A primer set for detecting bacterial strain drug-resistant enzyme genes, typing detection method and kit

By extracting DNA through the magnetic bead method and designing specific primer sets for PCR amplification, the problems of the complexity of traditional enzyme typing and identification methods and the susceptibility of PCR to contamination are solved, and efficient and accurate enzyme gene typing detection is achieved, supporting the development of new antibiotics and clinical use.

CN118581243BActive Publication Date: 2025-09-12NANJING CANCHEN MICROBIAL TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410758303.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-13
Publication Date
2025-09-12
Estimated Expiration
2044-06-13

AI Technical Summary

Technical Problem

Traditional enzyme typing and identification methods are complex, time-consuming, and prone to contamination, while PCR methods are susceptible to environmental interference and are costly, resulting in low experimental efficiency and poor accuracy.

Method used

The magnetic bead method was used to extract genomic DNA, and a specific primer set was designed for PCR amplification. Combined with agarose gel electrophoresis and sequencing analysis, the experimental process was simplified, the DNA extraction efficiency and purity were improved, and the accuracy of PCR was optimized.

Benefits of technology

It simplifies the experimental steps, reduces costs, improves experimental efficiency and accuracy, and provides a scientific basis for the development of new antibiotics and clinical use.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118581243B_ABST
    Figure CN118581243B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of microbiology and genetics technology, and in particular relates to a primer set and typing detection method and kit for detecting drug-resistant enzyme genes of bacterial strains, wherein the primer set is an amplification primer for β-lactamase-resistant genes and carbapenemase-resistant genes, wherein the β-lactamase-resistant genes include SHV, TEM, and CTX-M, and the carbapenemase-resistant genes include NDM, OXA-23, and KPC. PCR amplification is performed according to specific enzyme typing primers, and genomic DNA is extracted using a magnetic bead method to improve the efficiency and purity of DNA extraction, thereby optimizing the accuracy and efficiency of PCR. The specific enzyme typing results are confirmed by comparison with the NCBI database through agarose gel electrophoresis and subsequent sequencing analysis. The experimental process is simplified, the cost is reduced, and a scientific basis is provided for the screening and clinical use of new β-lactamase and carbapenemase inhibitors, with the advantages of high efficiency, accuracy, and cost-effectiveness.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of microbiology and genetics, and in particular relates to a primer set for detecting drug-resistant enzyme genes of bacterial strains, a typing detection method and a kit. Background Art

[0002] In the fields of microbiology and genetics, enzyme typing is a crucial technology. It not only determines the genetic variation and relationship of bacterial strains, but also is a key way to identify bacterial resistance to specific antibiotics. Traditional enzyme typing methods involve multiple steps, including DNA extraction, amplification, and analysis.

[0003] Traditional DNA extraction methods, such as the phenol-chloroform method and column purification, while widely used, suffer from drawbacks such as complexity, time-consuming procedures, and the potential for sample contamination. In contrast, the magnetic bead method has become a mainstream technology for nucleic acid extraction due to its high efficiency, high purity, and wide applicability. The magnetic bead method leverages the unique affinity of magnetic beads for nucleic acids, using magnetic separation technology to rapidly and efficiently extract nucleic acids, greatly simplifying experimental procedures and improving nucleic acid quality.

[0004] The subsequent PCR method is the gold standard technology for detecting enzyme genotyping. It is widely used for gene amplification due to its high specificity and sensitivity. However, the traditional PCR method requires complex operating procedures, is easily interfered by environmental pollutants, and is relatively expensive. With the continuous advancement of technology, new developments in modern biotechnology and molecular biology have provided new directions for the improvement of PCR methods. For example, in terms of primer design, precise bioinformatics tools can be used to predict and select optimal primers to improve the specificity and efficiency of PCR reactions. At the same time, the application of whole-genome sequencing technology can provide comprehensive genetic information for the accurate identification of enzyme genes. The combination of high-throughput sample processing platforms and high-fidelity PCR technology can speed up sample processing, reduce the risk of cross-contamination, and improve the accuracy of PCR amplification.

[0005] By combining efficient genomic DNA extraction techniques with novel primer design strategies, experimental cycles can be significantly shortened, costs reduced, and data reliability and accuracy improved. These optimized enzymatic genotyping methods are not only of great significance in bacteriological research but are also expected to play a significant role in personalized medicine, antibiotic development, and clinical medication guidance. Therefore, continuously optimizing and refining genotyping methods, combined with the latest biotechnology advances, will bring broader prospects and opportunities to research and applications in microbiology and genetics. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the present invention provides a primer set, typing detection method, and kit for detecting bacterial strain resistance enzyme genes. PCR amplification is performed using specific enzyme typing primers, and genomic DNA is extracted using a magnetic bead method to improve the efficiency and purity of DNA extraction, thereby optimizing the accuracy and efficiency of PCR. The specific enzyme typing results are confirmed by agarose gel electrophoresis and subsequent sequencing analysis, and compared with the NCBI database. This simplifies the experimental process, reduces costs, and provides a scientific basis for the screening and clinical use of new β-lactamase and carbapenemase inhibitors, with the advantages of high efficiency, accuracy, and cost-effectiveness.

[0007] The technical solution provided by the present invention is as follows:

[0008] The present invention provides a primer set for detecting drug-resistant enzyme genes of bacterial strains, characterized in that the primer set is amplification primers for β-lactamase-resistant genes and carbapenemase-resistant genes, the β-lactamase-resistant genes include SHV, TEM and CTX-M, and the carbapenemase-resistant genes include NDM, OXA-23 and KPC;

[0009] The primers for amplifying the SHV in the β-lactamase-resistant gene include SHV-F and SHV-R, the nucleotide sequence of the SHV-F is shown in SEQ ID NO.1, and the nucleotide sequence of the SHV-R is shown in SEQ ID NO.2;

[0010] The primers for amplifying TEM in the β-lactamase-resistant gene include TEM-F and TEM-R, the nucleotide sequence of the TEM-F is shown in SEQ ID NO.3, and the nucleotide sequence of the TEM-R is shown in SEQ ID NO.4;

[0011] The primers for amplifying CTX-M in the β-lactamase resistance gene include CTX-MF and CTX-MR, the nucleotide sequence of CTX-MF is shown in SEQ ID NO.5, and the nucleotide sequence of CTX-MR is shown in SEQ ID NO.6;

[0012] The primers for amplifying NDM in the carbapenemase-resistant gene include NDM-F and NDM-R, the nucleotide sequence of NDM-F is shown in SEQ ID NO.7, and the nucleotide sequence of NDM-R is shown in SEQ ID NO.8;

[0013] Primers for amplifying OXA-23 in the carbapenemase-resistant gene include OXA-23-F and OXA-23-R, the nucleotide sequence of OXA-23-F is shown in SEQ ID NO.9, and the nucleotide sequence of OXA-23-R is shown in SEQ ID NO.10;

[0014] The primers for amplifying KPC in the carbapenemase-resistant gene include KPC-F and KPC-R. The nucleotide sequence of KPC-F is shown in SEQ ID NO.11, and the nucleotide sequence of KPC-R is shown in SEQ ID NO.12.

[0015] Specifically, the nucleotide sequences of SHV, TEM, CTX-M, NDM, OXA-23, and KPC are as follows:

[0016] SHV-F2: 5'-CGCCTGTGTATTATCTCCCTGT-3' (SEQ ID NO. 1),

[0017] SHV-R2: 5'-TTTGTTATTCGGGCCAAGCAG-3' (SEQ ID NO. 2);

[0018] TEM-F2: 5'-CGTGTCGCCCTTATTCCCTT-3' (SEQ ID NO.3),

[0019] TEM-R2: 5'-GCTCACCGGCTCCAGATT-3' (SEQ ID NO.4);

[0020] CTX-M-F2: 5'-ACGCTTTCCAATGTGCAGT-3' (SEQ ID NO.5),

[0021] CTX-M-R2: 5'-CAAAACCAGTTACAGCCCTTC-3' (SEQ ID NO. 6);

[0022] NDM-F: 5'-GCATTAGCCGCTGCATTGAT-3' (SEQ ID NO.7),

[0023] NDM-R: 5'-GCCGTATGAGTGATTGCGG-3' (SEQ ID NO. 8);

[0024] OXA-23-F: 5'-ATGCCCTGATCGGATTGGAG-3' (SEQ ID NO.9),

[0025] OXA-23-R: 5'-CGGCATTTCTGACCGCATTT-3' (SEQ ID NO. 10);

[0026] KPC-F2: 5'-TTGCTGCACACCCATCC-3' (SEQ ID NO. 11),

[0027] KPC-R2: 5'-AGCCTTACTGCCCGTTGAC-3' (SEQ ID NO. 12).

[0028] The present invention also provides a method for detecting bacterial strain resistance enzyme genotyping for non-diagnostic purposes, comprising the following steps:

[0029] S1, extract genomic DNA of the strain to be tested using a magnetic bead kit;

[0030] S2, using the DNA of the strain to be detected extracted in S1 as a template, and using the primer combination according to claim 1 to perform PCR amplification on the target gene of the strain to be detected;

[0031] S3, detecting the amplified products obtained in S2 by gel electrophoresis to identify the drug resistance gene detection results;

[0032] S4, performing nucleic acid sequence determination on the amplified products after drug resistance gene detection in S3;

[0033] S5, performing sequence comparison analysis on the target gene sequence determined in S4 and the enzyme type standard sequence corresponding to the target gene to determine the specific genotype of the target gene.

[0034] Furthermore, the magnetic bead kit includes a lysis solution, magnetic beads, an adsorption buffer, a washing solution, and an eluent;

[0035] The bacterial lysate consists of a final concentration of 0.1 wt% SDS, a final concentration of 0.5 wt% Triton-100, and a final concentration of 0.5 wt% β-mercaptoethanol, with a pH of 7;

[0036] The adsorption buffer consists of guanidine hydrochloride with a final concentration of 4 mol / L, sodium chloride with a final concentration of 800 mmol / L, sodium citrate with a final concentration of 200 mmol / L, EDTA with a final concentration of 1 mmol / L, and isopropanol with a final concentration of 75 wt%;

[0037] The washing liquid is an ethanol solution with a concentration of 70wt%;

[0038] The eluent consists of Tris-HCl at a final concentration of 10 mmol / L and EDTA at a final concentration of 1 mmol / L.

[0039] Furthermore, the reaction system for PCR amplification in step S2 includes:

[0040] 1 μL of genomic DNA, 25 μL of 2× Taq Plus Master Mix (Dye Plus), 2 μL of upstream primer, 2 μL of downstream primer, and ultrapure water were added to 50 μL.

[0041] Furthermore, the procedure of PCR amplification in step S2 is as follows:

[0042] Pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 55°C for 1 min, extension at 72°C for 5 min were performed for 30 cycles, and the final extension was at 72°C for 5 min.

[0043] Furthermore, the identification of the drug resistance gene detection results includes:

[0044] 5 μL of PCR product was subjected to 1% agarose gel electrophoresis containing nucleic acid dye at 120 V for 20 min and observed under ultraviolet light. DNA size markers were used for comparison using molecular weight markers at 100 bp intervals, 738 bp, 694 bp, 685 bp, 743 bp, 512 bp, and 545 bp, indicating SHV, TEM, CTX-M, NDM, OXA-23, and KPC, respectively.

[0045] Furthermore, the strain to be detected is selected from at least one of Escherichia coli, Acinetobacter baumannii, Enterobacter cloacae, and Klebsiella pneumoniae.

[0046] The present invention also provides a kit for detecting bacterial strain drug-resistant enzyme genes, which comprises the primer set for detecting bacterial strain drug-resistant enzyme genes according to claim 1.

[0047] Furthermore, the primer concentration in the kit is 10 μmol / L.

[0048] Furthermore, it also includes detection reagents and nucleic acid extraction reagents.

[0049] Beneficial effects

[0050] (1) Improved efficiency and accuracy: By using the magnetic bead method to extract DNA, the present invention greatly simplifies the DNA extraction process and improves the purity and quality of the DNA, which helps to improve the efficiency and accuracy of subsequent PCR amplification.

[0051] (2) Reduce experimental costs: The magnetic bead method is more efficient than traditional DNA extraction methods such as the phenol-chloroform method, reducing the use of consumables and reagents, thereby reducing the overall experimental costs.

[0052] (3) High efficiency and fast speed: Optimized PCR amplification conditions and simplified DNA extraction methods greatly shorten the experimental time and improve experimental efficiency.

[0053] (4) Provide a basis for the development of new antibiotics and clinical medication guidance: Accurate and rapid enzyme typing identification helps provide a basis for the development of new antibiotics and clinical medication guidance, and improve the effectiveness and safety of antibiotic treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 This is the result of NCBI Primer-BLAST of the candidate primer SHV-F1 / R1 in Example 2 of the present invention.

[0055] Figure 2 This is the result of NCBI Primer-BLAST of the candidate primer SHV-F2 / R2 in Example 2 of the present invention.

[0056] Figure 3 This is an agarose gel electrophoresis diagram (738 bp) of the SHV gene detected in Klebsiella pneumoniae in Example 2 of the present invention.

[0057] Figure 4 This is the result of NCBI Primer-BLAST of the candidate primer TEM-F1 / R1 in Example 3 of the present invention.

[0058] Figure 5 This is the result of NCBI Primer-BLAST of the candidate primer TEM-F2 / R2 in Example 3 of the present invention.

[0059] Figure 6 This is an agarose gel electrophoresis diagram (694 bp) of the TEM gene detected in Klebsiella pneumoniae in Example 3 of the present invention.

[0060] Figure 7 This is the result of NCBI Primer-BLAST of the candidate primer CTX-M-F1 / R1 in Example 4 of the present invention.

[0061] Figure 8 This is the result of NCBI Primer-BLAST of the candidate primer CTX-M-F2 / R2 in Example 4 of the present invention.

[0062] Figure 9 This is an agarose gel electrophoresis diagram (685 bp) of the CTX-M gene detected in Klebsiella pneumoniae in Example 4 of the present invention.

[0063] Figure 10 This is an agarose gel electrophoresis diagram (743 bp) of the NDM gene detected in Escherichia coli, Acinetobacter baumannii and Enterobacter cloacae in Example 5 of the present invention.

[0064] Figure 11 This is an agarose gel electrophoresis diagram (512 bp) of the OXA-23 gene detected in Acinetobacter baumannii in Example 6 of the present invention.

[0065] Figure 12This is the result of NCBI Primer-BLAST of the candidate primer KPC-F1 / R1 in Example 7 of the present invention.

[0066] Figure 13 This is the result of NCBI Primer-BLAST of the candidate primer KPC-F2 / R2 in Example 7 of the present invention.

[0067] Figure 14 This is an agarose gel electrophoresis diagram (545 bp) of the KPC gene detected in Klebsiella pneumoniae in Example 7 of the present invention. DETAILED DESCRIPTION

[0068] Example 1

[0069] 1. Screening of Guanidine Hydrochloride Content

[0070] (1) Materials:

[0071] Clinical strains: Escherichia coli, Acinetobacter baumannii and Enterobacter cloacae were collected from Nanfang Hospital of Southern Medical University.

[0072] Bacterial suspension: composed of Tris-HCl at a final concentration of 10 mmol / L and EDTA at a final concentration of 1 mmol / L.

[0073] Bacterial lysis solution: composed of a final concentration of 0.1 wt% SDS, a final concentration of 0.5 wt% Triton-100 and a final concentration of 0.5 wt% β-mercaptoethanol, with a pH of 4-7.

[0074] Adsorption buffer: composed of guanidine hydrochloride with a final concentration of 4-8 mol / L, sodium chloride with a final concentration of 800 mmol / L, sodium citrate with a final concentration of 200 mmol / L, EDTA with a final concentration of 1 mmol / L, and isopropanol with a final concentration of 75 wt%.

[0075] Washing liquid: 70wt% ethanol solution.

[0076] Elution buffer: composed of Tris-HCl at a final concentration of 10 mmol / L and EDTA at a final concentration of 1 mmol / L.

[0077] Sterile water or TE buffer.

[0078] (2) Strain culture: Clinical strains collected from Nanfang Hospital of Southern Medical University, including Escherichia coli, Acinetobacter baumannii and Enterobacter cloacae. Weigh 33g of nutrient agar medium solid powder, dissolve it in 1L of ultrapure water, sterilize it at 121℃ for 15min, and prepare nutrient agar medium for later use. Pipette 30μL of the frozen solution and inoculate it on the nutrient agar slant. Incubate it at 37℃ for 16-24h to complete activation. Inoculate the clinical strains into a suitable culture medium and culture it until the logarithmic growth phase (about 16-18h).

[0079] (3) Bacteria collection: Collect the bacteria, centrifuge at 10,000 rpm for 5 min, discard the supernatant, and evenly disperse the bacteria at the bottom of the centrifuge tube with bacterial suspension.

[0080] (4) Lysis: Add 600 μL of lysis buffer to resuspend the cells, mix thoroughly, and incubate at 65°C for 30 min.

[0081] (5) Magnetic bead adsorption: Add 200 μL of magnetic bead adsorption buffer, mix well, and incubate at room temperature for 10 min.

[0082] (6) Washing: Wash the beads with 70% ethanol, centrifuge at 10,000 rpm for 30 seconds, and discard the supernatant. Repeat this step twice.

[0083] (7) Elution: Add 100 μL of elution buffer to elute the DNA on the magnetic beads, centrifuge at 10,000 rpm for 1 min, and collect the supernatant, which is the purified strain genomic DNA.

[0084] The yield and purity of the DNA purified using this method are shown in the following table:

[0085] Table 1

[0086]

[0087] The results are shown in Table 1. The adsorption buffer contained 4 mol / L guanidine hydrochloride, which resulted in high DNA concentration and purity, without contamination by proteins, etc. As the guanidine hydrochloride concentration increased, both the DNA concentration and purity values ​​decreased. Under normal circumstances, a moderate guanidine hydrochloride concentration can improve the binding efficiency of DNA to magnetic beads. However, an increase in the guanidine hydrochloride concentration may cause an increase in the number of proteins and other organic molecules nonspecifically adsorbed on the surface of the magnetic beads. These nonspecifically bound impurities may not be completely removed in the subsequent washing steps, resulting in a decrease in the purity of the obtained DNA.

[0088] 2. Screening of pH of bacterial lysate

[0089] (1) Materials:

[0090] Clinical strains: collected from Nanfang Hospital of Southern Medical University, including Escherichia coli, Acinetobacter baumannii and Enterobacter cloacae.

[0091] Other materials are the same as above.

[0092] (2) Strain culture: Clinical strains collected from Nanfang Hospital of Southern Medical University, including Escherichia coli, Acinetobacter baumannii and Enterobacter cloacae. Weigh 33g of nutrient agar medium solid powder, dissolve it in 1L of ultrapure water, sterilize it at 121℃ for 15min, and prepare nutrient agar medium for later use. Pipette 30μL of the frozen solution and inoculate it on the nutrient agar slant. Incubate it at 37℃ for 16-24h to complete activation. Inoculate the clinical strains into a suitable culture medium and culture it until the logarithmic growth phase (about 16-18h).

[0093] (3) Bacteria collection: Collect the bacteria, centrifuge at 10,000 rpm for 5 min, and discard the supernatant.

[0094] (4) Lysis: Add 600 μL of lysis buffer to resuspend the cells, mix thoroughly, and incubate at 65°C for 30 min.

[0095] (5) Magnetic bead adsorption: Add 200 μL of magnetic beads, mix well, and incubate at room temperature for 10 min.

[0096] (6) Washing: Wash the beads with 70% ethanol, centrifuge at 10,000 rpm for 30 seconds, and discard the supernatant. Repeat this step twice.

[0097] (7) Elution: Add 100 μL of elution buffer to elute the DNA on the magnetic beads, centrifuge at 10,000 rpm for 1 min, and collect the supernatant, which is the purified strain genomic DNA.

[0098] The yield and purity of the DNA purified using this method are shown in the following table:

[0099] Table 2

[0100]

[0101]

[0102] The results are shown in Table 2. At a lysis buffer pH of 6, the DNA concentration was 83 ng / μl and the A260 / 280 ratio was 1.7734. At a lysis buffer pH of 7, the DNA concentration was 86 ng / μl and the A260 / 280 ratio was 1.7986. The DNA was highly pure and free of protein contamination. This indicates that for Gram-negative bacteria such as Escherichia coli, Acinetobacter baumannii, and Enterobacter cloacae, the optimal lysis buffer pH range is between 6 and 7. Within this pH range, DNA molecules are relatively stable, protein degradation efficiency is high, and the adsorption efficiency of magnetic beads to DNA molecules is optimal.

[0103] Example 2 (Identification of SHV enzyme type of strain)

[0104] (1) Search the SHV gene sequence on NCBI and select two upstream and downstream sequences on the gene as primers so that the amplified fragments cover the mutation sites of various common types as much as possible. The specific primer designs are as follows:

[0105] SHV-F1: 5'-TTAAAACTAAGCGAAAGCCAGCT-3' (SEQ ID NO.13),

[0106] SHV-R1: 5'-TTTGTTATTCGGGCCAAGCAG-3' (SEQ ID NO. 14);

[0107] SHV-F2: 5'-CGCCTGTGTATTATCTCCCTGT-3' (SEQ ID NO.1),

[0108] SHV-R2: 5'-TTTGTTATTCGGGCCAAGCAG-3' (SEQ ID NO. 2).

[0109] The primers were predicted by NCBI Primer-BLAST, and the results were as follows Figure 1 、 Figure 2 As shown, there is a large difference in GC% between the upstream and downstream primers of the first pair of primers, and the 3' self-complementary score of the upstream primer is 4. However, the Tm values ​​and GC% of the upstream and downstream primers of the second pair of primers are close, and the 3' self-complementary score of the upstream primer is 0, so the second pair of primers is selected.

[0110] (2) Extraction of bacterial genomic DNA

[0111] ① Strain culture: Clinical strains collected from Nanfang Hospital of Southern Medical University, including 60 strains of Klebsiella pneumoniae. Weigh 33 g of nutrient agar solid powder and dissolve it in 1 L of ultrapure water. Sterilize at 121°C for 15 minutes to prepare nutrient agar medium for later use. Aspirate 30 μL of the frozen solution and inoculate it onto a nutrient agar slant. Incubate at 37°C for 16–24 hours to activate the culture. Inoculate the clinical strains into an appropriate culture medium and culture until the logarithmic growth phase (approximately 16–18 hours).

[0112] ② Bacteria collection: Collect bacteria, centrifuge at 10000 rpm for 5 min, and discard the supernatant.

[0113] ③ Lysis: Add 600 μL of lysis buffer to resuspend the bacteria, mix thoroughly, and incubate at 65°C for 30 min.

[0114] ④ Magnetic bead adsorption: Add 200 μL of magnetic beads, mix well, and incubate at room temperature for 10 min.

[0115] ⑤ Wash: Wash the beads with 70% ethanol, centrifuge at 10,000 rpm for 30 seconds, and discard the supernatant. Repeat this step twice.

[0116] ⑥ Elution: Add 100 μL of elution buffer to elute the DNA on the magnetic beads, centrifuge at 10,000 rpm for 1 min, and collect the supernatant, which is the purified strain genomic DNA.

[0117] (3)PCR

[0118] ① PCR system: 1 μL of genomic DNA, 25 μL of 2× Taq Plus Master Mix (Dye Plus), 2 μL of upstream primer, 2 μL of downstream primer, and add ultrapure water to 50 μL.

[0119] ②PCR conditions: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 55°C for 1 min, extension at 72°C for 5 min, 30 cycles, final extension at 72°C for 5 min.

[0120] (4) Agarose gel electrophoresis

[0121] ① Weigh about 0.5g agarose, add 50mL TAE solution, and heat in a microwave oven until the solution is clear. After cooling to 55℃, add 4μL nucleic acid dye, mix well, pour into the template slot, insert the comb teeth, and let it stand until it solidifies.

[0122] ② Load the PCR product into the well at a volume of 5 μL. Simultaneously, add a marker.

[0123] ③ Fill the electrophoresis tank with electrophoresis solution (TAE solution) and place the gel in it. Run the gel at 120V for 20 minutes.

[0124] ④ Place the gel in a gel imager and examine it at 302 nm to observe and record the DNA bands.

[0125] (5) Sequencing and comparison with the NCBI database to confirm the specific typing.

[0126] After comparison with the NCBI database, the sequence of some strains was identified as broad-spectrum class Abeta-lactamase SHV-11, sharing 99% similarity with the reference sequence NG_050000.1.

[0127] Sequence SHV-11:

[0128] CGCCTGTGTATTATCTCCCTGTTAGCCACCCTGCCGCTGGCGGTACACGCCAGCCCGCAGCCGCTTGAGCAAATTAAACAAAGCGAAAGCCAGCTGTCGGGCCGCGTAGGCATGATAGAAATGGATCTGGCCAGCGGCCGCACGCTGACCGCCTGGCGCGCCGATGAACGCTTTCCCATGATGAGCACCTTTAAAGTAGTGCTCTGCGGCGCAGTGCTGGCGCGGGTGGATGCCGGTGACGAACAGCTGGAGCGAAAGATCCACTATCGCCAGCAGGATCTGGTGGACTACTCGCCGGTCAGCGAAAAACATCTTGCCGACGGCATGACGGTCGGCGAACTCTGCGCCGCCGCCATTACCATGAGCGATAACAGCGCCGCCAATCTGCTGCTGGCCACCGTCGGCGGCCCCGCAGGATTGACTGCCTTTTTGCGCCAGATCGGCGACAACGTCACCCGCCTTGACCGCTGGGAAACGGAACTGAATGAGGCGCTTCCCGGCGACGCCCGCGACACCACTACCCCGGCCAGCATGGCCGCGACCCTGCGCAAGCTGCTGACCAGCCAGCGTCTGAGCGCCCGTTCGCAACGGCAGCTGCTGCAGTGGATGGTGGACGATCGGGTCGCCGGACCGTTGATCCGCTCCGTGCTGCCGGCGGGCTGGTTTATCGCCGATAAGACCGGAGCTGGCGAGCGGGGTGCGCGCGGGATTGTCGCCCTGCTTGGCCCGAATAACAAA

[0129] After alignment with the NCBI database, the sequence identification results of some strains were extended-spectrum class A beta-lactamase SHV-18, sharing 99% similarity with the reference sequence GenBank: NG_050047.1.

[0130] Sequence SHV-18:

[0131] GCCTGTGTATTATCTCCCTGTTAGCCACCCTGCCGCTGGCGGTACACGCCAGCCCGCAGCCGCTTGAGCAAATTAAACTAAGCGAAAGCCAGCTGTCGGGCAGCGTAGGCATGATAGAAATGGATCTGGCCAGCGGCCGCACGCTGACCGCCTGGCGCGCCGATGAACGCTTTCCCATGATGAG CACCTTTAAAGTAGTGCTCTGCGGCGCAGTGCTGGCGCGGGTGGATGCCGGTGACGAACAGCTGGAGCGAAAGATCCACTATCGCCAGCAGGATCTGGTGGACTACTCGCCGGTCAGCGAAAAACACCTTGCCGACGGCATGACGGTCGGCGAACTCTGTGCCGCCGCCATTACCATGAGCGAT AACAGCGCCGCCAATCTGCTGCTGGCCACCGTCGGCGGCCCCGCAGGATTGACTGCCTTTTTGCGCCAGATCGGCGACAACGTCACCCGCCTTGACCGCTGGGAAACGGAACTGAATGAGGCGCTTCCCGGCGACGCCCGCGACACCACTACCCCGGCCAGCATGGCCGCGACCCTGCGCAAGC TGCTGACCAGCCAGCGTCTGAGCGCCCGTTCGCAACGGCAGCTGCTGCAGTGGATGGTGGACGATCGGGTCGCCGGACCGTTGATCCGCTCCGTGCTGCCGGCGGGCTGGTTTATCGCCGATAAGACCGGAGCTGCCAAACGGGGTGCGCGCGGGATTGTCGCCCTGCTTGGCCCGAATAACAAA

[0132] Agarose gel electrophoresis results Figure 3 As shown, the sample added to each well (1-60) contains PCR products corresponding to 60 strains of Klebsiella pneumoniae. The results show clear, single DNA bands of the target gene with the correct band pattern, appearing at the expected position. This demonstrates that this method has high accuracy and good specificity, effectively enabling the screening and identification of target genes. Furthermore, the absence of nonspecific band contamination in the electrophoresis pattern further demonstrates the reliability and stability of this method. This result confirms the correctness of the experimental design and operation, enabling the screening of target genes.

[0133] Example 3

[0134] (1) Search the TEM gene sequence on NCBI and select two upstream and downstream sequences on the gene as primers so that the amplified fragments cover the mutation sites of various common types as much as possible. The specific primers are designed as follows:

[0135] TEM-F1: 5'-ATGCTGAAGATCAGTTGGGT-3' (SEQ ID NO.15),

[0136] TEM-R1: 5'-ATCAGCAATAAACCAGCCAGC-3' (SEQ ID NO. 16);

[0137] TEM-F2: 5'-CGTGTCGCCCTTATTCCCTT-3' (SEQ ID NO.3),

[0138] TEM-R2: 5'-GCTCACCGGCTCCAGATT-3' (SEQ ID NO. 4).

[0139] The primers were predicted by NCBI Primer-BLAST, and the results were as follows Figure 4 、 Figure 5 As shown, there is a large difference in the Tm values ​​of the upstream and downstream primers of the first pair of primers. The self-complementarity score of the upstream primer is 5, while the Tm values ​​and GC% of the upstream and downstream primers of the second pair of primers are close, so the second pair of primers is selected.

[0140] (2) Extraction of bacterial genomic DNA

[0141] ① Strain culture: Clinical strains collected from Nanfang Hospital of Southern Medical University, including 60 strains of Klebsiella pneumoniae. Weigh 33 g of nutrient agar solid powder and dissolve it in 1 L of ultrapure water. Sterilize at 121°C for 15 minutes to prepare nutrient agar medium for later use. Aspirate 30 μL of the frozen solution and inoculate it onto a nutrient agar slant. Incubate at 37°C for 16–24 hours to activate the culture. Inoculate the clinical strains into an appropriate culture medium and culture until the logarithmic growth phase (approximately 16–18 hours).

[0142] ② Bacteria collection: Collect bacteria, centrifuge at 10000 rpm for 5 min, and discard the supernatant.

[0143] ③ Lysis: Add 600 μL of lysis buffer to resuspend the bacteria, mix thoroughly, and incubate at 65°C for 30 min.

[0144] ④ Magnetic bead adsorption: Add 200 μL of magnetic beads, mix well, and incubate at room temperature for 10 min.

[0145] ⑤ Wash: Wash the beads with 70% ethanol, centrifuge at 10,000 rpm for 30 seconds, and discard the supernatant. Repeat this step once. Wash the beads with washing solution, centrifuge at 10,000 rpm for 30 seconds, and discard the supernatant. Repeat this step twice.

[0146] ⑥ Elution: Add 100 μL of elution buffer to elute the DNA on the magnetic beads, centrifuge at 10,000 rpm for 1 min, and collect the supernatant, which is the purified strain genomic DNA.

[0147] (3)PCR

[0148] ① PCR system: 1 μL of genomic DNA, 25 μL of 2× Taq Plus Master Mix (Dye Plus), 2 μL of upstream primer, 2 μL of downstream primer, and add ultrapure water to 50 μL.

[0149] ②PCR conditions: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 55°C for 1 min, extension at 72°C for 5 min, 30 cycles, final extension at 72°C for 5 min.

[0150] (4) Agarose gel electrophoresis

[0151] ① Weigh about 0.5g agarose, add 50mL TAE solution, and heat in a microwave oven until the solution is clear. After cooling to 55℃, add 4μL nucleic acid dye, mix well, pour into the template slot, insert the comb teeth, and let it stand until it solidifies.

[0152] ② Load the PCR product into the well at a volume of 5 μL. Simultaneously, add a marker.

[0153] ③ Fill the electrophoresis tank with electrophoresis solution (TAE solution) and place the gel in it. Run the gel at 120V for 20 minutes.

[0154] (5) Sequencing, comparison with the NCBI database, and confirmation of typing.

[0155] After comparison with the NCBI database, the partial strain sequence was identified as blaTEM-1gene for classAextended-spectrum beta-lactamase, sharing 99% similarity with the reference sequence GenBank: LC636050.1.

[0156] Sequence TEM-1:

[0157] CGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTT TCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGTGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAG TGCTGCCATAACCATGAGTGATAACACTGCTGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGA TGCCTGCAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTTATTGCTGATAAATCTGGAGCCGTGAGC

[0158] Agarose gel electrophoresis results Figure 6 As shown, the sample added to each well (1-60) contains PCR products corresponding to 60 strains of Klebsiella pneumoniae. The results show clear, single DNA bands of the target gene with the correct band pattern, appearing at the expected position. This demonstrates that this method has high accuracy and good specificity, effectively enabling the screening and identification of target genes. Furthermore, the absence of nonspecific band contamination in the electrophoresis pattern further demonstrates the reliability and stability of this method. This result confirms the correctness of the experimental design and operation, enabling the screening of target genes.

[0159] Example 4

[0160] (1) Search the CTX-M gene sequence on NCBI and select two upstream and downstream sequences on the gene as primers so that the amplified fragments cover the mutation sites of various common types as much as possible. The specific primers are designed as follows:

[0161] CTX-M-F1: 5'-GCTTTATGCGCAGACGAGTG-3' (SEQ ID NO. 17),

[0162] CTX-M-R1: 5'-TCATTGGTGGTGCCGTAGTC-3' (SEQ ID NO. 18);

[0163] CTX-M-F2: 5'-ACGCTTTCCAATGTGCAGT-3' (SEQ ID NO.5),

[0164] CTX-M-R2: 5'-CAAAACCAGTTACAGCCCTTC-3' (SEQ ID NO. 6).

[0165] The primers were predicted by NCBI Primer-BLAST, and the results were as follows Figure 7 、 Figure 8 As shown, the self-complementarity score of the upstream primer of the first pair of primers is 6, while the Tm values ​​and GC% of the upstream and downstream primers of the second pair of primers are close, and the self-complementarity score is 4, so the second pair of primers is selected.

[0166] (2) Extraction of bacterial genomic DNA

[0167] ① Strain culture: Clinical strains collected from Nanfang Hospital of Southern Medical University, including 120 strains of Klebsiella pneumoniae. Weigh 33 g of nutrient agar solid powder and dissolve it in 1 L of ultrapure water. Sterilize at 121°C for 15 minutes to prepare nutrient agar medium for later use. Aspirate 30 μL of the frozen solution and inoculate it onto a nutrient agar slant. Incubate at 37°C for 16–24 hours to activate the culture. Inoculate the clinical strains into an appropriate culture medium and culture until the logarithmic growth phase (approximately 16–18 hours).

[0168] ② Bacteria collection: Collect bacteria, centrifuge at 10000 rpm for 5 min, and discard the supernatant.

[0169] ③ Lysis: Add 600 μL of lysis buffer to resuspend the bacteria, mix thoroughly, and incubate at 65°C for 30 min.

[0170] ④ Magnetic bead adsorption: Add 200 μL of magnetic beads, mix well, and incubate at room temperature for 10 min.

[0171] ⑤ Wash: Wash the beads with 70% ethanol, centrifuge at 10,000 rpm for 30 seconds, and discard the supernatant. Repeat this step once. Wash the beads with washing solution, centrifuge at 10,000 rpm for 30 seconds, and discard the supernatant. Repeat this step twice.

[0172] ⑥ Elution: Add 100 μL of elution buffer to elute the DNA on the magnetic beads, centrifuge at 10,000 rpm for 1 min, and collect the supernatant, which is the purified strain genomic DNA.

[0173] (3)PCR

[0174] ① PCR system: 1 μL of genomic DNA, 25 μL of 2× Taq Plus Master Mix (Dye Plus), 2 μL of upstream primer, 2 μL of downstream primer, and add ultrapure water to 50 μL.

[0175] ②PCR conditions: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 55°C for 1 min, extension at 72°C for 5 min, 30 cycles, final extension at 72°C for 5 min.

[0176] (4) Agarose gel electrophoresis

[0177] ① Weigh about 0.5g agarose, add 50mL TAE solution, and heat in a microwave oven until the solution is clear. After cooling to 55℃, add 4μL nucleic acid dye, mix well, pour into the template slot, insert the comb teeth, and let it stand until it solidifies.

[0178] ② Load the PCR product into the well at a volume of 5 μL. Simultaneously, add a marker.

[0179] ③ Fill the electrophoresis tank with electrophoresis solution (TAE solution) and place the gel in it. Run the gel at 120V for 20 minutes.

[0180] (5) Sequencing, comparison with the NCBI database, and confirmation of typing.

[0181] After comparison with the NCBI database, the partial strain sequence was identified as CTX-M-14beta-lactamase (blaCTX-M-14) gene, which shared 99% similarity with the reference sequence KY640592.1.

[0182] Sequence CTX-M-14:

[0183] ACGCTTTCCAATGTGCAGTACCAGTAAAGTTATGGCGGCCGCGGCGGTGCTTAAGCAGAGTGAAACGCAAAAGCAGCTGCTTAATCAGCCTGTCGAGATCAAGCCTGCCGATCTGGTTAACTACAATCCGATTGCCGAAAAACACGTCAACGGCACAATGACGCTGGCAGAACTGAGCGCGGCCGCGTTGCAGTACAGCGACAATACCGCCATGAACAAATTGATTGCCCAGCTCGGTGGCCCGGGAGGCGTGACGGCTTTTGCCCGCGCGATCGGCGATGAGACGTTTCGTCTGGATCGCACTGAACCTACGCTGAATACCGCCATTCCCGGCGACCCGAGAGACACCACCACGCCGCGGGCGATGGCGCAGACGTTGCGTCAGCTTACGCTGGGTCATGCGCTGGGCGAAACCCAGCGGGCGCAGTTGGTGACGTGGCTCAAAGGCAATACGACCGGCGCAGCCAGCATTCGGGCCGGCTTACCGACGTCGTGGACTGTGGGTGATAAGACCGGCAGCGGCGACTACGGCACCACCAATGATATTGCGGTGATCTGGCCGCAGGGTCGTGCGCCGCTGGTTCTGGTGACCTATTTTACCCAGCCGCAACAGAACGCAGAGAGCCGCCGCGATGTGCTGGCTTCAGCGGCGAGAATCATCGCCGAAGGGCTGTAACTGGTTTTG

[0184] After alignment with the NCBI database, the sequence identification results of some strains were class A extended-spectrum beta-lactamase CTX-M-65 (blaCTX-M) gene, sharing 99% similarity with the reference sequence MW052535.1.

[0185] Sequence CTX-M-65:

[0186] GTCGCGGCGGTGCTTAAGCAGAGTGAAACGCAAAAGCAGCTGCTTAATCAGCCTGTCGAGATCAAGCCTGCCGATCTGGTTAACTACAATCCGATTGCCGAAAAACACGTCAACGGCACAATGACGCTGGCAGAACTGAGCGCGGC CGCGTTGCAGTACAGCGACAATACCGCCATGAACAAATTGATTGCCCAGCTCGGTGGCCCGGGAGGCGTGACGGCTTTTGCCCGCGCGATCGGCGATGAGACGTTTCGTCTGGATCGCACTGAACCTACGCTGAATACCGCCATTCC CGGCGACCCGAGAGACACCACCACGCCGCGGGCGATGGCGCAGACGTTGCGTCAGCTTACGCTGGGTCATGCGCTGGGCGAAACCCAGCGGGCGCAGTTGGTGACGTGGCTCAAAGGCAATACGACCGGCGCAGCCAGCATTCGGGC CGGCTTACCGACGTCGTGGACTGTGGGTGATAAGACCGGCAGCGGCGACTACGGCACCACCAATGATATTGCGGTGATCTGGCCGCAGGGTCGTGCGCCGCTGGTTCTGGTGACCTATTTTACCCAGCCGCAACAGAACGCAGAGCG

[0187] Agarose gel electrophoresis results Figure 9 As shown, wells 1-60 of the two gels were loaded with PCR products corresponding to 120 strains of Klebsiella pneumoniae. The results showed clear, single DNA bands of the target gene with the correct pattern and at the expected location, demonstrating the high accuracy and good specificity of this method, effectively enabling the screening and identification of target genes. Furthermore, the absence of contamination by nonspecific bands in the electrophoresis patterns further demonstrates the reliability and stability of this method. This result confirms the correctness of the experimental design and operation, enabling the screening of target genes.

[0188] Example 5

[0189] (1) Search the NDM gene sequence on NCBI and select two upstream and downstream sequences on the gene as primers so that the amplified fragments cover the mutation sites of various common types as much as possible. The specific primers are designed as follows:

[0190] NDM-F: 5'-GCATTAGCCGCTGCATTGAT (SEQ ID NO.7),

[0191] NDM-R: 5'-GCCGTATGAGTGATTGCGG (SEQ ID NO. 8).

[0192] (2) Extraction of bacterial genomic DNA

[0193] ① Strain culture: Clinical strains collected from Nanfang Hospital of Southern Medical University included 33 strains of Escherichia coli, 15 strains of Acinetobacter baumannii, and 12 strains of Enterobacter cloacae. Weigh 33 g of nutrient agar solid powder and dissolve it in 1 L of ultrapure water. Sterilize at 121°C for 15 minutes to prepare nutrient agar medium for later use. Aspirate 30 μL of the frozen solution and inoculate it onto a nutrient agar slant. Incubate at 37°C for 16–24 hours to activate the culture. Inoculate the clinical strains into an appropriate culture medium and culture until the logarithmic growth phase (approximately 16–18 hours).

[0194] ② Bacteria collection: Collect bacteria, centrifuge at 10000 rpm for 5 min, and discard the supernatant.

[0195] ③ Lysis: Add 600 μL of lysis buffer to resuspend the bacteria, mix thoroughly, and incubate at 65°C for 30 min.

[0196] ④ Magnetic bead adsorption: Add 200 μL of magnetic beads, mix well, and incubate at room temperature for 10 min.

[0197] ⑤ Wash: Wash the beads with 70% ethanol, centrifuge at 10,000 rpm for 30 seconds, and discard the supernatant. Repeat this step once. Wash the beads with washing solution, centrifuge at 10,000 rpm for 30 seconds, and discard the supernatant. Repeat this step twice.

[0198] ⑥ Elution: Add 100 μL of elution buffer to elute the DNA on the magnetic beads, centrifuge at 10,000 rpm for 1 min, and collect the supernatant, which is the purified strain genomic DNA.

[0199] (3)PCR

[0200] ① PCR system: 1 μL of genomic DNA, 25 μL of 2× Taq Plus Master Mix (Dye Plus), 2 μL of upstream primer, 2 μL of downstream primer, and add ultrapure water to 50 μL.

[0201] ②PCR conditions: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 55°C for 1 min, extension at 72°C for 5 min, 30 cycles, final extension at 72°C for 5 min.

[0202] (4) Agarose gel electrophoresis

[0203] ① Weigh about 0.5g agarose, add 50mL TAE solution, and heat in a microwave oven until the solution is clear. After cooling to 55℃, add 4μL nucleic acid dye, mix well, pour into the template slot, insert the comb teeth, and let it stand until it solidifies.

[0204] ② Load the PCR product into the well at a volume of 5 μL. Simultaneously, add a marker.

[0205] ③ Fill the electrophoresis tank with electrophoresis solution (TAE solution) and place the gel in it. Run the gel at 120V for 20 minutes.

[0206] (5) Sequencing, comparison with the NCBI database, and confirmation of typing.

[0207] After comparison with the NCBI database, the partial strain sequence was identified as New Delhi metallo-beta-lactamase (blaNDM-1) gene, which shared 99% similarity with the reference sequence KY966040.1.

[0208] Sequence NDM-1:

[0209] GCATTAGCCGCTGCATTGATGCTGAGCGGGTGCATGCCCGGTGAAATCCGCCCGACGATTGGCCAGCAAATGGAAACTGGCGACCAACGGTTTGGCGATCTGGTTTTCCGCCAGCTCGCACCGAATGTCTGGCAGCACACTTCCTATCTCGACATGCCGGGTTTCGGGGCAGTCGCTTCCAACGGTTTGATCGTCAGGGATGGCGGCCGCGTGCTGGTGGTCGATACCGCCTGGACCGATGACCAGACCGCCCAGATCCTCAACTGGATCAAGCAGGAGATCAACCTGCCGGTCGCGCTGGCGGTGGTGACTCACGCGCATCAGGACAAGATGGGCGGTATGGACGCGCTGCATGCGGCGGGGATTGCGACTTATGCCAATGCGTTGTCGAACCAGCTTGCCCCGCAAGAGGGGATGGTTGCGGCGCAACACAGCCTGACTTTCGCCGCCAATGGCTGGGTCGAACCAGCAACCGCGCCCAACTTTGGCCCGCTCAAGGTATTTTACCCCGGCCCCGGCCACACCAGTGACAATATCACCGTTGGGATCGACGGCACCGACATCGCTTTTGGTGGCTGCCTGATCAAGGACAGCAAGGCCAAGTCGCTCGGCAATCTCGGTGATGCCGACACTGAGCACTACGCCGCGTCAGCGCGCGCGTTTGGTGCGGCGTTCCCCAAGGCCAGCATGATCGTGATGAGCCATTCCGCCCCCGATAGCCGCGCCGCAATCACTCATACGGC

[0210] After alignment with the NCBI database, the sequence identification results of some strains were metallo-beta-lactamase NDM-5, sharing 99% similarity with the reference sequence NG_049337.1.

[0211] Sequence NDM-5:

[0212] GCATTAGCCGCTGCATTGATGCTGAGCGGGTGCATGCCCGGTGAAATCCGCCCGACGATTGGCCAGCAAATGGAAACTGGCGACCAACGGTTTGGCGATCTGGTTTTCCGCCAGCTCGCACCGAATGTCTGGCAGCACACTTCCTATCTCGACATGCCGGGTTTCGGGGCAGTCGCTTCCAACGGTTTGATCGTCAGGGATGGCGGCCGCGTGCTGTTGGTCGATACCGCCTGGACCGATGACCAGACCGCCCAGATCCTCAACTGGATCAAGCAGGAGATCAACCTGCCGGTCGCGCTGGCGGTGGTGACTCACGCGCATCAGGACAAGATGGGCGGTATGGACGCGCTGCATGCGGCGGGGATTGCGACTTATGCCAATGCGTTGTCGAACCAGCTTGCCCCGCAAGAGGGGCTGGTTGCGGCGCAACACAGCCTGACTTTCGCCGCCAATGGCTGGGTCGAACCAGCAACCGCGCCCAACTTTGGCCCGCTCAAGGTATTTTACCCCGGCCCCGGCCACACCAGTGACAATATCACCGTTGGGATCGACGGCACCGACATCGCTTTTGGTGGCTGCCTGATCAAGGACAGCAAGGCCAAGTCGCTCGGCAATCTCGGTGATGCCGACACTGAGCACTACGCCGCGTCAGCGCGCGCGTTTGGTGCGGCGTTCCCCAAGGCCAGCATGATCGTGATGAGCCATTCCGCCCCCGATAGCCGCGCCGCAATCACTCATACGGC

[0213] The results of agarose gel electrophoresis are as Figure 10As shown, the samples added to each well 1-33 are PCR products corresponding to 33 strains of Escherichia coli, the samples added to each well 1-15 are PCR products corresponding to 15 strains of Acinetobacter baumannii, and the samples added to each well 1-12 are PCR products corresponding to 12 strains of Enterobacter cloacae. The results show that the DNA bands of the target gene are clear, single, and of the correct banding pattern, and appear at the expected position, indicating that this method has high accuracy and good specificity, and can effectively achieve the screening and identification of the target gene. At the same time, there is no contamination of nonspecific bands in the electrophoresis pattern, further demonstrating the reliability and stability of the method. This result proves the correctness of the experimental design and operation, and can achieve the screening of the target gene.

[0214] Example 6

[0215] (1) Search the OXA-23 gene sequence on NCBI and select two upstream and downstream sequences on the gene as primers so that the amplified fragments cover the mutation sites of various common types as much as possible. The specific primers are designed as follows:

[0216] OXA-23-F: 5'-ATGCCCTGATCGGATTGGAG-3' (SEQ ID NO.9),

[0217] OXA-23-R: 5'-CGGCATTTCTGACCGCATTT-3' (SEQ ID NO. 10).

[0218] (2) Extraction of bacterial genomic DNA

[0219] ① Strain culture: Clinical strains collected from Nanfang Hospital of Southern Medical University, including 30 strains of Acinetobacter baumannii. Weigh 33 g of nutrient agar solid powder and dissolve it in 1 L of ultrapure water. Sterilize at 121°C for 15 minutes to prepare nutrient agar medium for later use. Aspirate 30 μL of the frozen solution and inoculate it onto a nutrient agar slant. Incubate at 37°C for 16–24 hours to activate the culture. Inoculate the clinical strains into an appropriate culture medium and culture until the logarithmic growth phase (approximately 16–18 hours).

[0220] ② Bacteria collection: Collect bacteria, centrifuge at 10000 rpm for 5 min, and discard the supernatant.

[0221] ③ Lysis: Add 600 μL of lysis buffer to resuspend the bacteria, mix thoroughly, and incubate at 65°C for 30 min.

[0222] ④ Magnetic bead adsorption: Add 200 μL of magnetic beads, mix well, and incubate at room temperature for 10 min.

[0223] ⑤ Wash: Wash the beads with 70% ethanol, centrifuge at 10,000 rpm for 30 seconds, and discard the supernatant. Repeat this step once. Wash the beads with washing solution, centrifuge at 10,000 rpm for 30 seconds, and discard the supernatant. Repeat this step twice.

[0224] ⑥ Elution: Add 100 μL of elution buffer to elute the DNA on the magnetic beads, centrifuge at 10,000 rpm for 1 min, and collect the supernatant, which is the purified strain genomic DNA.

[0225] (3)PCR

[0226] ① PCR system: 1 μL of genomic DNA, 25 μL of 2× Taq Plus Master Mix (Dye Plus), 2 μL of upstream primer, 2 μL of downstream primer, and add ultrapure water to 50 μL.

[0227] ②PCR conditions: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 55°C for 1 min, extension at 72°C for 5 min, 30 cycles, final extension at 72°C for 5 min.

[0228] (4) Agarose gel electrophoresis

[0229] ① Weigh about 0.5g agarose, add 50mL TAE solution, and heat in a microwave oven until the solution is clear. After cooling to 55℃, add 4μL nucleic acid dye, mix well, pour into the template slot, insert the comb teeth, and let it stand until it solidifies.

[0230] ② Load the PCR product into the well at a volume of 5 μL. Simultaneously, add a marker.

[0231] ③ Fill the electrophoresis tank with electrophoresis solution (TAE solution) and place the gel in it. Run the gel at 120V for 20 minutes.

[0232] (5) Sequencing, comparison with the NCBI database, and confirmation of typing.

[0233] After comparison with the NCBI database, some strain sequences were identified as carbapenem-hydrolyzing class Dbeta-lactamase OXA-23, sharing 99% similarity with the reference sequence NG_049525.1.

[0234] OXA-23 sequence:

[0235] ATGCCCTGATCGGATTGGAGAACCAGAAAACGGATATTAATGAAATATTTAAATGGAAGGGCGAGAAAAGGTCATTTACCGCTTGGGAAAAAGACATGACACTAGGAGAAGCCATGAAGCTTTTCTGCA GTCCCAGTCTATCAGGAACTTGCGCGACGTATCGGTCTTGATCTCATGCAAAAAGAAGTAAAACGTATTGGTTTCGGTAATGCTGAAATTGGACAGCAGGTTGATAATTTCTGGTTGGTAGGACCATT AAAGGTTACGCCTATTCAAGAGGTAGAGTTTGTTTCCCAATTAGCACATACACAGCTTCCATTTAGTGAAAAAGTGCAGGCTAATGTAAAAAATATGCTTCTTTTTAGAAGAGAGTAATGGCTACAAAA TTTTTGGAAAGACTGGTTGGGCAATGGATATAAAACCACAAGTGGGCTGGTTGACCGGCTGGGTTGAGCAGCCAGATGGAAAAATTGTCGCTTTTGCATTAAATATGGAAATGCGGTCAGAAATGCCG

[0236] Agarose gel electrophoresis results Figure 11 As shown, the sample added to each well (1-30) contains PCR products corresponding to 30 strains of Acinetobacter baumannii. The results show that the DNA bands of the target gene are clear, single, and of the correct pattern, appearing at the expected position. This demonstrates that this method has high accuracy and good specificity, effectively enabling the screening and identification of target genes. Furthermore, the absence of nonspecific band contamination in the electrophoresis pattern further demonstrates the reliability and stability of this method. This result confirms the correctness of the experimental design and operation, enabling the screening of target genes.

[0237] Example 7

[0238] (1) Search the KPC gene sequence on NCBI and select two upstream and downstream sequences on the gene as primers so that the amplified fragments cover the mutation sites of various common types as much as possible. The specific primers are designed as follows:

[0239] KPC-F1: 5'-AGGCATGACGGTGGCG-3' (SEQ ID NO. 19),

[0240] KPC-R1: 5'-AGCCTTACTGCCCGTTGAC-3' (SEQ ID NO. 20);

[0241] KPC-F2: 5'-TTGCTGCACACCCATCC-3' (SEQ ID NO. 11),

[0242] KPC-R2: 5'-AGCCTTACTGCCCGTTGAC-3' (SEQ ID NO. 12).

[0243] The primers were predicted by NCBI Primer-BLAST, and the results were as follows Figure 12 、 Figure 13 As shown, the first pair of primers had more nonspecific matches in Enterobacter cloacae, while the Tm values ​​and GC% of the upstream and downstream of the second pair of primers were close, the self-complementary score was low, and the specificity was good, so the second pair of primers was selected.

[0244] (2) Extraction of bacterial genomic DNA

[0245] ① Strain culture: Clinical strains collected from Nanfang Hospital of Southern Medical University, including 60 strains of Klebsiella pneumoniae and 15 strains of Enterobacter cloacae. Weigh 33 g of nutrient agar solid powder and dissolve it in 1 L of ultrapure water. Sterilize at 121°C for 15 minutes to prepare nutrient agar medium for later use. Aspirate 30 μL of the frozen solution and inoculate it onto a nutrient agar slant. Incubate at 37°C for 16–24 hours to complete activation. Inoculate the clinical strains into an appropriate culture medium and culture until the logarithmic growth phase (approximately 16–18 hours).

[0246] ② Bacteria collection: Collect bacteria, centrifuge at 10000 rpm for 5 min, and discard the supernatant.

[0247] ③ Lysis: Add 600 μL of lysis buffer to resuspend the bacteria, mix thoroughly, and incubate at 65°C for 30 min.

[0248] ④ Magnetic bead adsorption: Add 200 μL of magnetic beads, mix well, and incubate at room temperature for 10 min.

[0249] ⑤ Wash: Wash the beads with 70% ethanol, centrifuge at 10,000 rpm for 30 seconds, and discard the supernatant. Repeat this step once. Wash the beads with washing solution, centrifuge at 10,000 rpm for 30 seconds, and discard the supernatant. Repeat this step twice.

[0250] ⑥ Elution: Add 100 μL of elution buffer to elute the DNA on the magnetic beads, centrifuge at 10,000 rpm for 1 min, and collect the supernatant, which is the purified strain genomic DNA.

[0251] (3)PCR

[0252] ① PCR system: 1 μL of genomic DNA, 25 μL of 2× Taq Plus Master Mix (Dye Plus), 2 μL of upstream primers (KPC-F1, KPC-R1), 2 μL of downstream primers (KPC-F2, KPC-R2), and ultrapure water to 50 μL.

[0253] ②PCR conditions: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 55°C for 1 min, extension at 72°C for 5 min, 30 cycles, final extension at 72°C for 5 min.

[0254] (4) Agarose gel electrophoresis

[0255] ① Weigh about 0.5g agarose, add 50mL TAE solution, heat in a microwave oven until the solution is clear, pour into the template slot, insert the comb teeth, and let it stand until it solidifies.

[0256] ② Load the PCR product into the well at a volume of 5 μL. Simultaneously, add a marker.

[0257] ③ Fill the electrophoresis tank with electrophoresis solution (TAE solution) and place the gel in it. Run the gel at 120V for 20 minutes.

[0258] (5) Sequencing, comparison with the NCBI database, and confirmation of typing.

[0259] After comparison with the NCBI database, some strain sequences were identified as carbapenem-hydrolyzing class Abeta-lactamase KPC-2, sharing 99% similarity with the reference sequence NG_049253.1.

[0260] Sequence KPC-2:

[0261] TTGCTGGACACACCCATCCGTTACGGCAAAAATGCGCTGGTTCCGTGGTCACCCATCTCGGAAAAATATCTGACAACAGGCATGACGGTGGCGGAGCTGTCCGCGGCCGCCGTGCAATACAGTGATAACGCCGCCGCCAATTTGTTGCTGAAGGAGTTGGGCGGCCCGGCCGGGCTGACGGCCTTCATGCGCTCTATCGGCGATACCACGTTCCGTCTGGACCGCTGGGAGCTGGAGCTGAACTCCGCCATCCCAGGCGATGCGCGCGATACCTCATCGCCGCGCGCCGTGACGGAAAGCTTACAAAAACTGACACTGGGCTCTGCACTGGCTGCGCCGCAGCGGCAGCAGTTTGTTGATTGGCTAAAGGGAAACACGACCGGCAACCACCGCATCCGCGCGGCGGTGCCGGCAGACTGGGCAGTCGGAGACAAAACCGGAACCTGCGGAGTGTATGGCACGGCAAATGACTATGCCGTCGTCTGGCCCACTGGGCGCGCACCTATTGTGTTGGCCGTCTACACCCGGGCGCCTAACAAGGATGACAAGCACAGCGAGGCCGTCATCGCCGCTGCGGCTAGACTCGCGCTCGAGGGATTGGGCGTCAACGGGCAGTAAGGCT

[0262] After alignment with the NCBI database, the sequence identification results of some strains were carbapenem-hydrolyzing class A beta-lactamase KPC-3, sharing 99% similarity with the reference sequence NG_049257.1.

[0263] Sequence KPC-3:

[0264] TTGCTGGACACACCCATCCGTTACGGCAAAAATGCGCTGGTTCCGTGGTCACCCATCTC

[0265] GGAAAAATATCTGACAACAGGCATGACGGTGGCGGAGCTGTCCGCGGCCGCCGTGCAA

[0266] TACAGTGATAACGCCGCCGCCAATTTGTTGCTGAAGGAGTTGGGCGGCCCGGCCGGGCT

[0267] GACGGCCTTCATGCGCTCTATCGGCGATACCACGTTCCGTCTGGACCGCTGGGAGCTGG

[0268] AGCTGAACTCCGCCATCCCAGGCGATGCGCGCGATAACCTCATCGCCGCGCGCCGTGACG

[0269] GAAAGCTTACAAAAACTGACACTGGGCTCTGCACTGGCTGCGCCGCAGCGGCAGCAGT

[0270] TTGTTGATTGGCTAAAGGGAAACACGACCGGCAACCACCGCATCCGCGCGGCGGTGCC

[0271] GGCAGACTGGGCAGTCGGAGACAAAACCGGAACCTGCGGAGTGTATGGCACGGCAAAT

[0272] GACTATGCCGTCGTCTGGCCCACTGGGCGCACCTATTGTGTTGGCCGTCTACACCCGG

[0273] GCGCCTAACAAGGATGACAAGTACAGCGAGGCCGTCATCGCCCGCTGCGGCTAGACTCG

[0274] CGCTCGAGGGATTGGGCGTCAACGGGGCAGTAAGGC

[0275] Agarose gel electrophoresis results Figure 14 As shown, the samples added to each well (1-60) contained PCR products corresponding to 60 strains of Klebsiella pneumoniae, and the samples added to each well (1-15) contained PCR products corresponding to 15 strains of Enterobacter cloacae. The results showed clear, single DNA bands of the target gene with the correct band pattern, appearing at the expected position, demonstrating that this method has high accuracy and good specificity, effectively enabling the screening and identification of target genes. Furthermore, the absence of nonspecific band contamination in the electrophoresis pattern further demonstrates the reliability and stability of this method. This result confirms the correctness of the experimental design and operation, enabling the screening of target genes.

[0276] Comparative Example 1

[0277] (1) Primers for SHV gene, TEM gene, and CTX-M gene were designed based on existing literature. The specific primer designs are as follows:

[0278] SHV-F: 5'-ATGCGTATATTCGCCTGTG-3',

[0279] SHV-R: 5'-CCTCATTCAGTTCCGTTTTCC-3';

[0280] TEM-F: 5'-CAGAAACGCTGGTGAAAGTA-3',

[0281] TEM-R: 5'-ACTCCCCGTCGTGTAGATAA-3';

[0282] CTX-MF: 5'-AGTGAAAGCGAACCGAATC-3',

[0283] CTX-MR: 5'-CTGTCACCAATGCTTTACC-3'.

[0284] (2) Extraction of bacterial genomic DNA

[0285] ①The strains selected are Klebsiella pneumoniae and Escherichia coli.

[0286] ② Nutrient agar medium: Weigh 33 g of nutrient agar medium solid powder, dissolve it in 1 L of ultrapure water, and sterilize it at 121°C for 15 min to prepare nutrient agar medium for later use.

[0287] ③ Strain activation: aspirate 30 μL of the frozen solution, inoculate it on a nutrient agar slant, and culture at 37°C for 16-24 hours to complete the activation.

[0288] ④ Genomic DNA extraction: Use a bamboo stick to pick up a small amount of bacterial colonies growing on the slope and stir in an EP tube filled with sterile water. Place the EP tube containing the bacterial solution in a 95°C water bath for 10 minutes, remove it, and let it cool.

[0289] (3)PCR

[0290] ① PCR system: 1 μL of genomic DNA, 25 μL of 2× Taq Plus Master Mix (Dye Plus), 2 μL of upstream primer, 2 μL of downstream primer, and add ultrapure water to 50 μL.

[0291] ②PCR conditions: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 55°C for 1 min, extension at 72°C for 5 min, 30 cycles, final extension at 72°C for 5 min.

[0292] (4) Agarose gel electrophoresis

[0293] ① Weigh approximately 0.5 g of agarose, add 50 mL of TAE solution, and heat in a microwave oven until the solution is clear. After cooling to 55°C, add 4 μL of nucleic acid dye, mix well, pour into the template slot, insert the comb teeth, and let it stand until it solidifies.

[0294] ② Load the PCR product into the well at a volume of 5 μL. Simultaneously, add a marker.

[0295] ③ Fill the electrophoresis tank with electrophoresis solution (TAE solution) and place the gel in it. Run the gel at 120 V for 20 min.

[0296] (5) Sequencing, comparison with the NCBI database, and confirmation of typing.

[0297] Prepare a standard strain sample with known sequence typing as a positive control to verify the specificity of the primer design and the effectiveness of the PCR conditions. Each method was repeated at least three times, and the accuracy of the comparative example was compared with that of the embodiment. The results are shown in Table 3:

[0298] Table 3

[0299] Example Accuracy (%) Comparative Example Accuracy (%) SHV 100 SHV 100 TEM 100 TEM 75 CTX-M 100 CTX-M 75

Claims

1. A method for detecting bacterial strain resistance enzyme genotyping for non-diagnostic purposes, characterized in that: The following steps are involved: S1, extract genomic DNA of the strain to be tested using a magnetic bead kit; S2, using the DNA of the strain to be tested extracted in S1 as a template, and using the primer set to perform PCR amplification of the target gene of the strain to be tested; S3, detecting the amplified products obtained in S2 by gel electrophoresis to identify the drug resistance gene detection results; S4, performing nucleic acid sequence determination on the amplified products after drug resistance gene detection in S3; S5, performing sequence alignment analysis on the sequences of the six target genes determined in S4 and the enzyme type standard sequences of the corresponding target genes to determine the genotype of the specific target genes; The primer set is amplification primers for SHV, TEM, CTX-M, NDM, OXA-23 and KPC; The nucleotide sequences of the primer set are shown in SEQ ID NO.1 to SEQ ID NO.12; The magnetic bead kit includes a lysate, magnetic beads, an adsorption buffer, a washing solution and an eluent; The lysate consists of a final concentration of 0.1 wt% SDS, a final concentration of 0.5 wt% Triton-100, and a final concentration of 0.5 wt% β-mercaptoethanol, with a pH of 7; The adsorption buffer consists of guanidine hydrochloride with a final concentration of 4 mol / L, sodium chloride with a final concentration of 800 mmol / L, sodium citrate with a final concentration of 200 mmol / L, EDTA with a final concentration of 1 mmol / L, and isopropanol with a final concentration of 75 wt%; The washing liquid is an ethanol solution with a concentration of 70wt%; The eluent consisted of a final concentration of 10 mmol / L Tris-HCl and a final concentration of 1 mmol / L EDTA; The procedure for PCR amplification in step S2 is as follows: 30 cycles of pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 55°C for 1 min, and extension at 72°C for 5 min, with a final extension at 72°C for 5 min; The strain to be detected is selected from at least one of Escherichia coli, Acinetobacter baumannii, Enterobacter cloacae, and Klebsiella pneumoniae.

2. The bacterial strain enzyme typing detection method for non-diagnostic purposes according to claim 1, characterized in that: The reaction system for PCR amplification in step S2 includes: 1 μL of genomic DNA, 25 μL of 2 × Taq Plus Master Mix, 2 μL of upstream primer, 2 μL of downstream primer, and ultrapure water were added to 50 μL.

3. The bacterial strain enzyme typing detection method for non-diagnostic purposes according to claim 1, characterized in that: The identification of drug-resistant gene detection results includes: 5 μL of PCR product was electrophoresed on a 1% agarose gel containing a nucleic acid dye at 120 V for 20 min and observed under ultraviolet light. A 2000 bp DNA marker was used for DNA size comparison. The standard bands included 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp, of which 738 bp, 694 bp, 685 bp, 743 bp, 512 bp, and 545 bp indicated SHV, TEM, CTX-M, NDM, OXA-23, and KPC, respectively.