InDel molecular marker for identifying nitrogen-induced susceptibility of wheat and application thereof
By applying the molecular marker Fd2591 in wheat, the problem of locating the wheat nitrogen-induced susceptibility gene Ihrl1 was solved, enabling more efficient breeding and disease resistance identification, and improving wheat disease resistance and production efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- YANGZHOU UNIV
- Filing Date
- 2024-06-06
- Publication Date
- 2026-06-12
AI Technical Summary
Existing technologies have failed to effectively locate and clone the nitrogen-induced susceptibility-related gene Ihrl1 in wheat, which leads to nitrogen nutrition inhibiting disease resistance and affecting wheat yield and quality.
A molecular marker Fd2591, located on wheat chromosome 2B, is provided for specific PCR amplification. Nitrogen-induced susceptibility is identified by detecting the size of the PCR amplification product. The method includes specific primers and PCR amplification program, combined with CTAB method for genomic DNA extraction.
This enables more accurate screening and breeding of wheat varieties whose disease resistance is not inhibited by nitrogen nutrition, improving breeding efficiency, reducing pesticide dependence, optimizing nitrogen nutrition management, and enhancing wheat disease resistance and production efficiency.
Smart Images

Figure CN118563001B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology technology, specifically relating to an InDel molecular marker for identifying nitrogen-induced susceptibility in wheat and its application. Background Technology
[0002] Nitrogen is an essential element for plant growth, and nitrogen-induced susceptibility (NIS) is a common phenomenon in agricultural production. Studies have shown that nitrogen levels, nitrogen forms, and nitrogen metabolism affect plant disease resistance. Plant diseases cause adverse effects on crops, such as reduced yield and quality, and in severe cases, complete crop failure, threatening food security.
[0003] Pheromonial-like reactions refer to the spontaneous formation of necrotic-like spots on leaves, leaf sheaths, and other parts of plants in the absence of pathogen infection. The symptoms of phytosensitivity-like reactions are similar to those of allergic reactions, both involving localized cell death. Related studies have confirmed that phytosensitivity-like reactions are not directly caused by pathogens but are a typical manifestation of programmed cell death, transmitting signals to enhance the plant's defense system. The formation of phytosensitivity-like mutants is often related to the accumulation of plant defense substances such as salicylic acid, phenolic compounds, callose, phytoalexins, and ROS, enhancing the plant's acquired resistance. Generally, although most phytosensitivity-like mutant materials possess good broad-spectrum disease resistance, they are often characterized by low yield and poor quality, making them difficult to apply in breeding.
[0004] Research has found wheat varieties P7001 Carrying nitrogen nutrition-responsive allergy-like genes Ndhrl1 It mediates powdery mildew resistance in wheat. Ndhrl1 The expression of this gene is suppressed by nitrogen nutrition, leading to reduced disease resistance (Reference: A novel nitrogen-dependent gene associates with the lesion mimic trait in wheat.). Further research has found... Ndhrl1 Received Ihrl1 Suppression (Reference: A dominant gene) Ihrl1 is tightly linked to and inhibits the gene Ndhrl1 mediating nitrogen-dependenthypersensitive reaction-like phenotype in wheat), wheat Ihrl1 It can suppress nitrogen-induced susceptibility. Currently, there are no reports of fine mapping and cloning of NIS-related genes. Summary of the Invention
[0005] The purpose of this section is to outline some aspects of embodiments of the present invention and to briefly describe some preferred embodiments. Simplifications or omissions may be made in this section, as well as in the abstract and title of this application, to avoid obscuring the purpose of these documents; however, such simplifications or omissions should not be construed as limiting the scope of the invention.
[0006] In view of the problems existing in the above and / or prior art, the present invention is proposed.
[0007] Therefore, the purpose of this invention is to overcome the shortcomings of the prior art and provide a wheat nitrogen-induced susceptibility suppressor gene. Ihrl1 Co-separated molecular markers Fd2591 .
[0008] To solve the above-mentioned technical problems, the present invention provides the following technical solution: [The following is a description of a wheat nitrogen-induced susceptibility suppressor gene.] Ihrl1 Co-separated molecular markers Fd2591 This includes molecular markers located on wheat chromosome 2B. I- ind002 and Fd6047 The molecular markers are located between 11415050 and 11415229 bp.
[0009] Molecular markers for specific PCR amplification Fd2591 The primers are:
[0010] Upstream primer Fd2591-F:5'-GTTCTTCCAGTCGCTCATCC-3' and
[0011] Downstream primer Fd2591-R: 5'-TATAGCACAAGCATCGGCAG-3';
[0012] The amplification product size is 204 bp.
[0013] As a preferred embodiment of the molecular marker described in this invention, the characteristic band for identifying nitrogen-induced susceptibility is 24 bp, and the nucleotide sequence is ACTAGCTAGACTGCTGCTGCTGCT.
[0014] Another object of the present invention is to overcome the shortcomings of the prior art and provide the application of the molecular markers described in any one of claims 1 to 3 in identifying nitrogen-induced susceptibility to wheat.
[0015] As a preferred embodiment of the application described in this invention, the method includes: extracting genomic DNA from wheat to be tested;
[0016] Using the genomic DNA of the wheat to be tested as a template, PCR amplification was performed using the upstream and downstream primers described in claim 1;
[0017] If the fragment size of the PCR amplification product is detected, and a product of 204 bp is amplified, then the wheat being tested is determined to be susceptible to nitrogen-induced disease.
[0018] As a preferred embodiment of the application described in this invention, it includes: extracting wheat genomic DNA using the CTAB method.
[0019] As a preferred embodiment of the application described in this invention, the PCR amplification reaction program includes: 94°C pre-denaturation for 3 min; 95°C denaturation for 30 s, 56°C annealing for 45 s, 72°C extension for 45 s, for 35 cycles; and 72°C extension for 10 min.
[0020] As a preferred embodiment of the application described in this invention, the PCR amplification reaction system comprises: 2 μl template DNA, 0.3 μl each of 10 μmol F and R primers, 0.3 μl 10 mM dNTPs, 1.5 μl 10X PCR buffer, 0.2 μl rTaq, and ddH2O added to bring the reaction system to 20 μl.
[0021] As a preferred embodiment of the application described in this invention, the method includes: detecting the fragment size of the PCR amplification product; if a 204bp product is amplified, the wheat to be tested is determined to be nitrogen-induced susceptible; if a 180bp product is amplified, the wheat to be tested is determined not to be nitrogen-induced susceptible.
[0022] As a preferred embodiment of the application described in this invention, it includes: a wheat nitrogen-induced susceptibility suppressor gene. Ihrl1 Suppressing powdery mildew resistance.
[0023] Another object of the present invention is to overcome the shortcomings of the prior art and provide a kit for PCR detection of nitrogen-induced susceptibility in wheat, comprising, wherein the kit contains the molecular marker for specific PCR amplification as described in claim 1. Fd2591 Primer pairs; wherein, molecular markers are used for specific PCR amplification. Fd2591 Primers include,
[0024] Upstream primer Fd2591-F:5'-GTTCTTCCAGTCGCTCATCC-3' and
[0025] Downstream primer Fd2591-R: 5'-TATAGCACAAGCATCGGCAG-3'.
[0026] As a preferred embodiment of the application described in this invention, the kit further includes dNTPs, Taq DNA polymerase, and Mg. 2+ PCR reaction buffer and standard positive template.
[0027] The beneficial effects of this invention are:
[0028] 1. This invention utilizes molecular markers. Fd2591 This allows for more accurate screening and breeding of wheat varieties whose disease resistance is not inhibited by nitrogen nutrition, thereby improving breeding efficiency.
[0029] 2. The cultivation and application of this type of variety can effectively suppress nitrogen-induced susceptibility, reduce dependence on pesticides, and lower agricultural production costs.
[0030] 3. This invention helps to optimize nitrogen nutrient management strategies in wheat cultivation, improves wheat's disease resistance while applying fertilizer rationally, provides a more scientific, efficient and sustainable solution for wheat production, and promotes sustainable agricultural development. Attached Figure Description
[0031] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. Wherein:
[0032] Picture 1 In Example 1 Ihrl1 Initial location of the gene.
[0033] Picture 2 In Example 1 Ihrl1 Genes and their co-segregated molecular markers Fd2591 Precise positioning.
[0034] Picture 3 These are the disease-resistant and non-disease-resistant InDel marker sequences for identifying wheat NIS in Example 1.
[0035] Picture 4 Molecular markers in Example 2 Fd2591 Results of resistance identification to powdery mildew. Detailed Implementation
[0036] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to the examples in the specification.
[0037] Many specific details are set forth in the following description to provide a thorough understanding of the invention. However, the invention may also be practiced in other ways different from those described herein, and those skilled in the art can make similar extensions without departing from the spirit of the invention. Therefore, the invention is not limited to the specific embodiments disclosed below. Furthermore, the term "an embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the invention. The phrase "in one embodiment" appearing in different places in this specification does not necessarily refer to the same embodiment, nor is it a single or selective embodiment that excludes other embodiments.
[0038] The raw materials and reagents used in this invention, including primers, genomic DNA of the sample to be tested, dNTPs, Taq polymerase, PCR buffer, agarose gel, electrophoresis buffer, and nucleic acid dyes, were purchased from Sangon Biotech (Shanghai) Co., Ltd.
[0039] Unless otherwise stated, the experimental methods disclosed in this invention all employ conventional techniques in molecular biology and related fields. Example 1
[0040] 1. Resistance genetic analysis
[0041] Material P7001 (The wheat variety independently bred in this laboratory, with pedigree Arze*3 / / Zhoumai 17 / Pancho,) served as the maternal parent (highly resistant), and its genotype is homozygous, denoted as aa. Fielder (Yaktana 54a*4 / 2 / Norin 10 / Brevor / 3 / 2*Yaqui 50 / 4 / Norin 10 / Brevor / 2 / Baart / Onas The male parent (highly susceptible) was homozygous, denoted as AA. Crossing the male and female parents yielded the F1 generation, all of which were highly susceptible, with a heterozygous genotype of Aa. Self-crossing the F1 generation yielded the F2 generation, which showed segregation of highly resistant (aa) and highly susceptible (AA, Aa) traits. Under low nitrogen conditions (nitrogen concentration of 143 mg / kg), 42 plants were highly resistant to powdery mildew, and 108 were highly susceptible. The segregation ratio of these two phenotypes, as determined by the chi-square test (2), was 3:1, indicating that the powdery mildew resistance of P7001 was controlled by a single gene. Under high nitrogen conditions (nitrogen concentration of 756 mg / kg), all 137 plants showed high susceptibility to powdery mildew, indicating that the powdery mildew resistance of P7001 was controlled by a single gene and regulated by nitrogen nutrition.
[0042] 2. Fd2591 Fine localization of molecular markers
[0043] In order to locate Ihrl1 Genes and their co-separation Fd2591Molecular markers were used to perform genotyping on 150 individuals from the F2 segregating population using a 55K SNP chip, yielding 12,063 polymorphic markers. Based on the marker results, a linkage map was constructed.
[0044] The initial positioning results are as follows Picture 1 As shown, Fd2591 The molecular marker was locked onto the short arm of chromosome 2B.
[0045] Molecular markers were designed using the URL http: / / 0514110.vicp.net:8018 / Fd2591 Molecular markers are located I-ind002 and Fd6047 Fine localization results between molecular markers, such as Picture 2 As shown. Fd2591-F The sequence is shown in SEQ ID NO.3. Fd2591-R The sequence is shown in SEQ ID NO.4; I-ind002-F The sequence is shown in SEQ ID NO.5. I-ind002-R The sequence is shown in SEQ ID NO.6; Fd6047-F The sequence is shown in SEQ ID NO.7. Fd6047-R The sequence is shown in SEQ ID NO.8.
[0046] use Fd2591 Molecular marker pairs P7001 and Fielder Sequencing was performed after PCR amplification, and the results are as follows: Picture 3 As shown, Fd2591 Molecular marker pairs P7001 The amplification product is shown in SEQ ID NO.1, and its size is 204 bp. Fd2591 Molecular marker pairs Fielder The amplification product is shown in SEQ ID NO.2, and the product size is 180bp. Example 2
[0047] 1. After crossing P7001 / Fielder, continuous self-pollination was carried out, and F3-F8 generations were obtained through single-ear propagation.
[0048] 2. Select Fd2591 Molecular markers were used to analyze and identify powdery mildew resistance in 267 lines of the F8 generation using polymerase chain reaction (PCR) and 4% agarose gel electrophoresis.
[0049] The PCR amplification reaction program is as follows: 94℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 56℃ annealing for 45 s, 72℃ extension for 45 s, for 35 cycles; 72℃ extension for 10 min.
[0050] The PCR amplification reaction system includes 2 μl template DNA, 0.3 μl each of 10 μmol F and R primers (10 mM), 0.3 μl dNTPs, 1.5 μl 10×PCR buffer, 0.2 μl rTaq, and ddH2O to bring the reaction system to 20 μl.
[0051] 3. Steps for identifying powdery mildew resistance
[0052] During the tillering stage, wheat P7001 Genotype lines and Fielder Inoculation of genotype strains with powdery mildew: Select diseased leaves from a powdery mildew-infected nursery and gently shake the powdery mildew fungus from the diseased leaves onto the wheat plants to be tested.
[0053] A survey of powdery mildew severity was conducted during the heading stage.
[0054] A scoring system from 0 to 100 was used, where 0 represents immunity and 100 represents complete susceptibility. Powdery mildew spore masses almost completely covered the leaf, and the numerical value represents the proportion of the leaf surface covered by these spore masses to the total leaf area. Thirty leaves were surveyed for each material.
[0055] The identification results are shown in Figure 4. P7001 There were 139 strains with the genotype (180bp), and the severity of powdery mildew was 25.55±7.60. Fielder There were 128 strains with the genotype (204 bp), and the powdery mildew severity was 47.16 ± 8.64, indicating that the molecular marker... Fd2591 It can identify powdery mildew resistance.
[0056] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. A gene associated with nitrogen-induced susceptibility suppression in wheat Ihrl1 Co-separated molecular markers Fd2591 Its application in identifying nitrogen-induced susceptibility to disease in wheat is characterized by: include, Genomic DNA was extracted from the wheat to be tested; Using the genomic DNA of the wheat to be tested as a template, molecular markers were amplified by specific PCR. Fd2591 PCR amplification was performed using primers; Molecular markers for specific PCR amplification Fd2591 The primers are: Upstream primer Fd2591-F: 5'-GTTCTTCCAGTCGCTCATCC-3' and Downstream primer Fd2591-R: 5'-TATAGCACAAGCATCGGCAG-3'; The fragment size of the PCR amplification product is detected. If a 204bp product is amplified, and the product contains a characteristic band for identifying nitrogen-induced susceptibility, and the nucleotide sequence of the characteristic band is ACTAGCTAGACTGCTGCTGCTGCT, then the wheat to be tested is determined to be susceptible to nitrogen-induced powdery mildew.
2. The application as described in claim 1, characterized in that: Wheat genomic DNA was extracted using the CTAB method.
3. The application as described in claim 1, characterized in that: The PCR amplification reaction program includes: 94℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 56℃ annealing for 45 s, 72℃ extension for 45 s, for 35 cycles; and 72℃ extension for 10 min.
4. The application as described in claim 1, characterized in that: The PCR amplification reaction system includes 2 μl template DNA, 0.3 μl each of 10 μmol upstream primer Fd2591-F and downstream primer Fd2591-R, 0.3 μl 10 mM dNTPs, 1.5 μl 10X PCR buffer, 0.2 μl rTaq, and ddH2O added to bring the reaction system to 20 μl.
5. The application as described in claim 1, characterized in that: The detection of PCR amplification product fragment size indicates that the wheat being tested is susceptible to nitrogen-induced disease if a 204bp product is amplified, and that the wheat being tested is not susceptible to nitrogen-induced disease if a 180bp product is amplified.
6. The application as described in claim 1, characterized in that: With wheat nitrogen-induced susceptibility suppressor gene Ihrl1 Suppressing powdery mildew resistance.