Application of circ-SHPRH in the treatment and diagnosis of neuroblastoma

The combined treatment of neuroblastoma with circ-SHPRH overexpression construct and mTOR inhibitor has addressed the low survival rate of high-risk patients, reduced systemic toxicity, and provided a safe and effective treatment and diagnostic method.

CN118557593BActive Publication Date: 2026-03-13BEIJING CHILDRENS HOSPITAL AFFILIATED TO CAPITAL MEDICAL UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-04
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

Under current treatment options, the 5-year overall survival rate for high-risk neuroblastoma patients is less than 60%, necessitating innovative targeted therapies. Meanwhile, existing gene therapy technologies pose systemic toxicity risks in tumor treatment.

Method used

Using a circ-SHPRH overexpression construct, circ-SHPRH was introduced into target cells via adenovirus, adeno-associated virus, or lentiviral vectors, and combined with mTOR pathway inhibitors such as everolimus for the treatment of neuroblastoma; at the same time, circ-SHPRH-specific PCR amplification primers were used for diagnosis.

Benefits of technology

Overexpression of circ-SHPRH significantly inhibits the proliferation, migration, and invasion of neuroblastoma cells, reduces systemic toxicity, improves treatment safety, provides an effective diagnostic tool, and improves patient survival.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118557593B_ABST
    Figure CN118557593B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biomedicine and relates to the use of circ-SHPRH in the treatment and diagnosis of neuroblastoma. Specifically, it relates to the use of circ-SHPRH in the preparation of drugs for the prevention and / or treatment of neuroblastoma and in the preparation of reagents for the diagnosis of neuroblastoma, wherein the sequence of circ-SHPRH is SEQ ID NO:1. By promoting the expression of circ-SHPRH, the proliferation and migration of neuroblastoma cells are significantly inhibited. Furthermore, the expression of circ-SHPRH is reduced in neuroblastoma cell lines and neuroblastoma patient tissues; therefore, the expression level of circ-SHPRH can be used for the diagnosis of neuroblastoma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and relates to the use of circ-SHPRH in tumor treatment and diagnosis, specifically the use of circ-SHPRH in the prevention and / or treatment of neuroblastoma and in the diagnosis of neuroblastoma. Background Technology

[0002] Neuroblastoma (NB) is the most common extracranial solid tumor in children. It accounts for 12%-15% of cancer-related deaths in children under 15 years of age. NB presents with diverse clinical manifestations, and some cases may resolve spontaneously, but approximately 50% of children have metastases at diagnosis. Despite the availability of various treatment options, including surgery, high-dose chemotherapy, radiotherapy, autologous hematopoietic stem cell therapy, and maintenance therapy, the 5-year overall survival (OS) rate for high-risk NB patients remains below 60%. Therefore, innovative targeted therapies are needed for NB patients.

[0003] Gene therapy has emerged as a promising approach to treating diseases influenced by epigenetic factors, including malignancies and monogenic diseases. It involves introducing exogenous genetic material (DNA / RNA) into target cells to prevent or treat these diseases. Gene therapy techniques for malignancies involve the introduction of anti-angiogenic factors or tumor suppressor factors, immune stimulation, and infection with oncolytic viruses. The first gene therapy approved for cancer treatment was an oncolytic herpesvirus strain used to treat melanoma, approved by the U.S. Food and Drug Administration (FDA) in 2015. Gendicine, a gene therapy product approved in China in 2003, is based on adenovirus delivery of human p53 cDNA, replacing the E1 gene, for the treatment of head and neck squamous cell carcinoma.

[0004] Notably, circular RNAs (circRNAs) exhibit remarkable stability and show tissue- or cell-type-specific expression patterns, making them attractive targets for therapeutic interventions (Kristensen LS, Jakobsen T, Hager H, Kjems J: The emerging roles of circRNAs in cancer and oncology). Nat Rev Clin Oncol2022, 19(3):188-206). Circular RNAs are a class of non-coding RNAs with a unique covalently closed circular structure, and therefore lack free 3' and 5' ends (He AT, Liu J, Li F, Yang BB: Targeting circular RNAs as a therapeutic approach: current strategies and challenges). Signal Transduct Target Ther 2021, 6(1):185). Recent studies have elucidated their important roles in multiple cellular processes and their impact on the pathogenesis of various diseases (Zhou WY, Cai ZR, Liu J, Wang DS, Ju HQ, Xu RH: Circular RNA: metabolism, functions and interactions with proteins). Mol Cancer 2020, 19(1):172). Summary of the Invention

[0005] In order to provide a new method for treating and diagnosing neuroblastoma, the present invention provides the use of circ-SHPRH in the preparation of a medicament for the prevention and / or treatment of neuroblastoma, wherein the sequence of circ-SHPRH is SEQ ID NO:1.

[0006] Preferably, the drug includes a reagent that promotes circ-SHPRH expression.

[0007] More preferably, the reagent that promotes circ-SHPRH expression includes a circ-SHPRH overexpression construct.

[0008] More preferably, the vector for the circ-SHPRH overexpression construct is an adenovirus vector, an adeno-associated virus vector, a lentiviral vector, or a retroviral vector.

[0009] Preferably, the drug is used in combination with a second drug.

[0010] More preferably, the second drug includes an mTOR pathway inhibitor.

[0011] More preferably, the mTOR pathway inhibitor is a rapamycin-type drug.

[0012] More preferably, the rapamycin drug is everolimus.

[0013] On the other hand, the present invention provides the use of circ-SHPRH in the preparation of reagents for the diagnosis of neuroblastoma, wherein the sequence of said circ-SHPRH is SEQ ID NO:1.

[0014] Preferably, the reagent includes PCR amplification primers for detecting circ-SHPRH expression levels, wherein the PCR amplification primers include the forward primer of SEQ ID NO:2 and the reverse primer of SEQ ID NO:3.

[0015] This invention is the first to discover that circ-SHPRH expression is downregulated in neuroblastoma cells compared to normal cells. Overexpression of circ-SHPRH significantly inhibits the proliferation, migration, and invasion of neuroblastoma cells, while knockout of circ-SHPRH enhances these processes. Furthermore, analysis of clinical and case characteristics of neuroblastoma patients revealed that patients with low circ-SHPRH expression had worse 5-year overall survival (OS) than those with high expression. Moreover, circ-SHPRH expression was found to be more pronounced in neuroblastoma patients during the M phase (INRGSS), high-risk group (INRG), and... MYCN The expression of circ-SHPRH was downregulated in amplified NB patients. These results demonstrate the significant role of circ-SHPRH in neuroblastoma and its promising application in gene therapy, providing new insights for the diagnosis and treatment of neuroblastoma patients. Furthermore, the circ-SHPRH of this invention can be administered locally to the lesion site, effectively reducing systemic toxicity and improving drug safety. Attached Figure Description

[0016] Figure 1 : Schematic diagram of the structure of circ-SHPRH;

[0017] Figure 2 2A shows the Kaplan-Meier survival curves for neuroblastoma patients in the circ-SHPRH high expression group and the circ-SHPRH low expression group; 2B shows the Kaplan-Meier survival curves for circ-SHPRH in... MYCN amplification and MYCN 2C shows the relative expression statistics of circ-SHPRH in neuroblastoma patients in L1, L2, M and Ms stages according to INRGSS grouping; 2D shows the relative expression statistics of circ-SHPRH in neuroblastoma patients in high-risk and non-high-risk groups of INRG.

[0018] Figure 3Expression of circ-SHPRH in neuroblastoma cells (SK-N-BE(2), SH-SY5Y and CHLA-255 cell lines) and 293T cells;

[0019] Figure 4 :4A represents the relative expression of circ-SHPRH in the overexpression group (OE-Circ) and the control group (OE-NC) of S-KN-BE(2) cells; 4B represents the relative expression of circ-SHPRH in the overexpression group (OE-Circ) and the control group (OE-NC) of SH-SY5Y.

[0020] Figure 5 5A shows the cell proliferation curves of the SK-N-BE(2) overexpression group (OE-Circ) and the control group (OE-NC); 5B shows the colony formation test results of the SK-N-BE(2) overexpression group (OE-Circ) and the control group (OE-NC), with two replicates of each group shown; 5C shows the colony count histogram of the SK-N-BE(2) overexpression group (OE-Circ) and the control group (OE-NC); 5D shows the cell migration curves of the SK-N-BE(2) overexpression group (OE-Circ) and the control group (OE-NC).

[0021] Figure 6 Image 6A shows the cell proliferation curves of the SH-SY5Y overexpression group (OE-Circ) and the control group (OE-NC); Image 6B shows the colony formation assay results of the SH-SY5Y overexpression group (OE-Circ) and the control group (OE-NC), with two replicates shown for each group; Image 6C shows the colony count histogram of the SH-SY5Y overexpression group (OE-Circ) and the control group (OE-NC); Image 6D shows the cell migration curves of the SH-SY5Y overexpression group (OE-Circ) and the control group (OE-NC).

[0022] Figure 7 7A shows the relative expression of circ-SHPRH in the SK-N-BE(2) knockdown group and the si-negative control group; 7B shows the relative expression of circ-SHPRH in the SH-SY5Y knockdown group and the si-negative control group; the knockdown groups in the figure are Si-Circ1# and Si-Circ2#, and the si-negative control group is Si-NC;

[0023] Figure 8: 8A shows the cell proliferation curves of the SK-N-BE(2) knockdown group and the si-negative control group; 8B shows the colony formation test results of the SK-N-BE(2) knockdown group and the si-negative control group, with two replicates of each group shown; 8C shows the colony count histogram of the SK-N-BE(2) knockdown group and the si-negative control group; 8D shows the cell migration curves of the SK-N-BE(2) knockdown group and the si-negative control group; the knockdown groups in the figure are Si-Circ 1# and Si-Circ 2#, and the si-negative control group is Si-NC;

[0024] Figure 9 Image 9A shows the cell proliferation curves of the SH-SY5Y knockdown group and the si-negative control group; Image 9B shows the colony formation assay results of the SH-SY5Y knockdown group and the si-negative control group, with two replicates shown for each group; Image 9C shows the colony count histogram of the SH-SY5Y knockdown group and the si-negative control group; Image 9D shows the cell migration curves of the SH-SY5Y knockdown group and the si-negative control group; The knockdown groups in the figure are Si-Circ 1# and Si-Circ 2#, and the si-negative control group is Si-NC.

[0025] Figure 10 10A is a schematic diagram of tumor formation and circ-SHPRH injection in a mouse model experiment; 10B is an in vivo imaging photograph of mice in the circ-SHPRH overexpression group and the control group; 10C is the change in fluorescence intensity of tumors in mice in the circ-SHPRH overexpression group and the control group; 10D is the IHC detection results of mice in the circ-SHPRH overexpression group and the control group; in the figure, the overexpression group is Ad-OE-Circ, and the control group is Ad-OE-NC;

[0026] Figure 11 11A is a heatmap of gene expression in SH-SY5Y cells after circ-SHPRH overexpression, as determined by RNA-seq; 11B-C show the enriched KEGG functional and GO pathways; 11D shows the grouping of genes according to signaling pathways.

[0027] Figure 1212A shows the cell cycle analysis results of the SK-N-BE(2) overexpression group and the control group; 12B shows the cell cycle analysis results of the SH-SY5Y overexpression group and the control group; 12C shows the cell cycle analysis results of the SK-N-BE(2) knockdown group and the si-negative control group; 12D shows the cell cycle analysis results of the SH-SY5Y knockdown group and the si-negative control group; In the figure, the overexpression group is OE-Circ, the control group is OE-NC, the knockdown group is Si-Circ 1# and Si-Circ 2#, and the si-negative control group is Si-NC;

[0028] Figure 13 13A shows the mRNA levels of cell cycle pathway genes in the SK-N-BE(2) overexpression group and control group, as detected by RT-qPCR; 13B shows the mRNA levels of cell cycle pathway genes in the SH-SY5Y overexpression group and control group, as detected by RT-qPCR; 13C shows the mRNA levels of cell cycle pathway genes in the SK-N-BE(2) knockdown group and si-negative control group, as detected by RT-qPCR; 13D shows the mRNA levels of cell cycle pathway genes in the SH-SY5Y knockdown group and si-negative control group, as detected by RT-qPCR; 13E is a schematic diagram of how P21 binds to the cyclin / CDK complex to inactivate it and exert its function; in the figure, the overexpression group is OE-Circ, the control group is OE-NC, the knockdown group is Si-Circ 1# and Si-Circ 2#, and the si-negative control group is Si-NC;

[0029] Figure 14 14A shows the Western blot results of the SK-N-BE(2) overexpression group and its control group, knockdown group and its si-negative control group; 14B shows the Western blot results of the SH-SY5Y overexpression group and its control group, knockdown group and its si-negative control group; the ladder in lane 1 of the figure is used to display the protein molecular weight; the overexpression group in the figure is OE-Circ, the control group is OE-NC, the knockdown group is Si-Circ 1# and Si-Circ 2#, and the si-negative control group is Si-NC;

[0030] Figure 15The analysis results of data from the public database R2 are as follows: 15A shows the Kaplan-Meier survival curves (event-free survival) for patients with high and low P21 expression; 15B shows the Kaplan-Meier survival curves (overall survival) for patients with high and low P21 expression; 15C shows the expression level of P21 (CDKN1A) in patients at each stage as determined by the International Neuroblastoma Staging System (INSS); 15D shows the expression level of P21 (CDKN1A) in non-high-risk and high-risk patients as determined by the Childhood Oncology Tissue (COG) risk system; 15E shows the expression level of P21 (CDKN1A) in patients at each stage as determined by the International Neuroblastoma Staging System (INSS); 15D shows the expression level of P21 (CDKN1A) in patients at non-high-risk and high-risk patients as determined by the Childhood Oncology Tissue (COG) risk system; 15E shows the expression level of P21 (CDKN1A) in patients at high and low P21 expression. MYCN amplification and MYCN Expression level of P21 (CDKN1A) in patients with non-amplified neuroblastoma;

[0031] Figure 16 16A is a schematic diagram of the circ-SHPRH gene; 16B is a schematic diagram of the construction of the SHPRH-146aa overexpression construct (OE-146aa), the wild-type circ-SHPRH overexpression construct (OE-circ-SHPRH), and the mutant construct (OE-mut-circ-SHPRH); 16C is a schematic diagram of the expression levels of circ-SHPRH and mut-circ-SHPRH in SK-N-BE(2) cells transfected with the SHPRH-146aa overexpression construct (OE-146aa) and its control construct (OE-NC-146aa), the wild-type (WT) circ-SHPRH overexpression construct (OE-circ-SHPRH), the mutant construct (OE-mut-circ-SHPRH), and its control construct (OE-NC); 16D is a schematic diagram of the expression levels of circ-SHPRH and mut-circ-SHPRH in Western blotting. The protein expression level of SHPRH-146aa in SK-N-BE(2) cells transfected with OE-146aa or OE-NC was determined by Western blotting; 16E represents the expression level of each protein in the OE-146aa and OE-NC groups of SK-N-BE(2) cells as determined by Western blotting; 16F represents the expression level of each protein in the OE-146aa and OE-NC groups of SH-SY5Y cells as determined by Western blotting; the Ladder in lane 1 of Figures E and F is used to display the molecular weight of the proteins.

[0032] Figure 1717A shows the cell proliferation curves (left panel), colony formation assay results (middle panel, showing two replicates for each group), and colony count bar chart (right panel) of SK-N-BE(2) SHPRH-146aa overexpression group (OE-146aa) and control group (OE-NC). 17B shows the cell proliferation curves (left panel), colony formation assay results (middle panel, showing two replicates for each group), and colony count bar chart (right panel) of SH-SY5Y SHPRH-146aa overexpression group (OE-146aa) and control group (OE-NC). 17C shows the cell proliferation curves (left panel), colony formation assay results (middle panel, showing two replicates for each group), and colony count bar chart (right panel) of SK-N-BE(2). Cell migration curves of the SHPRH-146aa overexpression group (OE-146aa) and control group (OE-NC) of E(2); 17D shows the cell migration curves of the SHPRH-146aa overexpression group (OE-146aa) and control group (OE-NC) of SH-SY5Y; 17E shows the cell cycle analysis results of the SHPRH-146aa overexpression group (OE-146aa) and control group (OE-NC) of SK-N-BE(2); 17F shows the cell cycle analysis results of the SHPRH-146aa overexpression group (OE-146aa) and control group (OE-NC) of SH-SY5Y.

[0033] Figure 1818A shows the cell proliferation curves (left panel), colony formation assay results (middle panel, showing two replicates for each group), and colony count bar chart (right panel) of wild-type circ-SHPRH overexpression group (OE-Circ), mutant group (OE-Mut), and control group (OE-NC) of SK-N-BE(2); 18B shows the cell migration curves of wild-type circ-SHPRH overexpression group (OE-Circ), mutant group (OE-Mut), and control group (OE-NC) of SK-N-BE(2); 18C shows the cell migration curves of wild-type circ-SHPRH overexpression group (OE-Circ), mutant group (OE-Mut), and control group (OE-NC) of SK-N-BE(2); Cell proliferation curves (left panel), colony formation assay results (middle panel, showing two replicates for each group), and colony count bar chart (right panel) of SHPRH overexpression group (OE-Circ), mutant group (OE-Mut), and control group (OE-NC); 18D is the cell migration curve of wild-type circ-SHPRH overexpression group (OE-Circ), mutant group (OE-Mut), and control group (OE-NC) of SH-SY5Y; 18E is the Western chromatogram of mutant group (OE-Mut) and control group (OE-NC) of SK-N-BE(2) cells. The results of the Western blot analysis are shown in the figure. The Ladder in lane 1 is used to display the molecular weight of the protein. 18F shows the co-IP detection results of the wild-type circ-SHPRH overexpression group (OE-Circ), mutant group (OE-Mut), and control group (OE-NC) of SK-N-BE(2). 18G is a schematic diagram of the effect of circ-SHPRH on the binding of P21 to the CDK4-Cyclin D complex.

[0034] Figure 19 19A shows the IC50 curve of everolimus concentration versus cell viability in SK-N-BE (2) cells; 19B shows the cell proliferation curves of SK-N-BE (2) cells overexpressing circ-SHPRH (OE-circ) and control SK-N-BE (2) cells (OE-NC) before and after treatment with everolimus and DMSO.

[0035] Figure 20 Dose-response curves of SK-N-BE(2) cells (OE-circ) overexpressing circ-SHPRH and control SK-N-BE(2) cells (OE-NC) after treatment with different concentrations of everolimus. Detailed Implementation

[0036] To make the technical solutions and effects of the present invention clearer, the present invention is further described below through embodiments. It should be understood that these are merely exemplary and not intended to limit the present invention. Materials similar to or identical in type and model, or in properties or functions to the following reagents and instruments can be used in the implementation of the present invention. Unless otherwise specified, the reagents used in the present invention can be any suitable commercially available reagent. The instruments and reagents used in the present invention are used according to the instructions of the instrument / reagent manufacturer. The experimental methods involved in the present invention are conventional experimental methods in the art, and those skilled in the art can operate them based on known biological and chemical knowledge. Unless otherwise defined, all scientific and technical terms used in the present invention have the same meaning as commonly understood by those skilled in the art. The documents listed in this invention are incorporated herein by reference in their entirety.

[0037] The term "circ-SHPRH" as used in this invention refers to the circular RNA produced by backsplicing of exons 26 to 29 of the SHPRH gene. Figure 1 The nucleotide sequence of circ-SHPRH is shown in SEQ ID NO:1, consisting of 440 nucleotides. Its circBank ID in the public database circBank (http: / / www.circbank.cn / index.html) is hsa_circSHPRH_019. The translation product of circ-SHPRH is a small peptide containing 146 amino acids (named SHPRH-146aa).

[0038] .

[0039] As used in this invention, the term "tumor" refers to any malignant or benign growth and proliferation of vesicular cells, as well as all precancerous and cancerous cells and tissues.

[0040] The term "neuroblastoma" (NB) refers to a disease in which malignant (cancer) cells form in the nerve tissue of the adrenal glands, neck, chest, or spinal cord. It is an embryonic tumor of the sympathetic nervous system that originates from neuroblasts (pluripotent sympathetic nerve cells). The NCBI-indexed book (StatPearls, 2024) describes neuroblastoma as the most common extracranial solid tumor in children, classified as an embryonic neuroendocrine tumor (Matthay KK, Maris JM, Schleiermacher G, et al. Neuroblastoma[J]. Nature Reviews Disease Primers, 2016, 2(1): 16078). In the fifth edition of the WHO Classification of Childhood Cancers in 2022, neuroblastoma (NB) is classified as a subtype of peripheral neuroblastic tumors (pNTs). Peripheral neuroblastomas include three basic histological types: neuroblastoma (NB), ganglioneuroblastoma (GNB), and ganglioneuroma (GN). The International Committee on Neuroblastoma Pathology classifies peripheral neuroblastomas into four histopathological types based on the grading of neuroblast differentiation and the degree of Schwannian stromal development: NB (Schwannian stroma-poor); GNB (Schwannian stroma-rich); GN (Schwannian stroma-dominant); and GNB (including both Schwannian stroma-rich and stroma-dominant composite types). The first three types represent the maturation process of neuroblastoma, while the last type is polyclonal."Neuroblastoma" is a general term used to refer to all types of peripheral neuroblastic tumors. It originates from primitive neural crest cells, with primary sites distributed along the neural crest developmental pathway, including the sympathetic ganglia of the neck, chest, abdomen, adrenal glands, and pelvis. It is most common in children under 5 years old, especially infants under 2 years old, and is relatively rare in children over 10 years old. It is the most common tumor in children under 1 year old (Sarnat HB, Chan ES, Ng D, et al. Maturation of metastases in peripheral neuroblastictumors (neuroblastoma) of children[J]. JOURNAL OF NEUROPATHOLOGY AND EXPERIMENTAL NEUROLOGY, 2023, 82(10): 853-864; Chinese Anti-Cancer Association Pediatric Oncology Committee, Chinese Medical Association Pediatric Surgery Branch Oncology Group. Expert Consensus on the Diagnosis and Treatment of Neuroblastoma in Children CCCG-NB-2021[J]. Chinese Journal of Pediatric Surgery, 2022, 43(07): 588-598).

[0041] Pathological diagnosis of neuroblastoma includes: initial symptoms are often atypical, making early diagnosis difficult. Common symptoms include fatigue, loss of appetite, fever, and joint pain. Symptoms caused by the tumor depend on its location in the organ and whether metastasis has occurred. Local histological diagnosis of the tumor is possible, such as through biopsy or excision. Thin fibrovascular septa form nest-like structures. Based on the degree of differentiation of neuroblastoma cells within the nests, it can be classified as undifferentiated, poorly differentiated, and differentiated. Undifferentiated tumors often require IHC and / or molecular testing for confirmation due to the uniform "small round blue cell" morphology and lack of identifiable neurofelt structures. Poorly differentiated tumors show neurofelt structures in the background, and may exhibit Homer-Wright rosette structures. Less than 5% of the neuroblastoma cells show differentiated morphological characteristics, and the tumor cell nuclei have a "salt and pepper" appearance; rare cell morphologies may also be present, such as large and pleomorphic, spindle-shaped, and pseudo-striated muscle-like cells. Differentiated tumors have abundant cellular maturation, with more than 5% of cells exhibiting differentiated morphology, meaning that the nucleus (enlarged, eccentric, with vesicular chromatin and a single large nucleolus) and cytoplasm (eosinophilic or amphophilic, with a diameter greater than twice that of the nucleus) differentiate simultaneously. Furthermore, in cases where imaging confirms the presence of a tumor, combined with metastatic manifestations, such as bone metastasis or bone marrow metastasis, evidence of bone marrow metastasis can also confirm the diagnosis.

[0042] The staging and grading of neuroblastoma include:

[0043] According to the International Neuroblastoma Risk Group Staging System (INRGSS), neuroblastoma can be divided into L1, L2, M, and Ms stages. According to the International Neuroblastoma Risk Group (INRG), neuroblastoma patients can be divided into high-risk groups and non-high-risk groups.

[0044] Table 1:

[0045]

[0046] Table 2:

[0047]

[0048] Table 3:

[0049]

[0050] MYCN Amplified NB and MYCN Non-amplified NBs exhibit many differences in gene expression. MYCN It participates in the regulation of multiple genes and also regulates the expression of some microRNAs (miRNAs) and long non-coding RNAs (lncRNAs). Dysregulation of many genes also leads to… MYCN The amplification. MYCN The expanded NB cells exhibit prolonged eukaryotic transcription, more active expression, and stronger invasive capabilities. MYCN Gene amplification is associated with high-risk grouping and poor prognosis in neuroblastoma, and is accompanied by... MYCN In children with expanded neonatal nephropathy (NB), the primary tumor lesion is mainly located in the retroperitoneal adrenal region, with a high rate of early distant metastasis. More than 50% of these children experience tumor progression during maintenance therapy, with a 3-year overall survival (OS) of only 19.7%. Approximately 25% of NB patients have [a condition that is not explicitly stated in the original text]. MYCN Gene amplification, accompanied by MYCN Children with amplified neonatal nephropathy (NB) urgently need new treatment methods such as targeted therapy to improve efficacy and prognosis (Zhao Qian et al., with...). MYCN A case series report of 133 cases of neuroblastoma with gene amplification, Chinese Journal of Evidence-Based Pediatrics, 2022, Vol. 17 Issue (3): 215-219.

[0051] The term "treatment" as used in this invention includes relieving and / or eliminating symptoms associated with a particular disease or condition.

[0052] The term "prevention" as used in this invention refers to the treatment taken before the onset of a disease to avoid, minimize, or prevent the disease from developing or progressing.

[0053] As used in this invention, the term "diagnosis" refers to the detection and / or identification of a subject's case status, and the identification and / or determination of whether the subject suffers from a particular disease.

[0054] The term “combined use” or “combined drug use” as used in this invention includes the simultaneous, sequential, or alternating use of two or more drugs or drug components, including preparing two or more drugs or drug components into a pharmaceutical product present in one or more dosage units to obtain a suitable pharmaceutical product for combined use, and administering the pharmaceutical product to a mammal requiring combined use.

[0055] As used in this invention, the term "construction" refers to a recombinant gene molecule comprising one or more isolated nucleic acid sequences from different sources. Thus, a construct is a chimeric molecule in which two or more nucleic acid sequences from different sources are assembled into a single nucleic acid molecule, and includes any construct containing: (1) nucleic acid sequences comprising regulatory and coding sequences not found together in nature (i.e., at least one nucleotide sequence is heterologous relative to at least one other nucleotide sequence); or (2) sequences encoding non-naturally adjacent functional RNA molecules or protein portions; or (3) non-naturally adjacent promoter portions. Representative constructs include any recombinant nucleic acid molecule, such as plasmids, granules, viruses, autonomously replicating polynucleotide molecules, bacteriophages, or linear or circular single-stranded or double-stranded DNA or RNA nucleic acid molecules derived from any source, capable of genome integration or autonomous replication, comprising nucleic acid molecules in which one or more nucleic acid molecules have been operatively linked. Constructs of this invention typically include essential elements for guiding the expression of a nucleic acid sequence of interest (e.g., a target nucleic acid sequence or a regulatory nucleic acid sequence) also contained in the construct. Such elements may include regulatory elements or regulatory sequences, such as a promoter operatively linked to a nucleic acid sequence of interest (to direct transcription of that nucleic acid sequence), and often also include a polyadenylation sequence. In some embodiments of the invention, the construct may be contained within a vector. In addition to the components of the construct, the vector may also include, for example, one or more selectable markers, one or more origins of replication (e.g., prokaryotic and eukaryotic origins), at least one multiple cloning site, and / or elements that facilitate stable integration of the construct into the host cell genome. Two or more constructs may be contained in a single nucleic acid molecule, such as a single vector, or may be contained in two or more separate nucleic acid molecules, such as two or more separate vectors. An “expression construct” typically includes at least one regulatory sequence operatively linked to a nucleotide sequence of interest. In this way, for example, a promoter operatively linked to the nucleotide sequence to be expressed is provided in the expression construct for expression in an organism or a portion thereof, including a host cell. For the purpose of carrying out this invention, conventional compositions and methods for preparing and using constructs and host cells are well known to those skilled in the art, see, for example, Molecular Cloning: A Laboratory Manual, 3rd Edition, Volumes 1, 2 and 3, J.F. S.A. S.B., D. W.S. S.B., and N. Irwin, Cold Spring Harbor Laboratory Press, 2000.

[0056] The term "P21" as used in this invention refers to a member of the cyclin-dependent kinase (CDK) inhibitor family of Cip / Kip that functions by binding to and inhibiting the activity of cyclin / CDK complexes (including CDK1, CDK2, CDK4 / 6, etc.), thereby causing cell cycle arrest at a specific stage and hindering cell cycle progression.

[0057] The term "rapamycin class drugs" as used in this invention refers to rapamycin and its derivatives. Rapamycin and its derivatives share the same parent nucleus structure (as shown below), and are typically modified by altering the R group. Examples include temsirolimus, everolimus, ridaforolimus, umirolimus, and zotarolimus. Temsirolimus is a prodrug obtained by esterifying the 42-OH group of rapamycin with 2,2-dimethylolpropionate. Everolimus is obtained by etherifying rapamycin with ethylene glycol. Ridaforolimus is obtained by esterifying rapamycin with dimethylphosphonic acid. Umirolimus is a highly lipophilic rapamycin derivative; zotarolimus is obtained by replacing the 42-hydroxyl group of rapamycin with a tetrazolium ring. Rapamycin was the first marketed mTOR inhibitor, mediating its antiproliferative function by forming a complex with peptidyl-prolyl isomerase (PPIase) FKBP12. FKBP12 is a ubiquitous protein that acts as a receptor for immunosuppressive drugs. The mechanism of action of these inhibitors begins with the formation of a complex with FKBP12, which then binds to the mTOR FRB domain, inducing a conformational change that inhibits mTORC1 kinase activity. mTOR inhibition means blocking protein synthesis and cell growth, and amplifying autophagy by promoting tumor regression. Rapamycin and its derivatives inhibit mTORC1 activity through direct interactions with the components of mTORC1 (mTOR, GβL, and Raptor). However, long-term use of rapamycin-like drugs can modulate the expression of Akt, a downstream effector of mTORC2g, leading to drug resistance.

[0058]

[0059] As used in this invention, the term "and / or" refers to and covers any and all possible combinations of one or more of the associated listed items. When used in a list of two or more items, the term "and / or" means that any one of the listed items can be used alone, or any combination of two or more listed items can be used. For example, A and / or B means A alone, B alone, and combinations of A and B.

[0060] One embodiment of the present invention provides the use of circ-SHPRH in the preparation of a medicament for the prevention and / or treatment of neuroblastoma, wherein the sequence of said circ-SHPRH is SEQ ID NO:1. In a preferred embodiment, the medicament comprises an agent that promotes circ-SHPRH expression. The agent that promotes circ-SHPRH expression can be any agent known in the art for promoting the expression of a target circular RNA, and in a preferred embodiment, said agent that promotes circ-SHPRH expression comprises a circ-SHPRH overexpression construct. In a preferred embodiment, the vector of said circ-SHPRH overexpression construct is an adenovirus vector, an adeno-associated virus vector, a lentiviral vector, or a retroviral vector.

[0061] In a preferred embodiment, the medicament of the present invention can be used in combination with a second medicament. The second medicament refers to any medicament other than the medicament of the present invention that can be used for the prevention and / or treatment of neuroblastoma. The second medicament can be used simultaneously, sequentially, or alternately with the medicament of the present invention. When used simultaneously, the second medicament can be administered in the same or different dosage units as the medicament of the present invention, without particular limitation. In a preferred embodiment, the second medicament comprises an mTOR pathway inhibitor. In a preferred embodiment, the mTOR pathway inhibitor comprises a rapamycin class of drugs. In a preferred embodiment, the rapamycin class of drug is everolimus, a selective mTORC1 inhibitor that has been widely used in recent years to treat adult tumors.

[0062] Another embodiment of the present invention provides the use of circ-SHPRH in the preparation of a reagent for diagnosing neuroblastoma, wherein the sequence of said circ-SHPRH is SEQ ID NO:1. In a preferred embodiment, the reagent comprises PCR amplification primers for detecting circ-SHPRH expression levels, said PCR amplification primers comprising a forward primer of SEQ ID NO:2 and a reverse primer of SEQ ID NO:3.

[0063] In the following embodiments of the invention, all results from at least three independent experiments were analyzed using SPSS version 20.0 (SPSS, USA) or GraphPadPrism 8 as the final results. Data are expressed as mean ± standard deviation. Student's t-test was used to compare the significance of differences between groups. A p-value less than 0.05 was considered statistically significant. In the accompanying drawings of the invention, * p < 0.05, ** p < 0.01, ***p < 0.001, **** p < 0.0001. Example

[0064] Example 1: Expression of circ-SHPRH in neuroblastoma patients

[0065] Patient sample collection and ethical approval

[0066] Between January 2015 and June 2018, 94 neuroblastoma (NB) tissue samples were collected from Beijing Children's Hospital. Of these, 25 samples were obtained before chemotherapy, and 69 samples were obtained after chemotherapy. These specimens were taken from 93 children with NB, including one female child whose primary tumor originated in the retroperitoneum and mediastinum. The patients' ages ranged from 0 to 156 months. All fresh tumor tissues were immediately stored at -80°C in RNAlater RNA stabilizing solution (Sigma, USA) for long-term preservation. NB was staged according to the International Neuroblastoma Risk Group Staging System (INRGSS), and risk groups were established according to the criteria established by the International Neuroblastoma Risk Group (INRG). Clinical follow-up continued until March 2023. Informed consent was obtained from all participants and their parents. This study was approved by the Ethics Committee of Beijing Hospital of Traditional Chinese Medicine (2020-K-59).

[0067] RNA extraction and real-time quantitative polymerase chain reaction (RT-qPCR)

[0068] Total RNA was extracted from frozen tissue using TRIzol reagent (15596018, Invitrogen, USA). 30-50 mg of tissue was taken, 500 μl of TRIzol was added, and the mixture was then placed in a homogenizer and homogenized on ice until no solid particles remained. The homogenized tissue solution was transferred to a new 1.5 mL EP tube. Another 500 μl of TRIzol was added, and the mixture was thoroughly mixed by pipetting. The mixture was allowed to stand at room temperature for 5 min, and then transferred to a 1.5 mL EP tube. 0.2 mL of chloroform (Beijing Tongguang Fine Chemical Co., Ltd.) was added to each 1.5 mL EP tube, and the mixture was vigorously shaken for 15 s, allowed to stand for 5 min, and then centrifuged at 12000 rpm for 15 min at 4 °C. The supernatant was collected in a new EP tube. An equal volume of isopropanol was added, and the mixture was gently mixed by inverting the tube. The mixture was allowed to stand at room temperature for 10 min. Centrifuge at 12000 rpm for 10 min at 4℃. A white precipitate will appear at the bottom. Discard the supernatant, add 1 ml of 75% DEPC ethanol, wash the RNA once, centrifuge at 7500 rpm for 5 min at 4℃, add 30-50 µL of DEPC water, and dissolve thoroughly. Use a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, USA) to assess the concentration and purity of the RNA sample. Generally, an A260 / A280 ratio between 1.8 and 2.1 is considered a preliminary indication of good total RNA quality. Store at -20℃ or -80℃.

[0069] RNA was reverse transcribed into cDNA using a commercial cDNA synthesis kit (RR036A, Takara Biotech, Japan). The sample loading system is as follows:

[0070] Table 4

[0071] .

[0072] After thoroughly mixing the above sample loading system, place the PCR tubes in the PCR instrument (Thermo, VIIA7 Dx). The parameters are set as follows:

[0073] Table 5

[0074] .

[0075] The obtained cDNA was stored at -20°C. Then, RT-qPCR was performed using the SYBR Green PCR Kit (#1725122, Bio-Rad, USA). The reaction mixture is as follows:

[0076] Table 6

[0077] .

[0078] The reaction conditions for RT-qPCR are as follows:

[0079] Table 7

[0080] .

[0081] GAPDH was used as an internal reference gene. The primers for circ-SHPRH used in this invention were from RiboBio (Guangzhou, China), and other primers were from BGI Genomics (Beijing, China). The forward and reverse primer sequences for circ-SHPRH are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively, and the forward and reverse primer sequences for GAPDH are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively. Data were normalized to GAPDH and analyzed using a 23... -ΔΔCt The method was used to analyze relative RNA expression.

[0082] circ-SHPRH-F: CGAATTGGACAGACAAAACCTACT (SEQ ID NO: 2);

[0083] circ-SHPRH-R:TTGTAGAATGGCTGCCCTTCTC (SEQ ID NO: 3);

[0084] GAPDH-F: TGCACCACCAACTGCTTAG (SEQ ID NO:4);

[0085] GAPDH-R:GATGCAGGGATGATGTTC (SEQ ID NO:5).

[0086] result

[0087] RNA was extracted from the 94 frozen tissues using the above-described method of "RNA extraction and real-time quantitative polymerase chain reaction (RT-qPCR)," and the expression of circ-SHPRH was detected using the above-described primers circSHPRH-F and circSHPRH-R. The results are shown in Table 8.

[0088] Table 8

[0089] .

[0090] To verify the role of circ-SHPRH in NB patients, we analyzed the relationship between clinical and pathological characteristics and circ-SHPRH expression in 94 NB ​​patients. This study collected 94 tumor samples from 93 NB children who visited Beijing Children's Hospital between January 2015 and June 2018. Two samples were taken from the retroperitoneal and mediastinal tumors of the same child, respectively. The samples were divided into high-expression and low-expression groups based on the median circ-SHPRH expression. Other data, such as patient age and sex, were also analyzed. MYCN Amplification level and histological category are shown in Table 9.

[0091] Table 9: Relationship between circ-SHPRH expression and clinicopathological variables in NB patients

[0092] .

[0093] The Kaplan-Meier method was used to determine the difference in survival time between the circ-SHPRH high expression group and the circ-SHPRH low expression group, and the data were analyzed by log-rank test. Kaplan-Meier survival curve analysis showed that the 5-year overall survival (OS) of children with low circ-SHPRH expression (66.67%) was worse than that of children with high expression (83.72%) (P<0.05). Figure 2 A), and circ-SHPRH in phase M (INRGSS), high-risk group (INRG) and MYCN Downregulated expression in amplified NB patients ( Figure 2 BD). The above results indicate that reduced circ-SHPRH expression is associated with short-term overall survival (OS) in NB patients. MYCN Amplification, late INRG, and high risk based on INRG criteria are closely related.

[0094] Example 2: Expression of circ-SHPRH in neuroblastoma cells

[0095] Cell lines and cell culture

[0096] Neuroblastoma cell lines SK-N-BE(2), SH-SY5Y, and normal cell line 293T were purchased from the American Type Culture Collection (ATCC) and cultured in DMEM medium (10-013-CV, Corning, USA) containing 10% fetal bovine serum (FBS) (#35-081-CV, Gibco, USA), penicillin (100 units / mL), and streptomycin (100 μg / mL) (MACGENE, China) (hereinafter referred to as "medium 1"). Neuroblastoma cell lines CHLA-255 were obtained from UCLA and cultured in Iscove modified DMEM medium (10-016-CV, Corning, USA) containing 10% FBS (#35-081-CV, Gibco, USA), penicillin (100 units / mL), and streptomycin (100 μg / mL) (MACGENE, China) (hereinafter referred to as "medium 2"). All cells were cultured at 37°C and 5% CO2. SK-N-BE(2) was among them. MYCN Expanded cells (Peet AC, McConville C, Wilson M, et al. 1H MRS identify specific metabolite profiles associated with) MYCN -amplified andnon-amplified tumour subtypes of neuroblastoma cell lines[J]. NMR inbiomedicine, 2007, 20(7): 692-700; Farooqi AS, Dagg RA, Choi LMR, et al.Alternative lengthening of telomeres in neuroblastoma cell lines is associated with a lack of MYCN genomic amplification and with p53 pathway aberrations[J]. Journal of Neuro-Oncology, 2014, 119(1): 17-26). In November 1972, the SK-N-BE(2) neuroblastoma cell line was established from bone marrow aspiration of a child with diffuse neuroblastoma who had undergone multiple chemotherapy and radiotherapy. The cells showed moderate levels of dopamine-β-hydroxylase activity.

[0097] RNA extraction and real-time quantitative polymerase chain reaction (RT-qPCR)

[0098] RNA was extracted from cells using the "RNA extraction and real-time quantitative polymerase chain reaction (RT-qPCR)" method described in Example 1. One well of a six-well plate (Corning, 3516) containing normal cultured cells was taken, 1 ml of TRIzol was added, and the plate was allowed to stand at room temperature for 5 min. Subsequent RNA extraction steps were the same as those for extracting RNA from tissues. Using the aforementioned circSHPRH-F and circSHPRH-R primers, the expression of circ-SHPRH was detected.

[0099] result

[0100] like Figure 3 As shown, the expression of circ-SHPRH in different NB cell lines (SK-N-BE(2), SH-SY5Y and CHLA-255 cell lines) and 293T cells was detected by RT-qPCR. It can be seen that the expression of circ-SHPRH in NB cell lines is significantly decreased compared with 293T cells.

[0101] Example 3: circ-SHPRH inhibits the proliferation, clonal ability, and migration of NB cells.

[0102] Construction of circ-SHPRH overexpression construct and control construct

[0103] The cDNA sequence of circ-SHPRH was inserted into a lentiviral expression vector to construct the circ-SHPRH overexpression construct, and a control construct was constructed using a blank lentiviral vector. The lentivirus was purchased from GeneChem (Shanghai). The circ-SHPRH overexpression construct and the control construct were constructed by GeneChem (Shanghai).

[0104] Cell transfection

[0105] HitransGP (REVG005, GeneChem, Shanghai) was used to transfect the above-mentioned circ-SHPRH overexpressing lentiviral construct and control lentiviral construct into SK-N-BE(2) and SH-SY5Y NB cells, respectively. The transfection system is as follows:

[0106] Table 10

[0107] .

[0108] The transfection steps are as follows:

[0109] 1. One day before infection, culture cells in six-well plates at a rate of 5 × 10⁻⁶.5 1. Plant cells per well until the cell confluence reaches 40% and the cells are evenly distributed on the surface of each well before infection; 2. Replace with fresh complete culture medium 1 (960 μl) and mix with 40 μl of HitransGP infection enhancement medium (25×) 1 hour before virus infection; 3. Add the appropriate amount of virus according to the cell MOI=20 and virus titer, calculated as virus volume = (MOI × cell number) / virus titer. After incubating at 37℃ for 12 hours, replace with complete culture medium 1 (2 mL per well) and continue incubation. Change the medium as needed during incubation to maintain cell viability; 4. Observe the cell infection efficiency using a fluorescence microscope at 48 and 72 hours post-infection.

[0110] Cell proliferation, migration, and invasion were detected using a real-time cell analyzer (RTCA).

[0111] Cell proliferation and migration were monitored in real time using an xCELLigence RTCA-DP instrument (ACEA Bioscience, USA). Cell proliferation and migration rates were measured according to the instrument manufacturer's instructions. In the cell proliferation assay, 4000 SK-N-BE (2) and SH-SY5Y cells were seeded into wells of an electronic microplate (E-plate) (REF300600890) containing medium 1 and cultured for 72 hours. In the cell migration assay, serum-free medium 1 was added to the upper wells of a cell invasion and migration (CIM) plate (REF5665817001), and complete medium 1 was added to the lower wells. NB cells were introduced at a rate of 4 × 10⁶ cells per well. 4 NB cells were seeded at a density of [number] cells in the upper wells and cultured in RTCA wells for 48 hours. The proliferation and migration capacity of NB cells were expressed using the cell index (CI), which was calculated by dividing the change in electrical impedance by the background value.

[0112] Settlement formation experiment

[0113] S-KN-BE(2) and SH-SY5Y cells were seeded at a density of 800 cells per well into six-well plates containing medium 1. After two weeks of culture, cell colonies were washed with PBS. Cell colonies were then fixed with 4% paraformaldehyde and stained with 0.1% crystal violet (#C0121, Beyotime, China) in the dark for 15 minutes. Colonies were photographed and counted using ImageJ (National Institutes of Health, 1.8.0).

[0114] result

[0115] The level of circ-SHPRH expression in transfected cells was detected using the "RNA extraction and real-time quantitative polymerase chain reaction (RT-qPCR)" method described in Example 2. Figure 4 As shown, in S-KN-BE(2) and SH-SY5Y cells, the level of circ-SHPRH in the overexpression group (OE-Circ) was significantly higher than that in the control group (OE-NC).

[0116] Using the above " Cell proliferation, migration, and invasion were detected using a real-time cell analyzer (RTCA). "as well as" set Drop formation test The method described was used to perform RTCA proliferation, RTCA migration, and colony formation assays on the overexpression group and the control group. The results showed that, compared with the control group, the circ-SHPRH overexpression group significantly inhibited the proliferation, invasion, and migration of SK-N-BE(2) and SH-SY5Y cells. Figure 5-6 ).

[0117] Example 4: Knocking down circ-SHPRH enhances the proliferation, clonal capacity, and migration of NB cells.

[0118] Construction and transfection of short interfering RNA (siRNA)

[0119] The short interfering RNA (siRNA) targeting circ-SHPRH and the control siRNA (catalog number: siN0000001-1-5) were constructed by RiboBio (Guangzhou, China). The specific sequences are shown below.

[0120] hsa-circ-SHPRH-F1: CGAATTGGACAGACAAAACCTACT (SEQ ID NO: 6);

[0121] hsa-circ-SHPRH-R1:TTGTAGAATGGCTGCCCTTCTC (SEQ ID NO:7);

[0122] hsa-circ-SHPRH-F2: AATGCTGAAAACTGCTGAGAGAAG (SEQ ID NO: 8);

[0123] hsa-circ-SHPRH-R2:GCAAATTCCATGTTGTTGTCAGTAA (SEQ ID NO:9).

[0124] Using Lipofectamine RNAiMAX transfection reagent (#13778150, Invitrogen, USA), the two groups of siRNAs specifically targeting the circ-SHPRH reverse splice adapter (SEQ ID NO:6 and SEQ ID NO:7; SEQ ID NO:8 and SEQ ID NO:9) and control siRNA were transfected into SK-N-BE(2) and SH-SY5Y NB cells according to the manufacturer's instructions, forming the circ-SHPRH knockdown group, the si-circ-SHPRH group (Si-Circ 1# (siRNA: SEQ ID NO:6 and SEQ ID NO:7), Si-Circ 2# (siRNA: SEQ ID NO:8 and SEQ ID NO:9)) and the si-negative control group (Si-NC).

[0125] The transfection steps are as follows:

[0126] 1. Dilute siRNA (use new pipette tips for all steps to prevent RNase contamination):

[0127] Mix 100 μL of Opti MEM (Gibco, USA) with 3 or 4 μL of siRNA (20 μM) solution, gently pipette 10 times to mix, and let stand at room temperature for 10 min.

[0128] 2. Dilute RNAiMAX (Lipofectamin):

[0129] Mix 100 μL of Opti MEM (Gibco, USA) and 5 μL of RNAiMAX, gently pipet 10 times to mix, and let stand at room temperature for 10 min.

[0130] 3. Preparation of the RNAiMAX-siRNA complex:

[0131] Mix 100 μL of diluted RNAiMAX and 100 μL of diluted siRNA, gently pipette to mix, and incubate at room temperature for 15 min to prepare the RNA-RNAiMAX transfection complex.

[0132] 4. Transfection:

[0133] Add 200 μL of the transfection complex obtained in step 3 to a six-well plate (Corning, 3516) containing normal cultured cells. Gently shake the plate to distribute the complex evenly in the wells. Incubate the plate in an incubator and detect the transfection efficiency after 48 hours.

[0134] result

[0135] Using the “ in Example 2” RNA extraction and real-time quantitative polymerase chain reaction (RT-qPCR) The method described in the paper was used to detect the circ-SHPRH expression levels in the si-circ-SHPRH groups (Si-Circ 1#, Si-Circ 2#) and the si-negative control group (Si-NC). To increase the reliability of the results, two sets of siRNAs were designed to prepare different circ-SHPRH knockdown groups. RT-qPCR detection showed that, compared with the si-NC group, the circ-SHPRH expression in both si-circ-SHPRH groups was significantly decreased. Figure 7 ).

[0136] Using the “ in Example 3” Cell proliferation, migration, and invasion were detected using a real-time cell analyzer (RTCA). "and" Settlement formation experiment The methods described in the article were used to test the above-mentioned si-circ-SHPRH groups (Si-Circ 1#, Si-Circ 2#) and si-negative control group (Si-NC). The results of RTCA proliferation assay, RTCA migration assay and colony formation assay showed that, compared with the si-NC group, the proliferation, migration and invasion abilities of SK-N-BE(2) and SH-SY5Y cells in the si-circ-SHPRH group were all improved. Figure 8-9 ).

[0137] All these results indicate that knocking down circ-SHPRH promotes tumorigenicity of NB cells.

[0138] Example 5: Mouse Model Experiment

[0139] Construction of cells stably overexpressing luciferase

[0140] pLV-luciferase lentivirus, purchased from GeneChem (Shanghai, China), was transfected into CHLA-255 cells, followed by selection with puromycin (Lablead, China). The specific steps are as follows: 1.5 × 10⁻⁶ pLV-luciferase lentivirus was transfected into CHLA-255 cells. 5CHLA-255 cells were seeded per well in 24-well cell culture plates. After 24 hours, cell status was observed (cell confluence was 40% and cells were evenly distributed on the surface of each well) to prepare for lentiviral infection. First, the original culture medium was discarded, and 480 µl of fresh complete culture medium 2 and 20 µl of HitransGP viral infection reagent (REVG005, GeneChem, China) were added. Then, lentivirus (CON285) containing the Luciferase gene (purchased from GeneChem, Shanghai, China) was added to the 24-well cell culture plates and cultured. Based on the cell MOI=20 and viral titer, the appropriate amount of virus was added, calculated as: virus volume = (MOI × cell number) / virus titer. After 48 hours, puromycin was added to the cells at a final concentration of 4 µg / ml, and culture continued to screen for stable cell lines. During this period, fresh culture medium 2 and puromycin were replaced every other day for 14 days. The resulting cell line stably expressing the Luciferase gene was then maintained at half the puromycin concentration for 7 days. The expression level of the Luciferase gene was then detected using a dual-luciferase reporter assay (Promega, E1910). Cells that stably overexpressed luciferase were then screened.

[0141] Construction of circ-SHPRH overexpression adenovirus construct and control construct

[0142] The cDNA sequence of circ-SHPRH was inserted into an adenovirus expression vector to construct the circ-SHPRH overexpression construct, and a control construct was constructed using a blank adenovirus vector. The adenovirus was purchased from GeneChem (Shanghai). The circ-SHPRH overexpression adenovirus construct and the control construct were constructed by GeneChem (Shanghai).

[0143] Mouse xenograft model and in vivo imaging

[0144] NSG mice were obtained from Sipeifu Co., Ltd. (Beijing) and bred under specific pathogen-free (SPF) conditions. All mice were female and 4 weeks old. As shown in 10A, 2 × 10⁶ mice were... 6 CHLA-255 cells stably overexpressing the luciferase gene (diluted in 50 μL serum-DMEM medium) were injected into the left renal cortex of mice with 50 μL Matrigel (#354230, Corning, USA) to induce tumor growth in vivo. Two weeks later, either a control group or a circ-SHPRH-overexpressing adenovirus construct (1 x 10⁻⁶ cells) was injected. 9PFU / mouse (the specific dosage was calculated based on the viral titer) was injected into the tumor. Fluorescence intensity was measured using an In Vivo FX Pro (Bruker, Germany) two weeks after cell injection and one week after adenovirus construct injection, and tumor data were acquired and analyzed using Bruker MI software (v.7.2.0.21148). Mice were euthanized by painless cervical dislocation after treatment. All animal welfare and experimental procedures were performed in accordance with the requirements of the Beijing Municipal Committee for the Management of Laboratory Animals. The mouse tumor model (MDKN-2021-065) has received ethical approval.

[0145] Immunohistochemical (IHC) detection

[0146] Fresh tissue samples (3 mm thick) from NSG mice were routinely collected. Tumor tissue was fixed in formalin and embedded in paraffin, then placed in an embedding mold. The tissue underwent gradient dehydration, clearing, and paraffin infiltration. The cut surface of the tissue was placed downwards during embedding. After the paraffin block cooled, it was removed from the mold and trimmed. The paraffin block was pre-cooled on a freezing stage for 20 minutes, then sectioned at 4 µm using a microtome. The sectioned tissue slides were then spread in a constant-temperature water bath in a slide spreader until they were flat and adhered to a glass slide. IHC analysis was then performed. Sections were stained with hematoxylin and eosin according to standard protocol. Sections were incubated with P21 (Abcam, 1:1000), CDK4 (CST, 1:1000), and Cyclin D (CST, 1:1000) and counterstained with hematoxylin (Pinofi Biotechnology, China). Finally, the sections were imaged using a microscope (Nikon Eclipse Ti-SR, Japan).

[0147] result

[0148] like Figure 10 As shown in B and 10C, one week after injection of the adenovirus construct, the tumors in mice in the circ-SHPRH overexpression group (Ad-OE-Circ) were significantly smaller than those in the control group (Ad-OE-NC). This in vivo experiment demonstrates that overexpression of circ-SHPRH can inhibit tumor growth.

[0149] Hematoxylin-eosin (HE) staining showed that all mouse tumors conformed to the microscopic features of neuroblastoma. Figure 10 (D) IHC results showed that after treatment with adenovirus overexpressing circ-SHPRH, the level of P21 in NB tumor tissue increased, while the expression of CDK4 and cyclin D decreased.

[0150] Example 6: Mechanism of circ-SHPRH in inhibiting NB tumors

[0151] 1. circ-SHPRH regulates the cell cycle of NB cells through the p21-CDK pathway.

[0152] RNA sequencing (RNA-seq) analysis

[0153] SH-SY5Y cells were transfected with the OE-NC and OE-circ-SHPRH constructs from Example 3 for 72 hours, and total RNA was isolated from these cells using TRIzol reagent. All libraries were prepared using an Illumina HiSeq 4000 according to the manufacturer's recommendations. Sequence data were aligned to the hg19 reference using HISAT2 (GSE 112734). High-throughput sequencing was performed using the Illumina HiSeq 2000 platform. RNA-seq transcript data were analyzed using the TopHat / Cufflinks combined software. Genes with a false discovery rate (FDR) < 0.05, p-value < 0.01, and fold change > 1.5 were considered differentially expressed genes (DEGs).

[0154] Flow cytometry

[0155] The following steps were performed on the NB cells overexpressing circ-SHPRH in Example 3 and their control group cells, and on the NB cells knocked down circ-SHPRH in Example 4 and their control group cells: (1) Select cells in the logarithmic growth phase, digest them with trypsin, resuspend them in 1×PBS pre-cooled to 4°C, and then centrifuge them at 1000 rpm for 5 min in a 4°C centrifuge. After discarding the supernatant, repeat the 1×PBS washing step twice; (2) Resuspend the cells in 0.5 mL of pre-cooled 1×PBS, and then add 1.5 mL of pre-cooled anhydrous ethanol. Fix them in a 4°C refrigerator for 8 h, or in a -20°C refrigerator for more than 30 min (they can be stored in a -20°C refrigerator for one month); (3) Cell staining: After centrifuging the fixed cells, wash the cells once with pre-cooled 1×PBS. After centrifugation, add 1 mL of PBS (containing 50 μg / mL ethidium bromide (E8751, Sigma) and 100 μg / mL RNase). A (R6513, Sigma) cells were resuspended; (4) flow cytometry (ACEA, NovoCyte, USA) was used to detect and analyze the fluorescence at wavelengths above 600 nm using a 488 nm laser. 10,000 cells were counted and the results were analyzed using cell cycle fitting software (Modfit LT5).

[0156] Pathway analysis

[0157] KEGG analysis was performed on the obtained DEGs using KEGG Mapper (http: / / www.genome.jp / kegg / mapper.html). GO enrichment analysis [GO biological processes (GO:BP)] was performed using the GO database (http: / / www.geneontology.org / ). A p-value less than 0.05 was considered statistically significant.

[0158] RT-qPCR

[0159] Using Example 2" RNA extraction and real-time quantitative polymerase chain reaction (RT-qPCR) The detection was performed using the method described in the document, with primers for p53 (Tp53) being SEQ ID NO:10 and SEQ ID NO:11, primers for p21 (CNKN1A) being SEQ ID NO:12 and SEQ ID NO:13, primers for CDK4 being SEQ ID NO:14 and SEQ ID NO:15, primers for CDK6 being SEQ ID NO:16 and SEQ ID NO:17, and primers for cyclin D (CCND1) being SEQ ID NO:18 and SEQ ID NO:19.

[0160] TP53-F: CAGCACATGACGGAGGTTGT (SEQ ID NO: 10);

[0161] TP53-R: TCATCCAAATACTCCACACGC (SEQ ID NO: 11);

[0162] CDKN1A-F: TGTCCGTCAGAACCCATGC (SEQ ID NO:12);

[0163] CDKN1A-R:AAAGTCGAAGTTCCATCGCTC (SEQ ID NO:13);

[0164] CDK4-F: ATGGCTACCTCTCGATATGAGC (SEQ ID NO: 14);

[0165] CDK4-R: CATTGGGGACTCTCACACTCT (SEQ ID NO:15);

[0166] CDK6-F: CCAGATGGCTCTAACCTCAGT (SEQ ID NO: 16);

[0167] CDK6-R:AACTTCCACGAAAAAGAGGCTT(SEQ ID NO:17);

[0168] CCND1-F:GCTGCGAAGTGGAAACCATC(SEQ ID NO:18);

[0169] CCND1-R:CCTCCTTCTGCACACATTTGAA(SEQ ID NO:19)。

[0170] Protein extraction and Western blotting

[0171] Proteins were extracted from NB cells (NB cells overexpressing circ-SHPRH in Example 3 and control cells; NB cells with knocked-down circ-SHPRH expression in Example 4 and control cells) using RIPA lysis buffer (#P0013B, Beyotime, China) and a phosphatase inhibitor (#04906837001, Roche, Switzerland) was added to the RIPA buffer. The RIPA lysis buffer consisted of pH 7.4, 1 mM EDTA (E809185, MACKLIN, China), 150 mM NaCl (S805275, MACKLIN, China), 1.0% Nonidet P40 (N814616, MACKLIN, China), 50 mM Trisbase (B350, GENVIEW, China), a protease inhibitor mixture (04693132001, Roche, Switzerland), Na3VO4 (S817660, MACKLIN, China), and a protease inhibitor mixture (including benzyl sulfonyl fluoride (ST506, Beyotime, China)). Protein concentration was determined using a bisquinolinic acid (BCA) protein assay kit (#23225, Thermo, USA). Antibody-protein binding and detection were performed using an automated capillary Western blotting system (ProteinSimple, USA). It was suitable for 12-230 kDa and 66-440 kDa proteins. Wes Separation Capillary Cartridges (Cat#SM-W004 and SM-W008, ProteinSimple, USA) were used to isolate proteins. Antibodies against the following proteins were used: P21 (Abcam, 1:100), CDK1 (CST, 1:100), CDK4 (CST, 1:100), CDK6 (CST, 1:100), Cyclin D (CST, 1:100), and GAPDH (#5174, CST, 1:100). Signals were detected using HRP-bound anti-rabbit secondary antibody (DM-001, bio-techne) and visualized using the Protein-Simple system.

[0172] result

[0173] The inventors performed RNA-seq analysis on SH-SY5Y cells to explore potential signaling pathways that may be affected by circ-SHPRH. Compared with the control lentivirus group, the cells overexpressing the lentivirus carried 588 upregulated genes and 524 downregulated genes. The heatmap showed that the expression of 50 genes differed significantly between the control and overexpression groups. Figure 11A). These differentially expressed genes were analyzed using the KEGG and GO databases. KEGG pathway enrichment analysis showed that circ-SHPRH overexpression-induced differentially expressed mRNAs were enriched in the p53 signaling pathway, PI3K-Akt pathway, MAPK pathway, etc. Figure 11 B). GO analysis results showed that differentially expressed genes were enriched in the cell cycle and DNA replication (B). Figure 11 C). Based on these analyses using two databases, it can be seen that genes related to the cell cycle are most closely associated with circ-SHPRH, and the expression of these genes is most significantly affected by changes in circ-SHPRH expression levels (Figure 11D). Considering these findings, the effects of circ-SHPRH on the cell cycle were subsequently explored.

[0174] The inventors performed cell cycle analysis on NB cells using flow cytometry. The results showed that SK-N-BE(2) ( Figure 12 A) and SH-SY5Y ( Figure 12 B) The proportion of cells in the G0 / G1 phase was the highest, and overexpression of Circ-SHPRH increased this trend, with an increase in the proportion of NB cells in the G0 / G1 phase. Knockdown of Circ-SHPRH had the opposite effect on these cells, with a decrease in the proportion of NB cells in the G0 / G1 phase. Figure 12 C represents the SK-N-BE(2) cells from each group. Figure 12 D represents SH-SY5Y cells in each group.

[0175] Then, RT-qPCR was performed to detect the expression of genes in the cell cycle pathway. The results showed that circ-SHPRH overexpression upregulated the expression of p21 (CDKN1A) mRNA. Figure 13 A represents SK-N-BE(2) cells from each group. Figure 13 B represents SH-SY5Y cells from each group), and knocking down circ-SHPRH downregulates the expression of p21 (CDKN1A) mRNA. Figure 13 C represents the SK-N-BE(2) cells from each group. Figure 13 D represents SH-SY5Y cells from each group. P21 is a cyclin-dependent kinase (CDK) inhibitor that primarily works by binding to CKDs such as CDK1 and CDK4 / 6 and inhibiting their kinase activity, thereby causing cell cycle arrest at a specific stage. Figure 13 E).

[0176] Then, protein levels were measured using a Simple Wes instrument (ProteinSimple, USA). The results showed that enhanced expression of circ-SHPRH significantly increased P21 protein levels in NB cells and decreased the expression of CDK4, CDK6, Cyclin D, and CDK1, while knocking down circ-SHPRH had the opposite effect. Figure 14 ).

[0177] To verify the impact of P21 on children with NB, the inventors further analyzed data from the public database R2 (NB-498, https: / / hgserver2.amc.nl / cgi-bin / r2 / main.cgi). The results showed that children in the high P21 expression group had significantly better event-free survival (EFS) and overall survival (OS) than those in the low expression group. Figure 15 AB), while P21 is found in M-stage NB patients (INSS, International Neuroblastoma Staging System), high-risk groups in the Childhood Oncology Group (COG) risk system, and MYCN P21 expression in the amplification group was significantly lower than that in the L1 / L2 / Ms phase, the non-high-risk group, and MYCN Non-amplification group children ( Figure 15 (CE). The above results indicate that P21 expression is associated with the progression of neuroblastoma.

[0178] 2. Circ-SHPRH regulates the P21-CDK pathway by expressing SHPRH-146aa.

[0179] SHPRH-146aa overexpression construct, wild-type (WT) circ-SHPRH overexpression construct, and mutant construct. Construction and transfection of the body

[0180] circ-SHPRH has a tandem stop codon "UGAUGA". Circularization causes the start codon "AUG" and the stop codon "UGA" to overlap, meaning translation can start and stop simultaneously. The underlined GAAG GGCA marks the junction, and UGAUGA marks the start site. Figure 16 A). The translation product of circ-SHPRH is a small peptide containing 146 amino acids (named SHPRH-146aa) (Zhang M, Huang N, Yang X, Luo J, Yan S, Xiao F, Chen W, Gao X, Zhao K, Zhou H) et al: A novel protein encoded by the circularform of the SHPRH gene suppresses glioma tumorigenesis. Oncogene 2018, 37(13):1805-1814.). To further explore the biological function of SHPRH-146aa in NB cells, the inventors constructed an overexpression construct of SHPRH-146aa (OE-146aa) and its control construct (OE-NC-146aa), a wild-type (WT) circ-SHPRH overexpression construct (OE-circ-SHPRH), a mutant construct (OE-mut-circ-SHPRH), and its control construct (OE-NC). Figure 16 (B) All five vectors were constructed and provided by GeneChem (Shanghai). The SHPRH-146aa overexpression construct OE-146aa was obtained by cloning the circ-SHPRH ORF (open reading frame) sequence and inserting it into vector GV657. The control construct OE-NC-146aa was obtained using vector GV657. The wild-type (WT) circ-SHPRH overexpression construct OE-circ-SHPRH was obtained by cloning the circ-SHPRH sequence and inserting it into vector GV727. The mutant construct OE-mut-circ-SHPRH overexpressed a mutant circ-SHPRH (mut-circ-SHPRH) that could not be translated into SHPRH-146aa. This was achieved by mutating the tandem start codon "TGATGA" in the circ-SHPRH sequence to "TGATTA" before inserting it into vector GV727. The control construct OE-NC was obtained using vector GV727. Subsequently, these constructs were transfected into NB cells using the same method as in Example 3.

[0181] RT-qPCR

[0182] The detection was performed using the method described in Example 2, wherein the forward and reverse primer sequences of circ-SHPRH are as shown in SEQ ID NO:2 and SEQ ID NO:3, respectively, and the forward and reverse primer sequences of mut-circ-SHPRH are as shown in SEQ ID NO:20 and SEQ ID NO:21, respectively.

[0183] mutant-circSHPRH-F: AAACTGCTGAGAGAAGGGCAG (SEQ ID NO: 20);

[0184] mutant-circSHPRH-F: CTTGCCACGTTGAGAAAACGA (SEQ ID NO: 21).

[0185] Western Imprint

[0186] Using Part 1 of Example 6 Protein extraction and Western blotting The method described in the document was used for detection, which employed antibodies against the following proteins: P21 (Abcam, 1:100), CDK1 (CST, 1:100), CDK4 (CST, 1:100), CDK6 (CST, 1:100), Cyclin D (CST, 1:100), and GAPDH (#5174, CST, 1:100), as well as a Flag antibody against SHPRH-146aa (F3165, Sigma, 1:1000).

[0187] Cell proliferation, migration, and invasion detection, as well as colony formation assays, were performed using a real-time cell analyzer (RTCA).

[0188] The detection was performed using the method described in Example 3.

[0189] Flow cytometry

[0190] The detection was performed using the method described in Example 6.

[0191] co-immunoprecipitation (co-IP) assay

[0192] Whole-cell extracts were lysed in RIPA buffer (pH 7.4, 1 mM EDTA (E809185, MACKLIN, China), 150 mM NaCl (S805275, MACKLIN, China), 1.0% Nonidet P40 (N814616, MACKLIN, China), 50 mM Tris base (B350, GENVIEW, China), a mixture of protease inhibitors (04693132001, Roche, Switzerland), Na3VO4 (S817660, MACKLIN, China), and a mixture of protease inhibitors (including benzyl sulfonyl fluoride (ST506, Beyotime, China)). After centrifugation at 14,000 rpm for 15 minutes, the supernatant was collected, and the supernatant of the lysate was then incubated with antibodies against P21 (Abcam, USA) or IgG (CST, USA) at 4°C for 12–16 hours. Protein A agarose beads (11719408001, Roche) were used to bind antibodies under rotating conditions. The eluted proteins were identified by Western blotting using the Protein-Simple system. The IgG group served as a negative control, and the Input group as a positive control.

[0193] result

[0194] RT-qPCR was used to detect the expression of circ-SHPRH and mut-circ-SHPRH in S-KN-BE(2) cells transfected with the above five constructs. Figure 16 As shown in Figure C, transfection with the circ-SHPRH overexpression construct (OE-circ-SHPRH) increased the expression level of circ-SHPRH in cells, but transfection with the SHPRH-146aa overexpression construct (OE-146aa) did not significantly change the expression level of circ-SHPRH. Transfection with the OE-mut-circ-SHPRH construct induced the overexpression of mut-circ-SHPRH, but transfection with OE-circ-SHPRH did not have a similar effect.

[0195] like Figure 16 As shown in Figure D, the expression of SHPRH-146aa was measured using Western blotting. Compared with the control group, the SHPRH-146aa level in S-KN-BE(2) cells transfected with the SHPRH-146aa overexpression construct (OE-146aa) was significantly increased. Simultaneously, the effect of SHPRH-146aa levels on the P21-CDK pathway was assessed using Western blotting. Figure 16As shown in EF (where E is SK-N-BE(2) cells and F is SH-SY5Y cells), overexpression of SHPRH-146aa significantly increased the level of P21 protein in NB cells, while the protein levels of CDK4, CDK6, Cyclin D and CDK1 decreased.

[0196] The results of RTCA-based proliferation, colony formation, and migration assays showed that overexpression of SHPRH-146aa inhibited the proliferation, migration, and invasion of NB cells. Figure 17 AD). Among them. Figure 17 A and 17B are results of cell proliferation and colony formation based on RTCA. It can be seen that overexpression of SHPRH-146aa can inhibit the proliferation of NB cells (left image) and colony formation (middle and right images) (A is SK-N-BE(2) cells, B is SH-SY5Y cells). Figure 17 C and 17D are cell migration results based on RTCA. It can be seen that overexpression of SHPRH-146aa can inhibit the migration of NB cells (C is SK-N-BE(2) cells, and D is SH-SY5Y cells).

[0197] Flow cytometry analysis showed that overexpression of SHPRH-146aa induced an increase in the percentage of NB cells in the G0 / G1 phase (Fig. 17E-F, where E is SK-N-BE(2) cells and F is SH-SY5Y cells).

[0198] The above experimental results indicate that SHPRH-146aa can regulate the P21-CDK pathway.

[0199] To verify that circ-SHPRH expression inhibits NB cell proliferation via the P21-CDK pathway by increasing SHPRH-146aa levels, the inventors transfected wild-type (WT) circ-SHPRH overexpression constructs (in... Figure 18 (represented as OE-Circ in Chinese), mutant constructs (in...) Figure 18 Cells labeled OE-Mut were analyzed. RTCA proliferation, migration, and colony formation assays showed that the mutant circ-SHPRH had no significant effect on NB cell proliferation and migration. However, in the OE-Circ group, the proliferation and migration rates of NB cells were significantly reduced. Figure 18 AD). Western blot analysis also showed that overexpression mutants did not affect the levels of P21-CDK pathway proteins (AD). Figure 18 E).

[0200] P21 is a CDK inhibitor that binds to the cyclin / CDK complex, inhibiting its activity and thus preventing cell cycle progression. To further investigate whether overexpression of circ-SHPRH affects the ability of P21 to bind to the CDK4-Cyclin D complex, co-IP assays were performed. The results showed that, compared to the control group, the levels of CDK4 and Cyclin D bound to P21 were significantly increased in the OE-circ-SHPRH group. However, the OE-mut-circ-SHPRH group had no effect on the ability of P21 to bind to the CDK4-Cyclin D complex. Figure 18 F). In summary, enhanced overexpression of circ-SHPRH induces the binding of P21 to the CDK4-Cyclin D complex, thereby inactivating these complexes (F). Figure 18 G).

[0201] Example 7: Combined use of circ-SHPRH and everolimus

[0202] MTT test

[0203] SK-N-BE (2) cells were seeded at a density of 2000 cells per well into 96-well plates containing medium 1 and cultured at 37°C and 5% CO2. Everolimus (S1120, Selleck, USA) was then added to each well at concentrations of 5 nM, 10 nM, 50 nM, 100 nM, 1000 nM, 10000 nM, 20000 nM, 30000 nM, and 40000 nM. The solvent for everolimus was dimethyl sulfoxide (DMSO, Sigma, USA). An equal amount of DMSO was added to the control group. After 48 hours of culture, MTT (Solarbio, China) was added to each well, and the treated cells were cultured for another 4 hours. The optical density at 490 nm was measured using a microplate reader (Clario Star, Germany).

[0204] Combined use

[0205] SK-N-BE(2) cells overexpressing circ-SHPRH (OE-circ, experimental group) transfected with the circ-SHPRH overexpressing lentiviral construct from Example 3 and SK-N-BE(2) cells transfected with the control lentiviral construct (OE-NC, control group) were cultured at 37°C and 5% CO2. The following two sets of experiments were performed:

[0206] Experiment 1: 12 hours after transfection, cells were seeded into proliferation assay plates matched to the RTCA-DP instrument. After 4 hours of cell adhesion, 16179 nM everolimus was added to each well in the experimental group, and an equal amount of DMSO was added to the control group. Using the above-mentioned… Cell proliferation, migration, and invasion were detected using a real-time cell analyzer (RTCA). The method was used to detect the cell proliferation capacity at different time points after the addition of everolimus;

[0207] Experiment 2: Everolimus was added to each well of the experimental and control groups to achieve concentrations of 5 nM, 10 nM, 50 nM, 100 nM, and 1000 nM, respectively. After culturing for 48 hours, MTT (Solarbio, China) was added to each well. The treated cells were then cultured for another 4 hours, and the optical density at 490 nm was measured using a microplate reader (Clario Star, Germany).

[0208] result

[0209] The optimal dose concentration of everolimus in SK-N-BE (2) cells was determined by the MTT assay, with an IC50 of 16179 nM ( Figure 19 A).

[0210] RTCA proliferation assays showed that treatment of SK-N-BE(2) cells overexpressing circ-SHPRH with 16179 nM everolimus significantly reduced their proliferation capacity, and the combined use of the two almost completely inhibited the proliferation of SK-N-BE(2) cells. Figure 19 B). In addition, such as Figure 20 As shown, the slope of the dose-response curve for cells overexpressing circ-SHPRH treated with everolimus is much greater than that for cells not overexpressing circ-SHPRH treated with everolimus. This means that as the everolimus concentration increases, the difference in inhibitory effect between cells overexpressing circ-SHPRH and those not overexpressing circ-SHPRH becomes increasingly significant. These experimental results indicate that the combination of circ-SHPRH and everolimus has a synergistic inhibitory effect.

[0211] As can be seen from the above examples, reduced expression of circ-SHPRH is associated with short-term overall survival (OS) in NB patients. MYCNAmplification, late INRG stage, and high risk based on INRG criteria are closely associated, and in vitro experiments have confirmed the ability of circ-SHPRH to inhibit NB cell proliferation, migration, and invasion. Furthermore, in vivo experiments using a mouse orthotopic tumor model have also demonstrated the inhibitory effect of circ-SHPRH on NB tumor growth. Considering the potential for drug resistance in patients treated with rapamycin-type drugs for neuroblastoma, this invention provides a novel treatment method to overcome such resistance. Moreover, the combined use of circ-SHPRH with mTOR pathway inhibitors can further reduce the proliferative capacity of neuroblastoma cells, exhibiting a synergistic inhibitory effect. This invention highlights the important significance of circ-SHPRH in neuroblastoma and its application prospects in gene therapy. Simultaneously, circ-SHPRH is also a promising early diagnostic and prognostic biomarker, providing new insights for the diagnosis and treatment of neuroblastoma patients.

[0212] The embodiments described above are exemplary and are merely preferred embodiments of the present invention. The scope of protection of the present invention is not limited thereto. For those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. circ-SHPRH for use in the preparation of a medicament for treating MYCN neuroblastoma, characterized in that, The sequence of the circ-SHPRH is SEQ ID NO:

1.

2. Use according to claim 1, characterized in that, The drug is an agent for promoting expression of circ-SHPRH.

3. Use according to claim 2, characterized in that, The agent for promoting expression of circ-SHPRH is a circ-SHPRH overexpression construct.

4. Use according to claim 3, characterized in that, The vector of the circ-SHPRH overexpression construct is an adenovirus vector, an adeno-associated virus vector, or a lentivirus vector.

5. Use according to any one of claims 1 to 4, characterized in that, The drug is used in combination with a second drug.

6. Use according to claim 5, characterized in that, The second drug is an mTOR pathway inhibitor.

7. Use according to claim 6, characterized in that, The mTOR pathway inhibitor is a rapamycin drug.

8. Use according to claim 7, characterized in that, The rapamycin drug is everolimus.