invention is used for PCR amplification, the usage ratio of the upstream / downstream primers in the reaction system is 1:1, and the usage ratio of the upstream primer to the probe is 1:6-9.

[0031] Specifically, in the reaction system, the concentration of the upstream / downstream primers was 10 μM; the concentration of the probe was 10 μM.

[0032] Specifically, the direct sequencing in step S3 is Sanger sequencing.

[0033] Specifically, before direct sequencing, the amplified product obtained in step S2 needs to be purified.

[0034] Optionally, the purification method is magnetic bead purification.

[0035] The present invention has the following beneficial effects:

[0036] The present invention obtains a primer and probe combination for detecting the JAK2V617F mutation based on the sequence of the V617F site on the antisense strand of the JAK2 gene. Using the primer and probe combination of the present invention, the JAK2 V617F mutation can be specifically detected, and the minimum mutation frequency detected is 0.01%. The minimum DNA input required is 100pg, which can meet the needs of detecting minor residual mutations. Compared with the conventional PCR-Sanger method for detecting the JAK2 V617F mutation, the present invention has the advantages of high detection sensitivity and good repeatability, which is conducive to the accurate detection of minor residual mutations of JAK2V617F, and is also conducive to the formulation of diagnosis and treatment decisions for myeloproliferative tumors and the development of related therapeutic drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 These are the sequencing analysis results of reaction systems 1 to 7 described in Example 1.

[0038] Figure 2 These are the sequencing analysis results of reaction systems 1 to 10 described in Example 2.

[0039] Figure 3 The figure shows the sequencing peaks of DNA samples with different JAK2 V617F mutation frequencies detected using the common PCR-Sanger method and the method of the present invention.

[0040] Figure 4 The figures are sequencing peaks obtained by using the common PCR-Sanger method and the method of the present invention to detect JAK2V617F samples with different DNA input amounts and a mutation frequency of 0.01%.

[0041] Figure 5 The figure shows the sequencing peaks of detecting the JAK2 V617F mutation site in 5 patients with myeloproliferative neoplasms and 1 healthy person using the common PCR-Sanger method and the method of the present invention.

[0042] Note: The rectangular box in the figure indicates the location of the JAK2 V617F mutation site. DETAILED DESCRIPTION

[0043] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0044] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.

[0045] Example 1 Obtaining a primer and probe combination for detecting the JAK2 V617F mutation

[0046] Based on the sequence of the V617F site (rs77375493) on the antisense strand of the JAK2 gene, a primer pair was designed to amplify the region containing the JAK2 V617F mutation site. Based on the primer pair, a wild-type blocking probe capable of covering the JAK2 V617F site was designed. The wild-type blocking probe consists of three segments: the first segment is a competitor sequence that overlaps with the 3' end of the upstream primer; the second segment is a recognition sequence containing the JAK2 V617F site; and the third segment is a mismatch sequence that prevents excision repair by the amplicon. All three segments are common nucleotide sequences and do not require any modification.

[0047] By screening and optimizing the various primer pairs and wild-type blocking probes designed in the present invention, a relatively optimal primer and probe combination was obtained, including the primer pairs represented by SEQ ID NOs. 1 and 2 and the probe represented by SEQ ID NO. 3. These combinations can sensitively and specifically detect the JAK2 V617F mutation, a locus with low mutation frequency. To avoid tediousness, only the final optimization process of the primer and probe combination for detecting the JAK2 V617F mutation described in the present invention is presented here; the previous optimization processes for the primers, probe, and different segments within the probe are not discussed.

[0048] 1. Synthesis of primer and probe combinations for detecting JAK2 V617F mutation

[0049] In the primer and probe combination for detecting the JAK2 V617F mutation, the primer pair used to amplify the region containing the JAK2 V617F mutation site is as follows:

[0050] JAK2 upstream primer (5'-3'): AGTTTTACTTACTCTCGTCTCCACAG (shown in SEQ ID NO. 1)

[0051] JAK2 downstream primer (5'-3'): GCAGCAAGTATGATGAGCAAGC (shown in SEQ ID NO. 2)

[0052] The probes used in the combination are shown below; the underlined portion is the first segment that overlaps with the 3' end of the JAK2 upstream primer (the number of overlapping nucleotides ranges from 2 to 12 nt), the bold sequence is the third segment that is not complementary to the JAK2 gene, and between the first and third segments is the second segment containing the recognition sequence for the JAK2 V617F site. The italicized portion of the second segment indicates the location of the JAK2 V617F site.

[0053] Probe 1 (5'-3'):

[0054] Probe 2 (5'-3'): (shown in SEQ ID NO. 3)

[0055] Probe 3 (5'-3'):

[0056] Probe 4 (5'-3'):

[0057] Probe 5 (5'-3'):

[0058] Probe 6 (5'-3'):

[0059] The above primer pairs and probes were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0060] 2. Construction of wild-type plasmids and mutant plasmids

[0061] Wild-type and mutant plasmids were constructed based on the amplified fragments from the primer pair described above. The plasmids were constructed by Shanghai Sangon Biotechnology Co., Ltd. The wild-type plasmid contained an antisense fragment of the JAK2 gene (NG_009904.1|149939:93757-93282), the corresponding nucleotide sequence of which is shown in SEQ ID NO.4, with a C at position 232. The mutant plasmid contained an antisense fragment of the JAK2 gene (NG_009904.1|149939:93757-93282), the corresponding nucleotide sequence of which is shown in SEQ ID NO.5, with an A at position 232.

[0062] The constructed plasmids were diluted to 1×10 9 The diluted wild-type plasmid was used as a negative control, and the diluted mutant plasmid was used as a positive control.

[0063] 3. Validation and screening of primer and probe combinations

[0064] The primer pairs are respectively combined with different probes to obtain 6 different primer and probe combinations, and the primer and probe combinations are used to detect JAK2 V617F mutation-positive samples, including the following steps:

[0065] S1. DNA extraction from samples;

[0066] Take 200 μL of JAK2 V617F-positive blood sample and use the QIAamp Blood Mini Kit to extract sample DNA. For specific steps, see the instructions.

[0067] S2. performing PCR amplification using the primer and probe combination;

[0068] The kit used for PCR amplification was HotStarTaq DNA Polymerase (Qiagen, 203203).

[0069] The PCR amplification reaction system consists of: 2.5 μL of sample DNA (100 ng), 3.125 μL of PCR amplification premix, 1.25 μL of JAK2 upstream primer (10 μM), 1.25 μL of JAK2 downstream primer (10 μM), and 5 μL of probe (10 μM). The mixture is made up to 25 μL with nuclease-free water (if the reaction system does not contain a probe, the remaining volume is made up with nuclease-free water). The PCR amplification premix contains 2.5 μL of 10X PCR buffer, 0.5 μL of dNTPs (10 mM), and 0.125 μL of Taq DNA polymerase (5 U / μL).

[0070] The reaction system numbers corresponding to different primer and probe combinations are shown in Table 1.

[0071] Table 1 Addition of primer and probe combinations in the reaction system

[0072] Reaction system number Added primer and probe combinations 1 JAK2 upstream primer + JAK2 downstream primer 2 JAK2 upstream primer + JAK2 downstream primer + probe 1 3 JAK2 upstream primer + JAK2 downstream primer + probe 2 4 JAK2 upstream primer + JAK2 downstream primer + probe 3 5 JAK2 upstream primer + JAK2 downstream primer + probe 4 6 JAK2 upstream primer + JAK2 downstream primer + probe 5 7 JAK2 upstream primer + JAK2 downstream primer + probe 6

[0073] The prepared reaction systems were placed in a PCR amplification instrument (Applied Biosystems VeritiPro PCR

[0074] The PCR amplification was performed in an instrument (RT-PCR instrument). The reaction program used for PCR amplification was: 95°C for 15 min; 95°C for 30 s, 60°C for 1 min, 72°C for 30 s, 40 cycles; 72°C for 10 min.

[0075] After the reaction was completed, the PCR products of each reaction system were purified using magnetic beads, and the concentration and quality of the purified PCR products were measured using an ultra-micro UV-visible spectrophotometer.

[0076] S3. Sanger sequencing and data analysis

[0077] Sequencing PCR amplification was performed using the purified PCR product as a template and the JAK2 downstream primer as a sequencing primer. The reaction system was: 1.75 μL of 5X BigDye Sequencing Buffer, 0.5 μL of BigDye 3.1 Ready Reaction Mix, 1 μL of 3.2 μM JAK2 downstream primer, 5.75 μL of nuclease-free water, and 1 μL of 10 ng / μL PCR product. The reaction program was: 96°C for 1 min; 96°C for 10 s, 50°C for 5 s, and 60°C for 4 min, for 25 cycles.

[0078] After sequencing PCR amplification, 1 μL of 125 mM EDTA (pH = 8.0), 1 μL of 3 M NaAc (pH = 5.2), and 20 μL of anhydrous ethanol were added to each tube of sequencing PCR product, followed by centrifugation with vortexing and refrigeration at -20°C for 5 min. The tubes were centrifuged at 3000 rcf and 4°C for 15 min, inverted on absorbent paper, and briefly centrifuged for 8-10 s to remove the supernatant. 35 μL of freshly prepared 70% ethanol was added, mixed by vortexing, centrifuged at 3000 rcf and 4°C for 5 min, inverted on absorbent paper, and briefly centrifuged for 8-10 s to remove the supernatant. The previous step was repeated. The residual ethanol was allowed to evaporate at room temperature, and 10 μL of Hi-Di formamide was added. The samples to be tested were sequentially transferred to the bottom of a 0.2 mL 96-well PCR plate and briefly centrifuged to avoid bubbles. The 96-well PCR plate was transferred to a genetic analyzer (Applied Biosystems, 3500xl) for sequencing. After sequencing, the results were analyzed using BioEidt software.

[0079] The sequencing analysis results of reaction systems 1 to 7 described in this example are as follows Figure 1 As shown. Figure 1 As can be seen, without the addition of probes, the primer pair produced excellent sequencing results, with a heterozygous peak visible for JAK2 V617F, formed by the combination of wild-type site C and mutant site A. With the addition of probes 1 and 2, wild-type site C was completely suppressed, with only a homozygous peak visible for JAK2 V617F, formed by the combination of mutant site A. However, with the addition of probes 2 to 6, wild-type site C was incompletely suppressed, with a heterozygous peak visible for JAK2 V617F, formed by the combination of wild-type site C and mutant site A. Table 2 was obtained by calculating the peak height ratios for the wild-type and mutant JAK2 V617F sites. As shown in Table 2, the addition of probe 2 resulted in the lowest peak height ratio for the wild-type and mutant JAK2 V617F sites, indicating the greatest suppression of the wild-type sequence.

[0080] The above results indicate that the combination of the primer pair of the present invention and probe 2 can effectively amplify the JAK2V617F site, and probe 2 can inhibit the amplification of the wild-type sequence and is the best probe.

[0081] Table 2 Peak height ratios of the wild-type site and the mutant site of JAK2 V617F

[0082] Added primer and probe combinations Peak height ratio of wild-type site C / mutant site A JAK2 upstream primer + JAK2 downstream primer + probe 1 0.114 JAK2 upstream primer + JAK2 downstream primer + probe 2 0.104 JAK2 upstream primer + JAK2 downstream primer + probe 3 0.346 JAK2 upstream primer + JAK2 downstream primer + probe 4 0.733 JAK2 upstream primer + JAK2 downstream primer + probe 5 1.039 JAK2 upstream primer + JAK2 downstream primer + probe 6 1.063

[0083] Example 2 Optimization of reaction system

[0084] This example optimizes the reaction system by adjusting the ratio of the amount of JAK2 upstream primer to the amount of probe 2. The reaction system is the same as that of Example 1, except that the amount (μL) of JAK2 upstream primer and probe 2 is different, as shown in Table 3.

[0085] Table 3 Amounts of JAK2 upstream primer and probe 2 added to the reaction system

[0086] Reaction system number 1 2 3 4 5 6 7 8 9 10 Amount of JAK2 upstream primer added 1.25 1.25 1.25 1.25 1.25 1.25 1.25 1.25 1.25 1.25 Probe 2 addition amount 1.25 2.5 3.75 5 6.25 7.5 8.75 10 11.25 12.5 Ratio of upstream primer to probe 2 1:1 1:2 1:3 1:4 1:5 1:6 1:7 1:8 1:9 1:10

[0087] After the reaction system was prepared, PCR amplification, Sanger sequencing and data analysis were performed in the same manner as in Example 1, and the peak ratio of the JAK2 V617F wild-type site to the mutant site was calculated.

[0088] The optimization results of the reaction system are as follows Figure 2 As shown. Figure 2 As can be seen, with increasing probe addition, the peak height of the detected wild-type site C first decreases and then increases. When the ratio of the JAK2 upstream primer addition amount to the probe addition amount is 1:8 or 1:9, the peak height of the wild-type site reaches its lowest point, at which point it is difficult to distinguish with the naked eye. Table 4 was obtained by calculating the peak height ratio of the JAK2 V617F wild-type site to the mutant site. The results shown in Table 4 show that when the ratio of the JAK2 upstream primer addition amount to the probe addition amount is 1:9, the peak height ratio of the JAK2 V617F wild-type site to the mutant site is the lowest, indicating the best inhibition effect on the wild-type sequence. Therefore, the optimal ratio of the probe 2 addition amount to the JAK2 upstream primer addition amount is 9:1, that is, the optimal amount of probe 2 is 11.25 μL.

[0089] Table 4 Peak height ratios of the wild-type site and the mutant site of JAK2 V617F

[0090] Ratio of the amount of JAK2 upstream primer added to the amount of probe 1 added Peak height ratio of wild-type site C / mutant site A 1:1 0.284 1:2 0.129 1:3 0.09 1:4 0.079 1:5 0.071 1:6 0.068 1:7 0.063 1:8 0.064 1:9 0.062 1:10 0.072

[0091] Example 3 Sensitivity Detection

[0092] 1. Detection sensitivity of mutation frequency

[0093] 1×10 9 copies / μL of JAK2 V617F mutant plasmid and 1×10 9 Copies / μL of the JAK2V617F wild-type plasmid were mixed at volume ratios of 1:0, 1:19, 1:99, 1:199, 1:999, 1:1999, 1:9999, 1:19999, 1:99999, and 0:1, respectively, to produce sample DNA with JAK2 V617F mutation frequencies of 100%, 5%, 1%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005%, 0.001%, and 0%, respectively. PCR amplification was performed using the sample DNA as a template using the primer and probe combination of the present invention. The reaction system and reaction procedure were the same as in Example 1, except that the ratio of probe 2 added to the JAK2 upstream primer added in the reaction system was 9:1. After completion of the PCR amplification, the reaction products were subjected to Sanger sequencing and data analysis.

[0094] For comparison, the present invention used conventional PCR-Sanger sequencing (i.e., without the addition of Probe 2) to amplify and sequence DNA samples with JAK2 V617F mutation frequencies of 100%, 5%, 1%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005%, 0.001%, and 0%. The PCR amplification reaction system and reaction conditions were identical to those in Example 1, except that no probe was included in the reaction system.

[0095] In this example, the present invention and the conventional PCR-Sanger method were used to detect the sample DNA with JAK2 V617F mutation frequencies of 100%, 5%, 1%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005%, 0.001% and 0%, respectively. The test results are shown in FIG. Figure 3 As shown. Figure 3 As can be seen, conventional PCR-Sanger sequencing methods failed to detect the JAK2 V617F mutation site A in DNA samples with low mutation frequencies. However, the method of this example was able to detect the JAK2 V617F mutation site A even in DNA samples with a mutation frequency of 0.01%. Therefore, the minimum detection limit of this example is a JAK2 V617F mutation frequency of 0.01%. These results also demonstrate that when a low-proportion mutation occurs at the JAK2 V617F site, Probe 2 of the present invention can compete with the forward primer and bind to the wild-type sequence, enabling amplification and enrichment of the mutant sequence.

[0096] 2. Detection sensitivity of sample DNA amount

[0097] Based on the mutation frequency detection sensitivity experiment, sample DNA with a JAK2 V617F mutation frequency of 0.01% was selected, and the DNA input amounts were set to 5 ng, 1 ng, 500 pg, 100 pg, 50 pg and 10 pg, respectively, for a total of 6 experimental groups. The experimental groups were tested using both the present invention and the conventional PCR-Sanger method.

[0098] In this example, the present invention and the conventional PCR-Sanger method were used to test different DNA input amounts (5ng, 1ng, 500pg, 100pg, 50pg, and 10pg) of a sample with a JAK2 V617F mutation frequency of 0.01%. During the test, it was found that the concentration of the PCR product after purification of 50pg and 10pg DNA input was less than 1ng / μL, which could not meet the requirements of Sanger sequencing and ultimately failed to sequence. In contrast, the concentration of the PCR product after purification of 5ng, 1ng, 500pg, and 100pg DNA input met the requirements of Sanger sequencing, and the sequencing results were as follows: Figure 4 As shown. Figure 4 It can be seen that even with an input of 100 pg of DNA, the JAK2 V617F mutation site A with a mutation frequency of 0.01% can be detected. Therefore, the minimum DNA detection limit of this example is 100 pg.

[0099] Example 4 Specificity Detection

[0100] Positive plasmid DNA containing EGFR gene T790M mutation (rs121434569), EGFR gene L858R mutation (rs121434568), BRAF gene V600E mutation (rs113488022), KRAS gene Q61R mutation (rs121913240), and PIK3CA gene E542K mutation (rs121913273) and JAK2 gene V617F mutant plasmid DNA were used as templates, and PCR amplification was performed using the primer and probe combination of the present invention. The reaction system and reaction procedure were the same as in Example 3. After the PCR amplification, the reaction products were subjected to Sanger sequencing and data analysis.

[0101] The results showed that only the plasmid DNA with the JAK2 gene V617F mutant met the Sanger sequencing requirements and was successfully sequenced. The concentrations of the other samples after PCR product purification were all less than 1 ng / μL, and ultimately sequencing failed, indicating that the primer and probe combination of this example only specifically amplified the sequence where the JAK2 gene V617F mutation site was located.

[0102] Example 5 Repeatability Detection

[0103] Referring to Example 3, the present invention and the conventional PCR-Sanger method were used to repeatedly test 5 blood samples from myeloproliferative neoplasms patients and 1 blood sample from a healthy person. Each sample was tested 3 times, and the DNA input for each test was 100 pg.

[0104] In this example, the JAK2 V617F mutation site was detected three times using both the present invention and conventional PCR-Sanger methods in 5 patients with myeloproliferative neoplasms and 1 healthy person. The test results are shown in Tables 5 and Figure 5 As shown in Table 5 and Figure 5 It can be seen that in the conventional PCR-Sanger method, the JAK2 V617F mutation sites of patients 1, 2, and 3 all formed heterozygous peaks by combining mutation site A and wild-type site C, and the results of three repeated interpretations were all positive; the JAK2 V617F sites of patients 4 and 5 all formed homozygous peaks by combining wild-type site C, and the results of three repeated interpretations were all negative. In the method of the present invention, the JAK2 V617F mutation sites of patients 1, 2, and 3 all formed homozygous peaks by combining mutation site A, and the results of three repeated interpretations were all positive; the JAK2 V617F sites of patients 4 and 5 all formed heterozygous peaks by combining mutation site A and wild-type site C, and the results of three repeated interpretations were also all positive. In summary, the positive detection rate of the conventional PCR-Sanger method for the JAK2 V617F mutation in these five patients with myeloproliferative neoplasms was 60%, while the positive detection rate of the present invention for the JAK2 V617F mutation in these five patients with myeloproliferative neoplasms was 100%.

[0105] Table 5 Repeated testing of clinical samples

[0106]

[0107]

[0108] These results demonstrate that the method described herein has better reproducibility and a higher detection rate than the conventional PCR-Sanger method. Specifically, the primer and probe combination described herein can sensitively and accurately detect the JAK2 V617F mutation, demonstrating high sensitivity and suitability for clinical use.

[0109] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A primer and probe combination for detecting JAK2 V617F mutation, characterized in that: It contains the primer pair shown in SEQ ID NO. 1-2 and the probe shown in SEQ ID NO.

3.

2. Use of the primer and probe combination according to claim 1 in preparing a product for detecting the JAK2 V617F mutation.

3. A kit for detecting JAK2 V617F mutation, characterized in that: Contains the primer and probe combination according to claim 1.

4. The kit according to claim 3, wherein It also contains reagents required for PCR amplification reaction, negative quality control products and positive quality control products.

5. The kit according to claim 4, characterized in that The reagents required for the PCR amplification reaction include PCR buffer, amplification enzyme and dNTPs; the amplification enzyme does not have 3'-5' exonuclease activity.

6. The kit according to claim 4, characterized in that The negative quality control product is a plasmid containing the antisense chain fragment of the wild-type JAK2 gene; the positive quality control product is a plasmid containing the antisense chain fragment of the mutant JAK2 gene.

7. The kit according to claim 6, characterized in that The nucleotide sequence of the wild-type JAK2 gene antisense chain fragment is shown in SEQ ID NO.

4.

8. The kit according to claim 6, characterized in that The nucleotide sequence of the antisense strand of the mutant JAK2 gene is shown in SEQ ID NO.

5.

9. Use of the primer and probe combination of claim 1 or the kit of claim 3 in the preparation of a product for auxiliary diagnosis of myeloproliferative neoplasms.

10. A product for assisting the diagnosis of myeloproliferative neoplasms, characterized in that: Contains the primer and probe combination according to claim 1 or the kit according to claim 3.

Images