A non-coding RNA biomarker, kit and application thereof for differentiating benign and malignant pulmonary ground-glass nodules
A combination of non-coding RNA biomarkers (miR-147, miR-206, miR-1246, lncPART1, and circUBXN7) enhances the diagnostic accuracy for lung ground glass nodules, addressing the limitations of existing biomarkers by achieving 82% sensitivity and 80% specificity in distinguishing benign from malignant nodules.
Patent Information
- Application Number
- CN202410915933.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-09
- Publication Date
- 2025-07-15
- Estimated Expiration
- 2044-07-09
AI Technical Summary
The prior art molecular marker diagnostic positive rate, sensitivity and specificity for the differentiation of benign and malignant pulmonary ground glass nodules is low, resulting in a high false positive rate, wasting medical resources and bringing mental and economic burden to patients.
The combination of four non-coding RNAs, miRNA-147, miR-206, miR-1246, lncPART1 and circUBXN7, was used as biomarkers to detect expression levels in peripheral blood by real-time fluorescence quantitative PCR to identify the benign and malignant nature of lung ground glass nodules.
The diagnosis rate of differentiation of benign and malignant lung ground glass nodules was improved, and the sensitivity and specificity reached 82% and 80% respectively, which was significantly better than the traditional methods.
Smart Images

Figure CN118562962B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of early disease detection, and in particular to a non-coding RNA biomarker, a kit and applications thereof for differentiating benign and malignant ground-glass nodules of the lung. Background Art
[0002] Lung cancer is the leading malignant tumor in terms of morbidity and mortality worldwide. Recent data indicate that its overall five-year survival rate is less than 20%. This is because most patients are diagnosed at an advanced stage, and limited early diagnosis results in a low overall five-year survival rate. In the early 21st century, major clinical studies worldwide confirmed that low-dose CT screening can improve the early diagnosis of lung cancer and reduce its overall mortality rate. Consequently, major guidelines have recommended low-dose CT as a screening tool for lung cancer. With the widespread adoption of lung CT screening and the continuous advancement of imaging technology, an increasing number of ground-glass nodules (GGL) have been detected. Literature reports suggest that the incidence of pulmonary nodules is as high as 20%. Although a 2010 study published by the US National Institutes of Health (NIH) showed that low-dose CT screening reduced lung cancer mortality by 20% compared to conventional chest X-rays, the high false-positive rate of 96.4% leads to overdiagnosis of patients with pulmonary nodules, resulting in unnecessary subsequent biopsies, surgeries, and follow-up visits. This wastes precious medical resources and places unnecessary emotional and financial burdens on patients, as well as iatrogenic injuries. Determining the nature of pulmonary nodules, especially GGL nodules, is extremely difficult. Improper handling can lead to overdiagnosis or delayed treatment. Accurately diagnosing the nature of pulmonary ground-glass nodules is a key and difficult issue that needs to be addressed in clinical practice.
[0003] In recent years, with the advancement of molecular biology techniques, numerous studies have focused on identifying key biomarkers for distinguishing GGNs (ground-glass nodules) at the molecular level. Numerous studies have demonstrated the importance of molecular markers such as DNA methylation, miRNAs, lncRNAs, and cirRNAs in the early diagnosis of benign and malignant pulmonary nodules. In particular, recent advances in liquid biopsy technology have enabled the widespread use of non-invasive molecular markers for the early diagnosis of pulmonary nodules. Studies have shown that non-coding RNAs can be used to differentiate benign and malignant pulmonary nodules, thereby improving the accuracy of early lung cancer diagnosis. MiRNAs are a class of non-coding single-stranded RNA molecules approximately 22 nucleotides long, encoded by endogenous genes, that participate in post-transcriptional gene expression regulation. Combining multiple miRNAs can be used to distinguish benign and malignant pulmonary nodules with high accuracy. Long noncoding RNAs (lncRNAs) are a class of long noncoding RNAs greater than 200 nucleotides in length and are an important component of the non-coding genome. Studies have shown that they play a crucial role in the development and progression of lung cancer and can serve as biomarkers for the early diagnosis of lung cancer. CircRNAs are a unique class of noncoding RNA molecules that transform from linear RNA into closed circular structures through a process called "backsplicing." This structure makes circRNAs highly stable and resistant to degradation by exonucleases. CircRNAs can regulate gene expression at the transcriptional or post-transcriptional levels, playing a crucial role in the proliferation, migration, and invasion of lung cancer cells. However, the value of noncoding RNAs, including miRNAs, lncRNAs, and cirRNAs, in distinguishing benign from malignant ground-glass nodules (GGLs) remains unclear.
[0004] Previous studies have confirmed that miRNA-147 may inhibit the proliferation, metastasis, and invasion of lung adenocarcinoma cells. Lower levels of miR-147 in the peripheral blood of lung cancer patients are associated with a poorer prognosis. Studies have shown that miR-206, while acting as an oncogene to regulate tumor cell proliferation, can also function as a tumor suppressor gene to inhibit lung cancer cell proliferation and metastasis, mediating resistance to targeted lung cancer drugs through epithelial-mesenchymal transition. MiR-1246 has been shown to be associated with lung cancer invasion and metastasis, and elevated expression of miR206 and miR1246 can be detected in the peripheral blood of COPD patients years before the onset of lung cancer. LncPART1 promotes the development and progression of lung cancer. CircUBXN7 expression is downregulated in bladder cancer. Enforced circUBXN7 expression can inhibit bladder cancer cell growth and invasion, but its expression and role in lung cancer remain unclear. Summary of the Invention
[0005] To address the low diagnostic positivity, sensitivity, and specificity of existing molecular markers used to differentiate benign and malignant ground-glass nodules (GGNs), the present invention demonstrates for the first time that, compared with healthy controls and patients with benign GGNs, miR-147 expression in the peripheral blood of patients with malignant GGNs is significantly decreased, while miR-206, miR-1246, lncPART1, and circUBXN7 expression are significantly increased. The combined use of these five non-coding RNAs has a higher diagnostic rate for distinguishing benign and malignant GGNs. Therefore, the combination of miRNA-147, miR-206, miR-1246, lncPART1, and circUBXN7 is a reliable marker for distinguishing benign and malignant GGNs. The present invention provides applications and kits for distinguishing benign and malignant GGNs, namely, novel applications combining miRNA-147, miR-206, miR-1246, lncPART1, and circUBXN7. Based on extensive sample validation, five specific diagnostic markers for ground-glass nodules (GGNs) have been identified. The present invention uses blood samples from patients with pulmonary nodules detected by high-resolution CT in clinical settings, resulting in improved specificity. These five non-coding RNAs are proposed for the first time as diagnostic markers for GGNs and are more reliable than other non-coding RNA markers. This invention is of great significance for further identifying false-positive patients among patients with pulmonary nodules detected by high-resolution CT.
[0006] The technical solution adopted by the present invention to solve its technical problem is:
[0007] A non-coding RNA biomarker for differentiating benign and malignant pulmonary ground-glass nodules, comprising miRNA-147, miR-206, miR-1246, lncPART1, and circUBXN7.
[0008] The sequence of miRNA-147 is: GTGTGTGGAAATGCTTCGC (SEQ ID NO. 1)
[0009] The sequence of miR-206 is: TGGAATGTAAGGAAGTGTGTGG (SEQ ID NO. 2)
[0010] The sequence of miR-1246 is: AATGGATTTTTGGAGCAGG (SEQ ID NO. 3)
[0011] The sequence of the lncPART1 is: CCTGCCTTGTACTTCATGCAGGTTGAACAGAAATGTTTCTGAGCATGTATTGTTACAGCCCTCTGAGATGGTATAAAAGAATGAAAGAAGACACGACCTGCCTTCCAGGAGTTTCACAAAAAAGATGGGATGAACACAG (SEQ ID NO.4)
[0012] The sequence of the circUBXN7 is: ATGGCTGCCCACGGGGGCTCCGCGGCGTCCTCGGCGCTGAAGGGGTTAATTCAACAGTTCACCACCATTACCGGTGCAAGTGAAAGTGTAGGAAAACATATGCTTGAAGCGTGCAACAATAATCTGGAAATGGCAGTCACTATGTTTTTGGATGGTGGAGGAATCGCTGAAGAGCCCAGTACCAGTTCAGCAAGTGTCTCTACTGTCAGACCACACACAGAAGAAGAAGTTCGTGCCCCAATTCCTCAAAAGCAGGAAATACTGGTGGAACCAGAACCATTATTTGGTGCTCCTAAAAGACGACGGCCTGCACGTTCAATTTTTGATGGTTTCCGGGATTTTCAGACTGAAACTATTCGGCAAGAACAAGAATTAAGAAATGGAGGAGCTATCGATAAGAAATTAACTACCCTTGCAGATCTATTCCGGCCACCCATTGATTTGATGCATAAAGGCAGCTTTGAAACAGCCAAAGAGTGTGGCCAGATGCAAAATAAGTGGCTGATGATAAACATTCAAAATGTTCAAGACTTTGCATGTCAGTGCCTCAACCGCGATGT
[0013] GTGGAGCAACGAAGCTGTGAAGAATATTATCCGGGAACATTTCATTTTCTGGCAGGTTTATCATGACAGTGAGGAAGGTCAGAGATACATACAGTTTTATAAGTTAGGGGATTTCCCCTATGTTTCCATATTGGACCCACGGACAGGTCAGAAGCTAGTAGAATGGCACCAGTTAGATGTATCTTCTTTCTTGGACCAAGTGACGGGATTTCTGGGTGAACATGGACAACTGGATGGACTTTCTAGCAGTCCCCCCAAAAAATGTGCCCGTTCAGAGAGCCTTATAGATGCAAGTGAAGACAGCCAGCTAGAAGCTGCCATCAGAGCCTCCTTACAAGAAACACATTTTGATTCAACACAGACAAAACAGGATAGCCGCTCAGATGAAGAATCTGAATCTGAACTTTTTTCTGGCAGTGAGGAGTTCATATCCGTTTGTGGCTCTGATGAAGAAGAAGAGGTAGAGAATCTTGCCAAGTCCAGAAAGTCTCCCCACAAAGATTTGGGGCATAGAAAAGAGGAGAATAGAAGGCCGCTGACTGAGCCACCAGTCAGAACTGATCCTGGAACAGCCACAAACCACCAAGGATTGCCAGCTGTGGATTCAGAGATACTGGAGATGCCACCTGAAAAAGCAGATGGAGTAGTGGAGGGGATAGATGTAAATGGACCAAAAGCACAGCTGATGTTGCGGTATCCAGATGGAAAAAGGGAACAGATCACTCTTCCAGAGCAAGCTAAACTGCTAGCTTTGGTGAAGCACGTGCAGTCTAAAGGATACCCAAATGAACGTTTTGAACTTCTCACCAACTTTCCTCGAAGGAAATTATCTCATCTGGACTATGATATTACATTGCAAGAGGCAGGCCTTTGTCCTCAAGAGACTGTCTTTGTACAGGAAAGAAATTAA(SEQ ID NO.5)。
[0014] A non-coding RNA biomarker detection primer for differentiating benign and malignant pulmonary ground glass nodules, the detection primer comprising: a miRNA-147 primer, a miR-206 primer, a miR-1246 primer, a lncPART1 primer, and a circUBXN7 primer;
[0015] Upstream primer of miR-147: CGAGTCGTGTGTGGAAATGC (SEQ ID NO. 6)
[0016] Downstream primer of miR-147: TATGCTTGTTCTCGTCTCTGTGTC (SEQ ID NO. 7)
[0017] Upstream primer of miR-206: CAACACAATGGAATGTAAGGAAGT (SEQ ID NO. 8)
[0018] Downstream primer of miR-206: TATGGTTGTTCTGCTCTCTGTCTC (SEQ ID NO. 9)
[0019] Upstream primer of miR-1246: TTCGACGTGAATGGATTTTTG (SEQ ID NO. 10)
[0020] Downstream primer of miR-1246: TATCGTTGTACTCCAGACCAAGAC (SEQ ID NO.11)
[0021] Upstream primer of lncPART1: AAGGCCGTGTCAGAACTCAA (SEQ ID NO. 12)
[0022] Upstream primer of lncPART1: GTTTTCCATCTCAGCCTGGA (SEQ ID NO. 13)
[0023] Upstream primer of circUBXN7: CCACCCATTGATTTGATGC (SEQ ID NO. 14)
[0024] Downstream primer of circUBXN7: CCGTCGTCTTTTAGGAGCAC (SEQ ID NO. 15)
[0025] A kit comprising the above-mentioned biomarker detection primers, the kit comprising miRNA-147 primers, miR-206 primers, miR-1246 primers, lncPART1 primers and circUBXN7 primers as well as primers for internal reference genes U6 and GAPDH.
[0026] Upstream primer of miR-147: CGAGTCGTGTGTGGAAATGC (SEQ ID NO. 6)
[0027] Downstream primer of miR-147: TATGCTTGTTCTCGTCTCTGTGTC (SEQ ID NO. 7)
[0028] Upstream primer of miR-206: CAACACAATGGAATGTAAGGAAGT (SEQ ID NO. 8)
[0029] Downstream primer of miR-206: TATGGTTGTTCTGCTCTCTGTCTC (SEQ ID NO. 9)
[0030] Upstream primer of miR-1246: TTCGACGTGAATGGATTTTTG (SEQ ID NO. 10)
[0031] Downstream primer of miR-1246: TATCGTTGTACTCCAGACCAAGAC (SEQ ID NO.11) Upstream primer of lncPART1: AAGGCCGTGTCAGAACTCAA (SEQ ID NO.12)
[0032] Upstream primer of lncPART1: GTTTTCCATCTCAGCCTGGA (SEQ ID NO. 13)
[0033] Upstream primer of circUBXN7: CCACCCATTGATTTGATGC (SEQ ID NO. 14)
[0034] Downstream primer of circUBXN7: CCGTCGTCTTTTAGGAGCAC (SEQ ID NO. 15)
[0035] U6 upstream primer: GCTTCGGCAGCACATATACTAAAT (SEQ ID NO. 16)
[0036] Downstream primer of U6: CGCTTCACGAATTTGCGTCTCAT (SEQ ID NO. 17)
[0037] Upstream primer of GAPDH: GATGAGAAGTATGACAACAGCCT (SEQ ID NO. 18)
[0038] Downstream primer of GAPDH: AGTCCTTCCACGATACCAAAGT (SEQ ID NO. 19)
[0039] Preferably, the kit further comprises Taq enzyme, dNTP, MgCl2, fluorescent dye and PCR buffer.
[0040] A non-coding RNA biomarker or biomarker detection primer for differentiating benign from malignant ground-glass nodules of the lung and its use in preparing a diagnostic kit for malignant ground-glass nodules of the lung.
[0041] This study confirmed that, compared with healthy controls and a control group of benign ground-glass nodules, the peripheral blood of patients with malignant ground-glass nodules showed upregulation of miR-206, miR-1246, lncPART1, and circUBXN7, and downregulation of miRNA-147. The expression levels of these five RNAs varied by 0.3-6.0 fold. The combined AUC of these five RNAs reached 0.84, with a sensitivity and specificity of 82% and 80%, respectively. BRIEF DESCRIPTION OF THE DRAWINGS
[0042] Figure 1 It shows that only 5 of the 11 non-coding RNAs in the initial screening had expression level changes between the initial screening samples - 30 case groups and 30 control groups.
[0043] Figure 2 The expression levels of 5 RNAs were expressed differently among 500 cases, 210 benign nodules and 120 healthy controls.
[0044] Figure 3 The ROC curves of five non-coding RNAs for distinguishing between pulmonary ground glass nodule samples and control groups (benign pulmonary ground glass nodules and healthy controls) are shown.
[0045] Figure 4 The sensitivity and specificity of the combined detection of five non-coding RNAs are shown.
[0046] Figure 5 The figure shows the test results of the classic MAYO model for distinguishing benign and malignant lung nodules. DETAILED DESCRIPTION
[0047] The following is a complete and clear description of the specific technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative operations are within the scope of protection of the present invention.
[0048] Secondly, the descriptions of "first" and "second" in the present invention are only used to describe the purpose and cannot be understood as implying or indicating their importance or specifying the number of the technical features. Therefore, the features marked with "first" and "second" can be used to indicate that at least one of the features is included. In addition, the technical solutions of the various embodiments can be combined with each other, but they must be able to be implemented by ordinary technicians in this field. When the technical solutions are combined and there is a contradiction or it cannot be implemented, it should be deemed that such combination does not exist and is not within the scope of protection of this aspect.
[0049] Unless otherwise specified, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional techniques in molecular biology, biochemistry, and related fields in the art.
[0050] Peripheral blood samples from patients with pulmonary ground-glass nodules (GGNs) in this study were collected from a multicenter clinical study led by the Department of Respiratory Medicine, First Medical Center, PLA General Hospital. Clinical information was collected simultaneously with blood collection. The morphology of malignant GGNs was determined according to the WHO criteria, and patients were staged according to the 8th edition of the TNM classification for malignant tumors. Blood samples from all patients were collected prior to tumor diagnosis and resection.
[0051] In the present invention, the diagnostic kit for differential diagnosis of benign and malignant ground-glass nodules of the lung comprises primers for amplifying and detecting non-coding RNAs miRNA-147, miR-206, miR-1246, lncPART1 and circUBXN7 and internal reference upstream and downstream primers.
[0052] Furthermore, it also includes RNA extraction reagents, reverse transcription reagents and real-time fluorescence quantitative PCR reagents.
[0053] Furthermore, the internal references are U6 and GAPDH genes.
[0054] In the present invention, peripheral blood non-coding RNA miRNA-147, miR-206, miR-1246, lncPART1 and circUBXN7 are used in a kit for distinguishing benign from malignant ground-glass nodules of the lung. The kit uses real-time fluorescence quantitative PCR to detect the expression levels of miRNA-147, miR-206, miR-1246, lncPART1 and circUBXN7, miRNA-147, miR-206, miR-1246, lncPART1 and circUBXN7 in peripheral blood to determine whether the ground-glass nodules of the lung are malignant. The method is as follows:
[0055] 1. Extract total RNA from peripheral blood (Enhanced RNA Extraction Kit, Beijing Fengrui Biotechnology)
[0056] (1) Take out the peripheral blood sample to be extracted from the -80℃ ultra-low temperature freezer and thaw it on crushed ice;
[0057] (2) After the sample is extracted and mixed, 1 ml is transferred to an EP tube and total RNA is extracted according to the instructions of the enhanced RNA extraction kit.
[0058] 2. Reverse transcription (PrimeScript™ RT reagent kit, Takara)
[0059] (1) The reaction system is as shown in Table 1:
[0060]
[0061] (2) The reaction procedure is as follows:
[0062] 37℃ 15min (reverse transcription reaction)
[0063] 85℃ 5sec (inactivation reaction of reverse transcriptase)
[0064] 4℃
[0065] 3. Real-time fluorescence quantitative PCR (KAPA SYBR FAST qPCR, KAPA)
[0066] (1) The reaction system is as follows:
[0067]
[0068] Selection of peripheral blood noncoding RNA biomarkers
[0069] In this example, quantitative PCR was used to detect the expression of 11 non-coding RNAs (miR-122, miR-147, miR-137, miR-206, miR-1246, lncPART1, lnc01082, lncFENDRR, lncHOTAIR, circFNDC3B, and circUBXN7) in a group of peripheral blood samples (30 patients with malignant ground-glass nodules and 30 patients with benign ground-glass nodules).
[0070] Statistical analysis of the data was performed using GraphPad Prism 8.0 and SPSS 22.0. Numerical data are presented as mean ± standard deviation unless otherwise stated. Whole-blood non-coding RNA expression levels are presented as fold change relative to the control group. The Mann-Whitney U test was used to compare the expression of whole-blood non-coding RNAs between the malignant ground-glass nodule group and the control group. A P value less than 0.05 was considered statistically significant.
[0071] Example 1
[0072] Screening non-coding RNA with small samples to preliminarily identify markers
[0073] We first examined the expression of 11 non-coding RNAs (miR-122, miR-147, miR-137, miR-206, miR-1246, lncPART1, lnc01082, lncFENDRR, lncHOTAIR, circFNDC3B, and circUBXN7) in 60 peripheral blood samples (30 malignant ground-glass nodules and 30 benign ground-glass nodules). The results showed that compared with the normal control group, miR-147 was downregulated in malignant ground-glass nodules, while miR-1246, miR-206, lncPART1, and circUBXN7 were upregulated (p < 0.05). Figure 1 ).
[0074] Example 2
[0075] Further validation of noncoding RNA markers
[0076] To validate the diagnostic value of the five non-coding RNAs (miR-147, miR-1246, miR-206, lncPART1, and circUBXN7) initially screened, the expression levels of these five non-coding RNAs were further verified in 830 whole blood samples. Sixty samples from the initial screening step were also included in the statistical analysis of the validation step (the 830 whole blood samples here included 500 whole blood samples from patients with malignant ground-glass nodules, 120 healthy controls, and 210 whole blood samples from patients with benign ground-glass nodules).
[0077] Dye-based quantitative PCR was used to detect non-coding RNA. The primers used for each quantitative PCR were as follows:
[0078] Upstream primer of miR-147: CGAGTCGTGTGTGGAAATGC (SEQ ID NO. 6)
[0079] Downstream primer of miR-147: TATGCTTGTTCTCGTCTCTGTGTC (SEQ ID NO. 7)
[0080] Upstream primer of miR-206: CAACACAATGGAATGTAAGGAAGT (SEQ ID NO. 8)
[0081] Downstream primer of miR-206: TATGGTTGTTCTGCTCTCTGTCTC (SEQ ID NO. 9)
[0082] Upstream primer of miR-1246: TTCGACGTGAATGGATTTTTG (SEQ ID NO. 10)
[0083] Downstream primer of miR-1246: TATCGTTGTACTCCAGACCAAGAC (SEQ ID NO.11) Upstream primer of lncPART1: AAGGCCGTGTCAGAACTCAA (SEQ ID NO.12)
[0084] Upstream primer of lncPART1: GTTTTCCATCTCAGCCTGGA (SEQ ID NO. 13)
[0085] Upstream primer of circUBXN7: CCACCCATTGATTTGATGC (SEQ ID NO. 14)
[0086] Downstream primer of circUBXN7: CCGTCGTCTTTTAGGAGCAC (SEQ ID NO. 15)
[0087] U6 upstream primer: GCTTCGGCAGCACATATACTAAAT (SEQ ID NO. 16)
[0088] Downstream primer of U6: CGCTTCACGAATTTGCGTCTCAT (SEQ ID NO. 17)
[0089] Upstream primer of GAPDH: GATGAGAAGTATGACAACAGCCT (SEQ ID NO. 18)
[0090] Downstream primer of GAPDH: AGTCCTTCCACGATACCAAAGT (SEQ ID NO. 19)
[0091] The results showed that compared with the control group, miR-147 was down-regulated, while miR-1246, miR-206, lncPART1 and circUBXN7 were up-regulated in malignant ground-glass nodules (p<0.05), while there was no statistically significant difference in the expression of the above five non-coding RNAs in the peripheral blood between healthy controls and patients with benign ground-glass nodules in the control group ( Figure 2 Compared with the control group, the expression levels of the five non-coding RNAs changed by 0.3-6.0 times. These results suggest that peripheral blood non-coding RNAs can serve as biomarkers for distinguishing benign from malignant ground-glass nodules in the lung.
[0092] Example 3
[0093] Receiver operating characteristic (ROC) curve analysis
[0094] ROC curves were constructed to compare the diagnostic ability of five peripheral blood noncoding RNAs in distinguishing benign from malignant ground-glass opacities of the lung. The areas under the curve (AUCs) for the five noncoding RNAs were as follows: miR-147 0.61 (95% confidence interval: 0.57-0.65); miR-1246 0.68 (95% confidence interval: 0.64-0.71); miR-206 0.6 (95% confidence interval: 0.56-0.64); lncPART1 0.63 (95% confidence interval: 0.59-0.66); and circUBXN7 0.73 (95% confidence interval: 0.69-0.76). Figure 3 (AE). If the relative expression ratio of miR-147 in the subject's peripheral blood compared to the control group is less than 0.3, the probability that the subject's ground-glass nodule is malignant is 61%. If the relative expression ratio of miR-1246 in the subject's peripheral blood compared to the control group is greater than 4.4, the probability that the subject's ground-glass nodule is malignant is 68%. If the relative expression ratio of miR-206 in the subject's peripheral blood compared to the control group is greater than 4.9, the probability that the subject's ground-glass nodule is malignant is 60%. If the relative expression ratio of lncPART1 in the subject's peripheral blood compared to the control group is greater than 3.0, the probability that the subject's ground-glass nodule is malignant is 63%. If the relative expression ratio of circ-UBXN7 in the subject's peripheral blood compared to the control group is greater than 6.0, the probability that the subject's ground-glass nodule is malignant is 73%. If the above five non-coding RNAs are tested together and their expression levels meet the above conditions, the receiver operating characteristic (ROC) curve for distinguishing benign and malignant ground-glass nodules from malignant lungs has an AUC of 0.84, indicating an 84% probability of diagnosing a malignant ground-glass nodule. At the optimal cut-off value, the sensitivity and specificity of the five non-coding RNAs were as follows: miR-147, 30% and 83%; miR-1246, 34% and 93%; miR-206, 31% and 86%; lncPART1, 44% and 90%; and circUBXN7, 33% and 93%, respectively. If the above five non-coding RNAs are combined for detection, the AUC for distinguishing benign and malignant pulmonary ground-glass nodules can reach 0.84, with a sensitivity and specificity of 82% and 80%, respectively. Figure 4 We also evaluated the ability of the classic MAYO model for distinguishing benign and malignant lung nodules. The AUC of the model for distinguishing benign and malignant lung ground-glass nodules in this group was 0.62 (95% confidence interval: 0.57-0.68) ( Figure 5 ), with a sensitivity and specificity of 20% and 91%, respectively. These results indicate that the combined use of the five non-coding RNAs has higher sensitivity and specificity for the differential diagnosis of pulmonary ground-glass nodules compared with the commonly used Mayo Clinic model.
[0095] In summary, the present invention effectively overcomes the various shortcomings of existing differential diagnosis technologies for pulmonary ground glass nodules and has high clinical value.
[0096] The above embodiments are merely illustrative of the principles and functions of the present invention and are not intended to limit the present invention. Anyone skilled in the art may modify the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent changes or modifications within the technical field to which the present invention pertains, without departing from the scope and spirit of the present invention, are intended to be covered by the claims of the present invention.
Claims
1. A non-coding RNA biomarker panel for the differential diagnosis of benign and malignant pulmonary ground-glass nodules, characterized in that, The biomarker combination consists of miRNA-147, miR-206, miR-1246, lncPART1, and circUBXN7; The sequence of the miRNA-147 is as described in SEQ ID NO.1; the sequence of the miR-206 is as described in SEQ ID NO.2; the sequence of the miR-1246 is as described in SEQ ID NO.3; the sequence of the lncPART1 is as described in SEQ ID NO.4; the sequence of the circUBXN7 is as described in SEQ ID NO.
5.
2. Detection primers for a non-coding RNA biomarker combination for differentiating benign and malignant pulmonary ground-glass nodules, characterized in that, The detection primers consist of miRNA-147 primers, miR-206 primers, miR-1246 primers, lncPART1 primers, and circUBXN7 primers; the upstream primer sequence of miR-147 is as described in SEQ ID NO.6, the downstream primer sequence of miR-147 is as described in SEQ ID NO.7, the upstream primer sequence of miR-206 is as described in SEQ ID NO.8, the downstream primer sequence of miR-206 is as described in SEQ ID NO.9, the upstream primer sequence of miR-1246 is as described in SEQ ID NO.10, the downstream primer sequence of miR-1246 is as described in SEQ ID NO.11, the upstream primer sequence of lncPART1 is as described in SEQ ID NO.12, the downstream primer sequence of lncPART1 is as described in SEQ ID NO.13, the upstream primer sequence of circUBXN7 is as described in SEQ ID NO.14, and the downstream primer sequence of circUBXN7 is as described in SEQ ID NO.
15.
3. A kit comprising the detection primers of the biomarker combination according to claim 2, characterized in that, The kit includes miRNA-147 primers, miR-206 primers, miR-1246 primers, lncPART1 primers, and circUBXN7 primers, as well as primers for the internal reference genes U6 and GAPDH; The upstream primer sequence of miR-147 is as described in SEQ ID NO.6, the downstream primer sequence of miR-147 is as described in SEQ ID NO.7, the upstream primer sequence of miR-206 is as described in SEQ ID NO.8, the downstream primer sequence of miR-206 is as described in SEQ ID NO.9, the upstream primer sequence of miR-1246 is as described in SEQ ID NO.10, the downstream primer sequence of miR-1246 is as described in SEQ ID NO.11, the upstream primer sequence of lncPART1 is as described in SEQ ID NO.12, the downstream primer sequence of lncPART1 is as described in SEQ ID NO.13, the upstream primer sequence of circUBXN7 is as described in SEQ ID NO.14, the downstream primer sequence of circUBXN7 is as described in SEQ ID NO.15, the upstream primer sequence of U6 is as described in SEQ ID NO.16, the downstream primer sequence of U6 is as described in SEQ ID NO.17, the upstream primer sequence of GAPDH is as described in SEQ ID NO.18, and the downstream primer sequence of GAPDH is as described in SEQ ID NO.
19.
4. A kit according to claim 3, characterized in that, The kit further includes Taq enzyme, dNTP, Mgcl2, fluorescent dye, and PCR buffer.
5. Use of a detection primer for a non-coding RNA biomarker combination for differentiating benign and malignant pulmonary ground-glass nodules as described in claim 1 or a biomarker combination as described in claim 2 in the preparation of a diagnostic kit for pulmonary malignant ground-glass nodules.
Citation Information
Patent Citations
miRNA biomarkers, compositions and uses of the biomarker and the compositions
CN108165546A
Method and kit for differential diagnosis of lung benign nodules and malignant tumors through gene methylation
CN117106918A