Application of AST2 gene of banana wilt pathogen in regulating the pathogenicity of banana wilt pathogen

Abstract

The present invention discloses the application of the AST2 gene of banana wilt pathogen in regulating the pathogenicity of banana wilt pathogen. The present invention utilizes the principle of homologous recombination to knock out the gene FocAST2; and utilizes the method of PEG-mediated protoplast transformation to obtain the knockout body. The results show that the knockout of the FocAST2 gene causes mycelium to curl and other growth deformities, significantly affects the spore production of the strain, reduces the content of α-ketoglutaric acid (α-KG), and increases the H 2 O 2 The content increased and the pathogenicity decreased, indicating that knocking out the FocAST2 gene affected the growth of banana wilt pathogen and reduced its pathogenicity. The present invention helps to further clarify the pathogenic molecular mechanism of banana wilt pathogen and provides a target gene for the development of effective fungicides.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, and particularly relates to application of an AST2 gene of banana wilt pathogen in regulating the pathogenicity of banana wilt pathogen. Background Art

[0002] Banana (Musa spp.) is one of the most traded fresh fruits in the world. However, the outbreak and spread of Fusarium oxysporum f.sp.cubense Tropical race 4 (Foc TR4) not only caused huge economic losses, but also became the most important limiting factor for the sustainable development of the banana industry. Therefore, how to effectively prevent and control banana Fusarium wilt has become one of the top issues in the banana industry. Many attempts have been made to prevent and control banana Fusarium wilt from aspects such as disease-resistant breeding, biological control and agricultural operations, but no breakthrough progress has been made. Chemical control is still the main way to prevent and control banana Fusarium wilt in the field because it has the advantages of being economical, direct and rapid. However, 85% of the fungicides currently used are single-target fungicides, and they can have drug resistance through single-target mutations, such as azoles, succinate dehydrogenase inhibitors (SDHI) and methoxyacrylate fungicides (QoI).

[0003] Studies have shown that Foc TR4 is resistant to conventional single-target chemical fungicides such as carbendazim, which cannot completely kill spores, and the surviving spores will eventually cause banana disease. At present, mixed agents are mainly used for field control of banana wilt. Although its control effect is better than that of single-target fungicides, the field control effect is still not obvious. Although multi-site fungicides can interfere with unknown cellular processes in various ways, they are also accompanied by increased toxicity and are very unfriendly to the environment. As an economic crop, bananas can not only be used for fresh consumption, but their pseudostems and leaves are also used as silage. These uses require that the fungicide should have the characteristics of high activity, low drug resistance, environmental friendliness and safety to non-target organisms. Studies have shown that using new targets as a breakthrough in the development of new pesticides can effectively reduce costs, shorten drug creation time, and increase their efficiency.

[0004] Continuous innovation of new targets and chemical entities remains an important way to create green pesticides. According to data from the U.S. Food and Drug Administration, 70% of new drugs in the past two decades were discovered based on the combination of targets and drugs. The discovery of the target of carboxin in 1970 led to the subsequent development of structurally diverse, broad-spectrum, and highly effective succinate dehydrogenase inhibitors (SDHIs) by major pesticide companies based on this target combined with biology; clarifying the drug's target on pathogens can not only create new drugs, but also synthesize dsRNA or siRNA through these targets, spray them on the surface of plants for fungal absorption and inhibition of target gene expression, thereby inhibiting the occurrence of diseases and achieving green prevention and control. Functional and structural analysis of potential targets is the basis for the development of new green pesticides.

[0005] Aspartate aminotransferases are divided into two categories in cells. One is cytoplasmic aspartate aminotransferase (AST1), which converts glutamine-derived aspartate (Asp) and α-ketoglutarate in the cytoplasm into glutamate and oxaloacetate, respectively. The other is mitochondrial aspartate aminotransferase (AST2), which has a low sequence similarity to cytoplasmic aspartate aminotransferase (AST1) ( Fig. 9 ), mitochondrial aspartate aminotransferase catalyzes glutamate and oxaloacetate into aspartate (Asp) and α-ketoglutarate (α-KG) in mitochondria. This enzyme is a member of the malate aspartate shuttle, involved in nucleotide synthesis, redox homeostasis, and can promote tricarboxylic acid (TCA) cycle, fatty acid transport, nitrogen balance and sulfur catabolism. Existing research mainly focuses on the study of cytoplasmic aspartate aminotransferase (AST1), while there is little research on the function of mitochondrial aspartate aminotransferase FocAST2. Summary of the invention

[0006] The invention aims to provide an application of banana wilt pathogen AST2 (FocAST2) gene in influencing the pathogenicity of banana wilt disease; banana wilt pathogen AST2 gene and its expression product can be blocked or inhibited to prevent banana wilt pathogen.

[0007] The technical solution adopted by the present invention is:

[0008] In a first aspect of the present invention, a use of a FocAST2 gene or an expression product thereof in reducing the pathogenicity of banana wilt pathogen is provided; the sequence of the FocAST2 gene is shown in SEQ ID NO.9.

[0009] Preferably, the use reduces the pathogenicity of banana wilt pathogen by blocking or inhibiting the expression of FocAST2 gene or its expression product.

[0010] Preferably, the expression product includes a protein formed by expression of the FocAST2 gene.

[0011] Preferably, the banana wilt pathogen is banana wilt pathogen race 4.

[0012] Preferably, the application comprises knocking out or knocking down the FocAST2 gene by genetic engineering methods, and the knocked-out sequence is the entire FocAST2 gene sequence as shown in SEQ ID NO.9.

[0013] Preferably, the genetic engineering method comprises a homologous recombination method.

[0014] Preferably, the homologous recombination method is homologous double crossover recombination technology.

[0015] Preferably, the homologous recombination method comprises:

[0016] 1) Using banana wilt pathogen Foc TR4 II5 genome template, primers UF and UR were used to amplify the upstream fragment of AST2 gene, and primers DF and DR were used to amplify the downstream fragment of AST2 gene;

[0017] 2) PCR fusion of the upstream and downstream fragments with the hygromycin fragment;

[0018] 3) Amplification was performed using NF and NR primers to obtain a DNA fragment of FocAST2 upstream-hygromycin fragment (HPH)-FocAST2 downstream; the prepared DNA fragment was added to protoplasts to obtain a mutant strain with a FocAST2 gene deletion.

[0019] When the recombinant DNA fragment enters the protoplast, the gene fragment to be knocked out in the genome is replaced by the principle of homologous recombination, and the recombinant elements such as the hygromycin resistance gene on the recombinant DNA fragment are also integrated into the genome. The hygromycin resistance marker in the recombinant element can be used to screen positive recombinant clones to obtain a mutant strain with a deletion of the FocAST2 gene.

[0020] Preferably, the sequence of the UF is as shown in SEQ ID NO.1, the sequence of the UR is as shown in SEQ ID NO.2; the sequence of the DF is as shown in SEQ ID NO.5; the sequence of the DR is as shown in SEQ ID NO.6; the sequence of the NF is as shown in SEQ ID NO.3; and the sequence of the NR is as shown in SEQ ID NO.7.

[0021] The second aspect of the present invention provides the use of the FocAST2 gene as a target of a drug for preventing and treating banana wilt, wherein the drug blocks or inhibits the expression of the FocAST2 gene or its expression product.

[0022] The third aspect of the present invention is the use of extracted FocAST2 inhibitors in the preparation of drugs for preventing and treating banana wilt.

[0023] Preferably, the drug reduces the pathogenicity of banana wilt fungus by inhibiting the expression of FocAST2 gene or its expression product.

[0024] Preferably, the inhibitor includes an agent that inhibits the expression of the FocAST2 gene and / or an agent that reduces or inactivates the activity of the FocAST2 protein.

[0025] Preferably, the inhibitor may include but is not limited to nucleic acid inhibitors, protein inhibitors, proteolytic enzymes, protein binding molecules, which can downregulate the expression or activity of the FocAST2 gene or the protein encoded by it at the protein or gene level.

[0026] For example, the inhibitor may include at least one of sgRNA, siRNA, dsRNA, miRNA, cDNA, antisense RNA / DNA, a low molecular compound, a peptide, an antibody, and the like.

[0027] Preferably, the compound comprises albendazole or a pharmaceutically acceptable salt thereof.

[0028] Preferably, the sequence of the siRNA is:

[0029] siRNAsense: UUCCCAUAAGGCACUUUGUAA (SEQ ID NO. 10);

[0030] siRNAantisense: GUUCACAAAGUGCCUUAUGGGAA (SEQ ID NO. 11).

[0031] Preferably, the inhibitor further comprises a knockout vector containing the above-mentioned FocAST2 gene.

[0032] Preferably, the inhibitor can effectively reduce the pathogenicity of banana wilt pathogen by effectively inhibiting or silencing the expression of FocAST2 gene.

[0033] Preferably, the drug also includes a pharmaceutically acceptable carrier or excipient, which may be one or more of an excipient, a diluent, a thickener, a filler, a binder, a disintegrant, a lubricant, a surfactant, a suspending agent, a gelling agent, an adjuvant, a preservative, an antioxidant, a stabilizer, and a colorant.

[0034] A fourth aspect of the present invention provides a method for reducing the pathogenicity of banana wilt or preventing and controlling banana wilt, comprising blocking or inhibiting the expression of the FocAST2 gene or its expression product.

[0035] The beneficial effects of the present invention are:

[0036] The present invention discloses the application of the FocAST2 gene in regulating the pathogenicity of banana wilt pathogen. The present invention utilizes the principle of homologous recombination to knock out the gene FocAST2; and utilizes the method of PEG-mediated protoplast transformation to obtain the knockout body. The results show that the knockout of the FocAST2 gene causes the mycelium to grow in curled growth and other growth deformities, significantly affects the spore production of the strain, reduces the α-ketoglutaric acid content, increases the H2O2 content, and reduces the pathogenicity; indicating that knocking out the FocAST2 gene affects the growth of banana wilt pathogen and reduces its pathogenicity. The present invention is helpful to further clarify the pathogenic molecular mechanism of banana wilt pathogen and provides a target gene for the development of effective fungicides. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 .Construction of banana knockout (Figure A is a schematic diagram of constructing gene knockout by fusion PCR; Figure B is a schematic diagram of knockout verification).

[0038] Figure 2 .Effect of FocAST2 gene knockout on hyphal morphology.

[0039] Figure 3 .Effect of FocAST2 gene knockout on conidia production.

[0040] Figure 4 .Effect of FocAST2 gene knockout on α-KG content.

[0041] Figure 5 .Effect of FocAST2 gene knockout on H2O2 content.

[0042] Figure 6 .Effect of FocAST2 gene knockout on the pathogenicity of Foc TR4; A: Banana leaves were sprayed with II5 and ΔFocAST1 conidia (1×10 6 / ml); photographed 7-9 days after inoculation; Bar=1 cm; B: disease phenotype; C: disease progression assessed by measuring lesion length in bulbs 7-9 days after infection; data presented as mean SD of three independent experiments, different asterisks above the columns indicate significant differences between treatments; D: is the disease index of the inoculated plants in B, and the disease severity was assessed using a four-scale rating standard.

[0043] The disease index assessment criteria are as follows:

[0044] The disease index range is: 0 (no symptoms), 1 (brown spots appear on the inner rhizome), 2 (less than 25% of the inner rhizome turns brown), 3 (up to 75% of the inner rhizome turns brown), 4 (the entire inner rhizome and pseudostem turn dark brown and die). A total of 20 technical replicates were set up in the experiment, with 3 replicates in each.

[0045] Figure 7 DARTS experiments proved that FocAST2 is the direct action site of ABZ.

[0046] Figure 8 (A (control group)) and (B (experimental group)) Topical application of pathogen FocAST2-siRNA inhibited the virulence of Foc TR4. Banana leaves were treated with control or FocAST2-siRNA (150 ng / μL) and then inoculated with TR4. Bar = 1 cm. C and D are the results of relative lesion size measurement on leaves in A and B using ImageJ software (9 dpi). Error bars represent SD of 10 samples and relative lesion size was calculated for 3 biological replicates.

[0047] Fig. 9 Phylogenetic tree and sequence alignment of aspartate aminotransferase. A: Phylogenetic tree of aspartate aminotransferase in different Fusarium species (red is cytoplasmic aspartate aminotransferase AST1, the sequences are aspC, FoAST1 (EMT68912.1); FomAST1 (KAH7467738.1); FsAST1 (XP_036536631.1); FfAST1 (KLO97248.1); green is mitochondrial aspartate aminotransferase AST2, the sequences are FnAST2 (KAF5564309.1); FolAST2 (XP_0182510 18.1); FoAST2 (KAF5642570.1); FtAST2 (XP_037212704.1); FmAST2 (XP_041689554.1); FopAST2 (EXA39174.1); FocR1AS2 (ENH72826.1); FolAST2 (XP_018251018.1); FocAST2; FbAST2 (KAF4342566.1); B: Sequence alignment analysis of FocAST2 and aspC. DETAILED DESCRIPTION

[0048] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0049] Example 1 Construction of banana wilt knockout

[0050] The FocAST2 knockout fragment was constructed by fusion PCR. The main steps of this method are as follows:

[0051] 1) Primers were designed based on the upstream 1000bp and downstream 1000bp sequences of the banana wilt pathogen FocAST2 DNA sequence. Primers UF and UR amplified the upstream fragment of the AST2 gene, and primers DF and DR amplified the downstream fragment of the AST2 gene. The banana wilt pathogen Foc TR4 II5 genome template was used for amplification. PCR was performed using the Novagen 2×Phanta Max Master Mix enzyme. After detection by agarose gel electrophoresis, the PCR products of each fragment were purified.

[0052] 2) PCR fusion of the upstream and downstream fragments of the gene and the hygromycin fragment.

[0053] 3) Using the PCR in step 2) as a template, amplification was performed using NF and NR primers to obtain a DNA fragment of FocAST2 upstream-hygromycin fragment (HPH)-FocAST2 downstream, and the PCR product was recovered after gel cutting and set aside.

[0054] 4) The prepared PCR product was subjected to the PEG-mediated protoplast transformation method. After obtaining the transformants, identification primers were designed and IF and IR were used to perform PCR to identify the transformants to see whether the sequence of the transformants was successfully replaced by the hygromycin fragment ( Figure 1 A).

[0055] Results: In order to analyze the biological function of FocAST2 gene, a gene knockout experiment was conducted on FocAST2. The FocAST2 gene was replaced by hygromycin fragment and transferred into wild-type strain II5. Transformants were selected by hygromycin and identified by PCR. Figure 1 As shown in B, the FocAST2 fragment cannot be amplified in the knockout gene but can be amplified in II5, which indicates that the FocAST2 gene has been successfully knocked out; the gene ID of FocAST2 is FOIG_07863T0; the sequence is as follows:

[0056]

[0057] Table 1 Knockout primers

[0058]

[0059]

[0060] Table 2 PCR fusion system

[0061] Components Dosage 2×Phanta Max Master Mix 25μL Upstream PCR purification product 200ng HPH Purification Products 200ng Downstream PCR purification product 200ng <![CDATA[ddH2O]]> Up to 50μL

[0062] Example 2 Mycelial morphology changes

[0063] The preserved Foc TR4 wild-type strain II5 and ΔFocAST2 knockout were transferred to PDA medium and cultured at 28°C for 5-7 days. A 6 mm diameter bacterial cake was punched at the edge of the freshly activated colony with a cork borer and inoculated on a new PDA medium. The mycelium was cultured at 28°C for 24 hours, and the edge mycelium was picked and transferred to a glass slide to observe the mycelial morphology under a microscope.

[0064] Results: After 6 days of growth on PDA plates, the growth of ΔFocAST2 colonies slowed down and the colonies were smaller than those of wild-type strain II5. Microscopic observation showed that the knockout mycelium morphology changed. Compared with the wild-type strain II5, the knockout mycelium showed curling and other growth deformities ( Figure 2 ).

[0065] Example 3 Changes in the number of conidia formed

[0066] The preserved wild-type strain II5 and ΔFocAST2 knockout were transferred to PDA medium and cultured at 28°C for 5-7 days. A 6 mm diameter bacterial cake was punched at the edge of the freshly activated colony with a cork puncher, and 6-8 bacterial cakes were inoculated into PDB liquid medium, cultured at 28°C for 5 days, and the bacterial liquid was filtered with 3 layers of filter paper to collect the conidia liquid, and the spore count was calculated using a hemocytometer. The experiment was repeated 5 times.

[0067] Results: The conidia production of II5 and ΔFocAST2 was measured using a hemocytometer. The results showed that the conidia production of II5 was significantly higher than that of the knockout. Compared with II5, the conidia production of the knockout decreased by 11 times (p<0.0001). This indicates that the deletion of this gene significantly affects the conidia production of the strain ( Figure 3 ).

[0068] Example 4 Determination of α-ketoglutarate content in strains

[0069] The preserved wild-type strain II5 and ΔFocAST2 knockout were transferred to PDA medium and cultured at 28°C for 5-7 days. A 6mm diameter bacterial cake was punched at the edge of the freshly activated colony with a cork puncher, and 6-8 bacterial cakes were inoculated into PDB liquid medium, cultured at 28°C for 5 days, and the bacterial solution was filtered with 3 layers of filter paper, and the mycelium on the filter paper was scraped. The mycelium was quickly frozen with liquid nitrogen and tested according to the instructions of the Solebold α-ketoglutaric acid (α-KG) content detection kit (BC5425).

[0070] Results: The contents of α-ketoglutarate in the mycelia of wild-type strain II5 and ΔFocAST2 knockout strain were detected. Figure 4 As shown in the figure, compared with the wild-type strain II5 hyphae, the α-KG content in the knockout hyphae was significantly reduced, 1.88 times less than the control (p<0.0001); AST aspartate aminotransferase is generally divided into two categories, one is the cytoplasmic aspartate aminotransferase that catalyzes aspartate and α-kg to glutamate and oxaloacetate; the other is the mitochondrial aspartate aminotransferase that does the opposite. The reduction in the content of α-KG indicates that the conversion direction of FocAST2 may be from glutamate to aspartate, and the enzyme is a mitochondrial aspartate aminotransferase.

[0071] Example 5 Determination of hydrogen peroxide content in strains

[0072] The preserved wild-type strain II5 and ΔFocAST2 knockout were transferred to PDA medium and cultured at 28°C for 5-7 days. A 6mm diameter bacterial cake was punched at the edge of the freshly activated colony with a cork puncher, and 6-8 bacterial cakes were inoculated into PDB liquid medium, cultured at 28°C for 5 days, and the bacterial solution was filtered with 3 layers of filter paper, and the hyphae on the filter paper were scraped. The hyphae were quickly frozen with liquid nitrogen and tested according to the instructions of the Solebold Hydrogen Peroxide (H2O2) Content Detection Kit (BC3595).

[0073] Results: The H2O2 content in the mycelia of the wild-type strain II5 and the ΔFocAST2 knockout strain was detected. Figure 5 As shown, compared with the wild-type strain II5 hyphae, the H2O2 content in the knockout hyphae was increased and decreased 1.58 times compared with the control (p<0.05), which indirectly indicated that FocAST2 is a mitochondrial enzyme that, as a member of the malate-aspartate shuttle (MAS), supports oxidative phosphorylation.

[0074] Example 6 Knockout leaf and potted plant infection experiment

[0075] The preserved wild-type strain II5 and ΔFocAST2 knockout were transferred to PDA medium and cultured at 28°C for 5-7 days. A 6mm diameter bacterial cake was punched at the edge of the freshly activated colony with a cork puncher, and 6-8 bacterial cakes were inoculated into PDB liquid medium. The culture was cultured at 28°C for 5 days, and the bacterial liquid was filtered with 3 layers of filter paper to collect the conidia liquid. The spore count was calculated using a hemocytometer, and an appropriate amount of sterile water was added to adjust the concentration to 10 6 spores / mL.

[0076] Using the same volume of water as the control, spore liquid of II5 and ΔFocAST2 were prepared and sprayed on the Brazilian banana leaves for inoculation. Each spore liquid was inoculated into 20 banana leaves and cultured at 28°C for 7 days. After 7 days, photos were taken to record the disease situation, and imageJ was used to calculate and count the lesion area of ​​3 random banana leaves.

[0077] Using the same volume of water as a control, II5 and ΔFocAST2 spores were prepared and inoculated into potted Brazilian seedlings using the root wounding method. Thirty Brazilian seedlings were inoculated with each spore. After 30 days, the disease of the banana seedlings inoculated with the strain was observed and photographed. The bulbs of the banana seedlings were cut open to observe the browning degree of the bulbs. The disease level was determined and recorded according to the disease grading survey standard, and the disease index was statistically calculated.

[0078] The results are as follows Figure 6 As shown in the results, the knockout of FocAST2 gene led to a decrease in the pathogenicity of the strain and a decrease in the area of ​​lesions in both leaf and pot inoculation results; the average disease index of the knockout banana was significantly lower than that of the II5 inoculation. This indicates that the FocAST2 gene plays an important role in the pathogenicity of Foc TR4.

[0079] Example 7 Albendazole (ABZ) inhibits FocAST2

[0080] In order to confirm that FocAST2 is the direct target of ABZ, FocAST2 was expressed in prokaryotes and the DARTS validation experiment was performed by Western blot, which specifically included the following steps:

[0081] FocAST2 cDNA was cloned into the pET30a(+) vector for His tagging and transformed into Escherichia coli BL21(DE3) to express the protein. The transformed cells were cultured in LB at 37°C overnight, induced with IPTG at 16°C for 20h, and then lysed with lysozyme and ultrasonic treatment. Afterwards, the supernatant was purified using a His column (Transgene Biotech, Beijing, China). 5mg / mL of protein was treated with different concentrations of albendazole (ABZ) or DMSO as a control at room temperature for 60 minutes. The samples were treated with 1:800 (pronase:protein) pronase (Roche, Switzerland) at room temperature for 45 minutes. The reaction was stopped by boiling for 10min and SDS-PAGE loading buffer was added. All samples were separated on 20% Tris-bis gels and transferred to nitrocellulose membranes. His Tag Mouse monoclonal antibody (Beyotime, Shanghai, China) and AP-labeled goat anti-mouse IgG (H+L) (Beyotime, Shanghai, China) were used to detect the expression level of FocAST2 protein. The intensity of the bands detected by Western blots was quantified using the BCIP / NBT alkaline phosphatase colorimetric kit (Beyotime, Shanghai, China).

[0082] The experimental results are as follows Figure 7 As shown, after the purified FocAST2-His protein was incubated with DMSO, 0.056 μM, 0.56 μM, and 5.6 μM ABZ, the level of FocAST2-His protein increased with the increase of drug concentration under the action of PNase hydrolysis, and this effect was proved to be dose-dependent.

[0083] The above results indicate that ABZ can directly target and bind to FocAST2 protein and that ABZ is an inhibitor of FocAST2.

[0084] Example 8 FocAST2-siRNA Experiment

[0085] The siRNA sequence was designed based on the mRNA sequence of Foc TR4 FOIG_07863 and synthesized by Shanghai Shenggong Biotechnology Co., Ltd. The siRNA sequence is as follows:

[0086] siRNAsense: UUCCCAUAAGGCACUUUGUAA (SEQ ID NO. 10);

[0087] siRNAantisense:GUUCACAAAGUGCCUUAUGGGAA (SEQ ID NO. 11);

[0088] The siRNA targeting FocAST2 synthesized by Shanghai Biotech was diluted to 150ng / μL with sterile water, and sterile water and 5mg / L ABZ were used as controls. 10μL FocAST2-siRNA was dropped on the surface of banana leaves. After 6-8 hours, 5mm Foc TR4 mycelium blocks were applied to the same position containing FocAST2-siRNA. The leaves were observed for disease after 7-10 days.

[0089] In order to verify the effect of synthesized siRNA targeting FocAST2 in inhibiting Fusarium wilt, FocAST2-siRNA was synthesized in this study. FocAST2-siRNA (150ng / μL, 10μL) was applied to banana leaves, which showed milder disease symptoms compared with water treatment and 5mg / L ABZ. This experiment shows that the external application of siRNA targeting FocAST2 can inhibit the virulence of pathogens by inhibiting the target gene FocAST2 ( Figure 8 ).

[0090] Example 9

[0091] The MEGA software and the online tool Itol (https: / / itol.embl.de / ) were used to construct a phylogenetic tree using the neighbor method (bootstrap set to 1000) for the aspartate aminotransferase protein sequences in different Fusarium species. The online tool ESPript 3 (https: / / espript.ibcp.fr / ESPript / cgi-bin / ESPript.cgi) was used for multiple sequence alignment. The aspC that has been reported is a type of cytoplasmic aspartate aminotransferase (AST1), and the sequence similarity between FocAST2 and aspC is not high ( Fig. 9 ).

[0092] The above specific implementations have been described in detail for the present invention, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Banana wilt pathogen AST2 Application of a gene or its expression product in reducing the pathogenicity of banana wilt pathogen; the banana wilt pathogen AST2 The nucleotide sequence of the gene is shown in SEQ ID NO:9, and the application includes blocking or inhibiting AST2 The expression of the gene or its expression product can reduce the pathogenicity of banana wilt fungus.

2. The use according to claim 1, characterized in that: The application includes knocking out or knocking down by genetic engineering methods AST2 Gene.

3. The use according to claim 2, characterized in that: The genetic engineering method includes a homologous recombination method.

4. The use according to claim 3, characterized in that: The homologous recombination method includes homologous double crossover recombination technology.

5. The use according to claim 4, characterized in that: The homologous recombination method comprises: 1) Fusarium wilt Foc TR4 II5 genomic template, primers UF and UR amplify the AST2 The upstream fragment of the gene was amplified by primers DF and DR AST2 Downstream fragment of gene; 2) PCR fusion of the upstream and downstream fragments with the hygromycin fragment; 3) Use NF and NR primers to amplify and obtain the DNA fragment of FocAST2 upstream-hygromycin fragment-FocAST2 downstream; add the prepared DNA fragment into protoplasts to obtain FocAST2 Gene deletion mutant strains.

6. The use according to claim 5, characterized in that: The sequence of the UF is shown in SEQ ID NO.1, the sequence of the UR is shown in SEQ ID NO.2; the sequence of the DF is shown in SEQ ID NO.5; the sequence of the DR is shown in SEQ ID NO.6; the sequence of the NF is shown in SEQ ID NO.3; and the sequence of the NR is shown in SEQ ID NO.

7.

7. Banana wilt pathogen AST2 Application of genes as targets for drugs for controlling banana wilt, wherein the drugs block or inhibit AST2 The banana wilt pathogen is expressed by AST2 The nucleotide sequence of the gene is shown in SEQ ID NO:

9.

8. Banana wilt pathogen AST2 Application of inhibitor in the preparation of medicine for preventing and treating banana wilt, the banana wilt pathogen AST2 The nucleotide sequence is shown in SEQ ID NO:9; The inhibitor may include siRNA, and albendazole or a pharmaceutically acceptable salt thereof; The sequence of the siRNA is: siRNAsense:UUCCCAUAAGGCACUUUGUAAC; siRNAantisense:GUUCACAAAGUGCCUUAUGGGAA.

9. A method for reducing the pathogenicity of banana wilt pathogen or preventing banana wilt disease, comprising blocking or inhibiting banana wilt pathogen AST2 The banana wilt pathogen is expressed by AST2 The nucleotide sequence of the gene is shown in SEQ ID NO:

9.

10. The use according to any one of claims 1 to 8 or the method according to claim 9, characterized in that: The banana wilt pathogen is banana wilt pathogen race 4.

Images