Application of Trichoderma sp. CAU-M23 combined with chicken manure organic fertilizer in promoting wheat growth

Abstract

The present invention discloses Trichoderma CAU-M23 which can cooperate with chicken manure organic fertilizer to promote the growth of wheat, including test materials and inoculation methods. The test materials consist of a spore suspension prepared from the strain Trichoderma longibrachiatum CAU-M23 and chicken manure organic fertilizer. The inoculation method is that in pot experiments and field experiments, the chicken manure organic fertilizer is applied to the soil in the form of basal fertilizer. In pot experiments, Trichoderma CAU-M23 is inoculated by root irrigation, and in the field, Trichoderma CAU-M23 is inoculated by spraying. The present invention uses the CAU-M23 strain to prepare a spore suspension (total number of spores is 1×10<supgt;7< / supgt; cfu / mL), and in combination with the application of chicken manure organic fertilizer. The results of pot experiments and field experiments show that compared with the treatment of only applying chemical fertilizers, only applying chicken manure organic fertilizer or other strains, the application of the present invention can significantly promote the growth of wheat, improve the physical and chemical properties of the soil, optimize the structure of the rhizosphere microbial community, and effectively increase the yield.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial fertilizer preparation, and particularly to the application of a Trichoderma sp. CAU-M23 combined with chicken manure organic fertilizer in promoting wheat growth. Background Art

[0002] According to the data of the Food and Agriculture Organization of the United Nations, chemical fertilizers contribute 40% - 60% to the global food production. However, China uses more than 30% of the global chemical fertilizers on only 7% of the world's arable land. Compared with developed countries, the fertilizer application rate per unit area in China is about twice the safe upper limit.

[0003] Chemical fertilizers are indispensable in agricultural production, but the extensive use of fertilizers has caused problems such as soil compaction, soil acidification, and serious pollution, resulting in low fertilizer utilization efficiency. It is urgent to solve the problems brought by traditional chemical fertilizers. Therefore, in recent years, China has paid more and more attention to the research of green fertilizers such as microbial fertilizers, aiming to reduce the input of chemical fertilizers while increasing China's food production, so as to reduce the ecological pressure caused by excessive application of chemical fertilizers.

[0004] Beneficial microorganisms have many functions, including helping plants obtain nutrients and improving the tolerance of plants to various biotic and abiotic stresses. Beneficial microbial communities have become a key component in promoting soil health and agricultural sustainable development. Trichoderma can significantly promote root development and plant growth, and prevent and control soil-borne pathogens. It is an important agricultural microbial preparation.

[0005] Trichoderma can utilize a variety of organic substances as carbon sources, such as glucose, starch, amino acids, etc. These are all relatively ideal carbon sources for Trichoderma, but the agricultural cost is relatively high. Chicken manure organic fertilizer has a relatively low cost and is widely available in rural areas but has not been reasonably utilized. The combined application of Trichoderma and chicken manure organic fertilizer conforms to the concept of sustainable green development in agriculture. Some studies have shown that the replacement of chemical fertilizers with organic fertilizers has played a good effect in agricultural production. However, there is less research on the application of Trichoderma combined with chicken manure organic fertilizer in wheat production. Summary of the Invention

[0006] The purpose of the present invention is to solve the disadvantages of excessive application of current chemical fertilizers, serious environmental pollution, and low resource utilization rate, and to propose the application of a Trichoderma sp. CAU-M23 combined with chicken manure organic fertilizer in promoting wheat growth, so as to significantly promote the growth of wheat, improve the physical and chemical properties of the soil, optimize the structure of the rhizosphere microbial community, and effectively increase the wheat yield.

[0007] In order to achieve the above purpose, the present invention adopts the following technical scheme:

[0008] Application of a Trichoderma strain CAU-M23 combined with chicken manure organic fertilizer in promoting wheat growth, including: experimental materials, which are composed of a spore suspension prepared from the strain Trichoderma longibrachiatum CAU-M23 and chicken manure organic fertilizer;

[0009] Inoculation method, in which the chicken manure organic fertilizer is applied to the soil as a base fertilizer in both pot experiments and field experiments. In the pot experiment, Trichoderma CAU-M23 is inoculated by root irrigation, and in the field experiment, Trichoderma CAU-M23 is inoculated by spraying.

[0010] After treatment, it significantly promotes the growth of wheat, improves the physical and chemical properties of the soil, optimizes the rhizosphere microbial community structure, and effectively increases the wheat yield.

[0011] As a further technical solution of the present invention, the nucleotide sequence of the 16S rDNA of the strain Trichoderma longibrachiatum CAU-M23 is as shown in SEQ ID NO: 1.

[0012] As a further technical solution of the present invention, the number of spores contained in the spore suspension prepared from the strain Trichoderma longibrachiatum CAU-M23 is 1×10 7 cfu / ml.

[0013] As a further technical solution of the present invention, the preparation method of the spore suspension includes the following steps:

[0014] S1: Inoculate the strain Trichoderma longibrachiatum CAU-M23 on a PDA solid medium, and place it in a 25°C light incubator for 2 days until the Trichoderma covers the entire dish;

[0015] S2: After taking it out, add about 5 ml of sterile water to the medium, scrape the spores with a spreader, and filter them into a sterile triangular flask wrapped with two layers of sterile gauze to obtain a spore suspension. Determine the OD 600 to calculate the concentration of the Trichoderma CAU-M23 spore suspension, calculate the number of spores, so that the number of spores contained is 1×10 7 cfu / ml.

[0016] As a further technical solution of the present invention, the pH of the chicken manure organic fertilizer is 7.53, the organic matter content in the chicken manure organic fertilizer is 452.50 g / kg, and the total nitrogen, total phosphorus, and total potassium contents in the chicken manure organic fertilizer are 28.21 g / kg, 83.42 g / kg, and 4.95 g / kg respectively.

[0017] As a further technical solution of the present invention, the application rate of the chicken manure organic fertilizer in the inoculation method is 20% of the total amount of chemical fertilizers whose nutrient content replaces the plant requirements.

[0018] As a further technical solution of the present invention, in the potting of the inoculation method, the dosage is 20 ml per 2 kg of soil, and the dosage in the field is 5 L per mu. The spore suspension with a spore number of 1×10 7 cfu / ml is diluted 10 times, and 200 ml is irrigated into each pot by root irrigation.

[0019] As a further technical solution of the present invention, the target plant is wheat, which can significantly promote the growth of the plant, improve the physical and chemical properties of the soil, optimize the structure of the rhizosphere microbial community, and effectively increase the yield.

[0020] The beneficial effects of the present invention are as follows: Trichoderma CAU-M23 combined with chicken manure organic fertilizer can promote the growth of wheat, improve the structure of the rhizosphere microbial community, significantly increase the yield of wheat, significantly increase the number of grains per spike of wheat, and the fertilization method of replacing chemical fertilizer with organic fertilizer also improves the utilization rate of fertilizer and promotes soil health. Description of the Drawings

[0021] Figure 1 It is the phylogenetic tree of Trichoderma CAU-M23 strain;

[0022] Figure 2 It is the bar chart of soil nitrate nitrogen content after Trichoderma CAU-M23 combined with chicken manure organic fertilizer treatment in the pot experiment;

[0023] Figure 3 It is the bar chart of wheat rhizosphere fungal diversity in the pot experiment;

[0024] Figure 4 It is the bar chart of the size of wheat flag leaf area after Trichoderma CAU-M23 combined with chicken manure organic fertilizer treatment in the field experiment;

[0025] Figure 5 It is the bar chart of biomass after Trichoderma CAU-M23 combined with chicken manure organic fertilizer treatment during the filling period of wheat in the field experiment;

[0026] Figure 6 It is the bar chart of the number of grains per spike after Trichoderma CAU-M23 combined with chicken manure organic fertilizer treatment at the harvest stage of wheat in the field experiment;

[0027] Figure 7 It is the bar chart of the actual yield after Trichoderma CAU-M23 combined with chicken manure organic fertilizer treatment at the harvest stage of wheat in the field experiment;

[0028] Figure 8 It is the growth status diagram of wheat treated with Trichoderma CAU-M23 combined with chicken manure organic fertilizer;

[0029] Fig. 9 It is the schematic diagram of the medium of Trichoderma CAU-M23. Detailed Embodiments

[0030] In order to make the technical means, creative features, achieved purposes and effects of the present invention easy to understand, the present invention will be further described below in conjunction with specific embodiments.

[0031] It should be noted that unless otherwise specified, the technical terms or scientific terms used in this application should have the ordinary meanings understood by those skilled in the art to which the present invention belongs.

[0032] Application of a Trichoderma strain CAU-M23 combined with chicken manure organic fertilizer in promoting wheat growth, including: test materials, which are composed of a spore suspension prepared from the strain Trichoderma longibrachiatum CAU-M23 and chicken manure organic fertilizer;

[0033] Inoculation method, in which the chicken manure organic fertilizer is applied to the soil in the form of a base fertilizer in both pot experiments and field experiments. In the pot experiment, Trichoderma CAU-M23 is inoculated by root irrigation, and in the field experiment, Trichoderma CAU-M23 is inoculated by spraying.

[0034] In a preferred embodiment, the nucleotide sequence of the 16S rDNA of the strain Trichoderma longibrachiatum CAU-M23 is as shown in SEQ ID NO: 1, specifically ACGGCGGAGTTTCACTCCCAACCCCAATGTGAACGTTACCAATCTGTTGCCTCGGCGGGATTCTCTTGCCCCGGGCGCGTCGCAGCCCCGGATCCCATGGCGCCCGCCGGAGGACCAACTCCAAACTCTTTTTTCTCTCCGTCGCGGCTCCCGTCGCGGCTCTGTTTTATTTTTGCTCTGAGCCTTTCTCGGCGACCCTAGCGGGCGTCTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCCTCACCGGGCCGCCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGGCCACAGCCGTAAAACACCCCAAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAAA。

[0035] In a preferred embodiment, the number of spores contained in the spore suspension prepared from the strain Trichoderma longibrachiatum CAU-M23 is 1×10 7 cfu / ml.

[0036] In a preferred embodiment, the method for preparing the spore suspension comprises the following steps:

[0037] S1: Inoculate the strain Trichoderma longibrachiatum CAU-M23 onto a PDA solid medium and place it in a 25°C light incubator for 2 days until the Trichoderma covers the entire dish;

[0038] S2: After taking it out, add about 5 ml of sterile water to the medium, scrape the spores with a spreader, filter them into a sterile Erlenmeyer flask wrapped with two layers of sterile gauze to obtain a spore suspension, and measure the OD by a hemocytometer or an ELISA reader 600to calculate the number of spores so that the number of spores contained is 1×10 7 cfu / ml.

[0039] In a preferred embodiment, the pH of the chicken manure organic fertilizer is 7.53, the organic matter content in the chicken manure organic fertilizer is 452.50 g / kg, and the total nitrogen, total phosphorus, and total potassium contents in the chicken manure organic fertilizer are 28.21 g / kg, 83.42 g / kg, and 4.95 g / kg, respectively.

[0040] In a preferred embodiment, the application rate of the chicken manure organic fertilizer in the inoculation method is 20% of the total amount of chemical fertilizers whose nutrient content replaces the plant requirements.

[0041] In a preferred embodiment, in the potting, 20 ml is used per 2 kg of soil, and 5 L is used per mu in the field. The spore suspension with a spore number of 1×10 7 cfu / ml is diluted 10 times, and 200 ml is irrigated into each pot.

[0042] In a preferred embodiment, the target plant is wheat, which can significantly promote the growth of the plant, improve the physical and chemical properties of the soil, optimize the rhizosphere microbial community structure, and effectively increase the yield.

[0043] The following is a detailed description of the examples of the application of a Trichoderma strain CAU-M23 in combination with chicken manure organic fertilizer in promoting the growth of wheat according to the present invention. The following examples are only used to more clearly illustrate the application of the present invention, so they are only examples and cannot be used to limit the protection scope of the present invention.

[0044] The CAU-M23 strain is preserved in the China General Microbiological Culture Collection Center, and the preservation number is: CGMCC NO.41241.

[0045] Example 1

[0046] Isolation and biological identification of Trichoderma longibrachiatum Trichoderma longibrachiatum (

[0047] CAU-M23 is a strain preserved in the laboratory. It is isolated by the dilution coating method, sourced from farmland soil, dissolved in 10 mL of sterile water, and this concentration is 10 -1 . 100 μL is taken and diluted with 900 μL of sterile water to 10 -2 , and successively diluted to 10 -3 , 10 -4 , 10 -5 , 10 -6 These 6 concentration gradients. After dilution, 100 μL is taken from the highest to the lowest concentration and placed on PDA medium (10 -1 , 10-2 )、Gau's medium (10 -3 、10 -4 )、LB medium (10 -5 、10 -6 ) were used for spreading, and cultured in an incubator at 28 °C for 3 days. After 3 days, colonies with various different morphologies were separately picked and streaked for purification in the corresponding media. CAU-M23 grew in PDA medium.

[0048] Using the genomic DNA of strain CAU-M23 as a template, 16S rDNA was amplified (the 16S rDNA sequence is shown in SEQ ID NO: 1) and then sequenced. The specific amplification method was as follows: The purified single colony plate was scraped with a pipette gun to obtain Trichoderma, transferred to a sterilized mortar, and repeatedly added with liquid nitrogen for rapid grinding, and then transferred to a 1.5 mL centrifuge tube containing 100 μL of ultrapure water, and pipetted and mixed evenly; Heat-treated in a metal bath at 95 °C for 15 min, immediately placed in a -20 °C refrigerator for freezing treatment for 2 min, and then centrifuged at 14,000 rpm for 3 min. The obtained supernatant was used as a template for PCR amplification; The amplification primers were the fungal universal primers ITS1 (sequence shown in SEQ ID NO: 2: TCCGTAGGTGAACCTGCGG) and ITS4 (sequence shown in SEQ ID NO: 3: TCCTCCGCTTATTGATATGC).

[0049] The amplification system was: a 20 μL PCR reaction system, 10 μL Taq Master Mix, 0.5 μL of forward and reverse primers, 8 μL 2 H₂O and 1 μL of DNA template.

[0050] PCR reaction conditions: Pre-denaturation at 94 °C for 5 min; Denaturation at 94 °C for 1 min, annealing at 55 °C for 1 min, extension at 72 °C for 1 min, 30 cycles; Extension at 72 °C for another 10 min.

[0051] The PCR products were detected by 1.5% agarose gel electrophoresis to determine whether the amplification was successful; The sequences were compared with the Ezbiocloud database. The results showed that the similarity rate between strain CAU-M23 and the related species of Trichoderma longibrachiatum ( Trichoderma longibrachiatum ) reached 99.2%. The phylogenetic tree was constructed using MEGA5.0 software (see Figure 1 ), and it was found that it clustered together with Trichoderma longibrachiatum. Based on this, it was named Trichoderma longibrachiatum ( Trichoderma longibrachiatum ), and the strain number was CAU-M23.

[0052] Example 2

[0053] Pot experiment on the application of Trichoderma CAU-M23 combined with chicken manure organic fertilizer on wheat

[0054] Preparation method of Trichoderma spore suspension: The CAU-M23 strain was inoculated on a PDA solid medium and cultured in a 25°C light incubator for 2 days until Trichoderma covered the entire dish. After taking it out, about 5 ml of sterile water was added to the medium, and the spores were scraped off with a spreader and filtered into a sterile triangular flask wrapped with two layers of sterile gauze to obtain a Trichoderma spore suspension. The Trichoderma spore suspension was obtained, and the number of spores was determined by a hemocytometer or an ELISA reader to measure OD 600 to calculate the number of spores, so that the number of spores contained was 1×10 7 cfu / ml.

[0055] Each pot was filled with 2 kg of soil, and 20 ml of a suspension with a spore quantity of 1×10 7 cfu / ml was applied and diluted 10 times, and 200 ml was irrigated into each pot through the roots.

[0056] 20% of the chemical fertilizer was replaced with chicken manure. The basic physical and chemical properties of the tested chicken manure organic fertilizer were as follows: the pH was 7.53, the organic matter content in the chicken manure organic fertilizer was 452.50 g / kg, and the total nitrogen, total phosphorus, and total potassium contents in the chicken manure organic fertilizer were 28.21 g / kg, 83.42 g / kg, and 4.95 g / kg, respectively. Each pot was filled with 2 kg of soil, and the amount of chicken manure used was about 1.5 g.

[0057] The experiment was carried out using Malan No. 1 wheat seeds. Before the experiment, the seeds were disinfected with a 2% sodium hypochlorite solution for 10 min, washed with sterile water 6 - 8 times, soaked for 8 h, placed in a humid and dark environment for germination for 2 days until the main plumule of the wheat emerged, and 3 wheat plants with the same growth vigor were sown in each pot. This experiment was set with two treatments, with 3 replicates for each treatment, as follows: CK (non-inoculated), CAU-M23 (inoculated with Trichoderma longibrachiatum CAU-M23). The treatment was to irrigate the spore suspension at the wheat roots, and the control was to irrigate the same amount of sterile water at the roots. After 2 weeks of planting, the samples were collected and relevant indicators were recorded. The results are shown in Figure 2 、 Figure 3 and Table 1.

[0058] Table 1. Effects of CAU-M23 combined with chicken manure organic fertilizer on the nitrate nitrogen content in wheat soil and the rhizosphere fungal community structure

[0059]

[0060] From Figure 2 、 Figure 3 and the data in Table 1, it can be seen that the treatment of inoculating Trichoderma longibrachiatum CAU-M23 can improve the physical and chemical properties of the soil, significantly increase the utilization rate of nitrate nitrogen, significantly optimize the rhizosphere fungal community structure, and increase the proportion of dominant bacteria.

[0061] Example 3

[0062] Field Experiment on the Application of Trichoderma CAU-M23 Combined with Chicken Manure Organic Fertilizer in Wheat

[0063] Preparation method of Trichoderma CAU-M23 spore suspension: The CAU-M23 strain was inoculated on PDA solid medium and cultured in a 25°C light incubator for 2 days until Trichoderma covered the entire dish. After taking it out, about 5 ml of sterile water was added to the medium, and the spores were scraped off with a spreading rod and filtered into a sterile Erlenmeyer flask wrapped with two layers of sterile gauze to obtain Trichoderma spore suspension. The number of spores was determined by a hemocytometer or using an enzyme-linked immunosorbent assay (ELISA) reader to measure the optical density (OD) 600 to calculate the number of spores, so that the number of spores contained was 1×10 7 cf / ml.

[0064] The basic physical and chemical properties of the tested chicken manure organic fertilizer were as follows: the pH was 7.53, the organic matter content in the chicken manure organic fertilizer was 452.50 g / kg, and the total nitrogen, total phosphorus, and total potassium contents in the chicken manure organic fertilizer were 28.21 g / kg, 83.42 g / kg, and 4.95 g / kg, respectively.

[0065] The inoculant was applied at the wheat green-reverting stage, only once during the entire growth period, with a dosage of 5 L / acre, and the dosage of chicken manure organic fertilizer was 130 kg / acre

[0066] Test crop: Wheat variety Malan No. 1

[0067] Plot design and treatment: The plot was 8 m long and 4 m wide. CK (non-inoculated) and CAU-M23 (inoculated with Trichoderma longibrachiatum CAU-M23) treatments were set, and each treatment was replicated 3 times. A total of 6 plots were randomly arranged, and the application method was root irrigation.

[0068] Samples were taken at the jointing stage, filling stage, and harvesting stage of wheat to measure the wheat biomass, flag leaf area, actual yield, and yield influencing factors. The relevant results are as Figure 4 , Figure 5 , Figure 6 , Figure 7 , Figure 8 and shown in Table 2.

[0069] Table 2. Effects of CAU-M23 combined with chicken manure organic fertilizer on wheat biomass, flag leaf area, actual yield, and grain number per spike

[0070]

[0071] From Figure 4 , Figure 5 , Figure 6 , Figure 7 , Figure 8It can be seen from the data in Table 2 that inoculating with Trichoderma longibrachiatum CAU-M23 can significantly increase the biomass of wheat, enlarge the leaf area of the flag leaf, and achieve a significant increase in yield by increasing the number of grains per spike, which is a yield factor.

[0072] Those of ordinary skill in the art should understand that the discussion of any above embodiment is only exemplary and is not intended to imply that the scope of the present invention (including the claims) is limited to these examples; under the concept of the present invention, the technical features in the above embodiments or different embodiments can also be combined, the steps can be implemented in any order, and there are many other variations in different aspects of the present invention as described above, and they are not provided in detail for the sake of brevity.

[0073] The present invention aims to cover all such substitutions, modifications, and variations that fall within the broad scope of the claims. Therefore, any omissions, modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. A long-branched Trichoderma ( Trichoderma longibrachiatum )CAU-M23, its accession number is: CGMCC NO.41241.

2. The application of the long-branch Trichoderma CAU-M23 combined with chicken manure organic fertilizer in promoting wheat growth according to claim 1, characterized in that: include: The test material is composed of a spore suspension made from the strain Trichoderma longibrachiata CAU-M23 and chicken manure organic fertilizer; The inoculation method is as follows: in pot test and field test, chicken manure organic fertilizer is applied to the soil in the form of base fertilizer, Trichoderma CAU-M23 is inoculated by root irrigation in pot test, and Trichoderma CAU-M23 is inoculated by spraying in field test.

3. The application of the long-branch Trichoderma CAU-M23 combined with chicken manure organic fertilizer in promoting wheat growth according to claim 2 is characterized in that: The nucleotide sequence of 16S rDNA of the strain Trichoderma longibrachiatum CAU-M23 is shown in SEQ ID NO:

1.

4. The application of the long-branch Trichoderma CAU-M23 combined with chicken manure organic fertilizer in promoting wheat growth according to claim 3 is characterized in that: The spore suspension prepared by the strain Trichoderma longifolia CAU-M23 contains 1×10 7 cfu / mL.

5. The application of the long-branch Trichoderma CAU-M23 combined with chicken manure organic fertilizer in promoting wheat growth according to claim 2, characterized in that: The preparation method of the spore suspension comprises the following steps: S1: Inoculate the strain Trichoderma longibrachiata CAU-M23 on PDA solid medium and culture it in a 25℃ light incubator for 2 days until the Trichoderma grows all over the plate; S2: After taking out, add about 5 mL of sterile water to the culture medium, scrape off the spores with a coating stick, filter into a sterile triangular flask wrapped with two layers of sterile gauze to obtain a spore suspension, and measure the OD using a hemocytometer or an ELISA reader. 600 To calculate the number of spores, the number of spores contained is 1×10 7 cfu / mL.

6. The application of the long-branch Trichoderma CAU-M23 combined with chicken manure organic fertilizer in promoting wheat growth according to claim 2, characterized in that: The pH value of the chicken manure organic fertilizer is 7.53, the organic matter content in the chicken manure organic fertilizer is 452.50 g / kg, and the total nitrogen, total phosphorus and total potassium contents in the chicken manure organic fertilizer are 28.21 g / kg, 83.42 g / kg and 4.95 g / kg respectively.

7. The application of the long-branch Trichoderma CAU-M23 combined with chicken manure organic fertilizer in promoting wheat growth according to claim 2, characterized in that: The number of spores applied per 2 kg of soil in the potted plant in the inoculation method is 1×10 7 cfu / mL suspension 20 mL, the spore count was 1×10 7 The spore suspension of cfu / mL was diluted 10 times and 200 ml was applied to each pot for root irrigation.

8. The application of the long-branch Trichoderma CAU-M23 combined with chicken manure organic fertilizer in promoting wheat growth according to claim 2, characterized in that: The affected plant is Wheat Malan No. 1, which can significantly promote plant growth, improve soil physical and chemical properties, optimize the structure of rhizosphere microbial communities, and effectively increase yields.

Images