Application of JH-RE-06 in the preparation of drugs for inhibiting pseudorabies virus DNA synthesis

By developing the small molecule compound JH-RE-06, the REV1-mediated TLS pathway was blocked, and the problem of existing vaccines being ineffective against pseudorabies virus variants was solved, and effective inhibition of pseudorabies virus and improved survival rate was achieved.

CN118593489BActive Publication Date: 2025-07-04ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410773549.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-17
Publication Date
2025-07-04
Estimated Expiration
2044-06-17

AI Technical Summary

Technical Problem

Existing vaccines are unable to effectively fight the mutant strain of the pseudorabies virus, lack of specific drugs to treat pseudorabies, existing vaccination strategies are facing challenges, and new antiviral drugs are needed to control the transmission and infection of PRV.

Method used

The small molecule compound JH-RE-06 was developed to block the REV1-mediated TLS pathway by inducing dimerization of REV1, thereby inhibiting pseudorabies virus DNA synthesis and reducing viral replication and cytopathy.

Benefits of technology

JH-RE-06 significantly inhibits pseudorabies virus replication, reduces cell lesions, improves the survival rate of mice, and provides a scientific basis for clinical prevention and treatment of pseudorabies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118593489B_ABST
    Figure CN118593489B_ABST
Patent Text Reader

Abstract

The present invention discloses the application of JH-RE-06 in the preparation of a drug for inhibiting the DNA synthesis of pseudorabies virus. The translesion DNA synthesis pathway inhibitor JH-RE-06 has the characteristics of a REV1 inhibitor and can induce the dimerization of REV1. The REV1-mediated TLS pathway is essential for the DNA synthesis of porcine pseudorabies virus. Therefore, JH-RE-06 can inhibit the proliferation of porcine pseudorabies virus. The present invention discovers for the first time the mechanism of action of JH-RE-06 in inhibiting the proliferation of pseudorabies virus and uses this drug for antiviral purposes for the first time.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of pharmaceutical technology, and particularly to the application of JH-RE-06 in the preparation of a drug for inhibiting the DNA synthesis of pseudorabies virus. Background Art

[0002] Pseudorabies virus (PRV) is a highly contagious alpha herpesvirus that causes porcine pseudorabies (PR), also known as Aujeszky's disease (AD). This disease is mainly characterized by fever, severe itching (except in pigs), respiratory and nervous system diseases, and encephalomyelitis. It presents an explosive epidemic in pigs, which can cause abortion, stillbirth, or mummified fetuses in pregnant sows, infertility in boars, dyspnea and growth stagnation in fattening pigs, and the mortality rate of newborn piglets is almost 100%. It is one of the major infectious diseases endangering the global pig industry.

[0003] Vaccination is the main measure for the prevention and control of PR. However, the severe outbreaks of porcine pseudorabies in many parts of China in recent years have shown that even after vaccination with the Bartha-K61 vaccine, the newly emerging PRV variant strains are still highly pathogenic to pigs of all ages and exhibit varying degrees of clinical symptoms. This indicates that the existing vaccines can no longer provide complete immune protection.

[0004] Currently, there is no specific drug for the treatment of pseudorabies, and vaccination remains the main preventive measure. However, the emergence of PRV mutant strains poses a major challenge to vaccine-based control strategies. Therefore, there is an urgent need to study the drug targets of PRV and develop new antiviral drugs. The research and development of these new drugs will help supplement the existing vaccination program, thereby more effectively controlling the spread and infection of PRV.

[0005] Translesion synthesis (TLS) is an important mechanism for cells to respond to DNA damage. Special DNA polymerases are used to synthesize DNA at the damage site, bypassing the damaged area, thereby maintaining genomic stability. Due to the extremely high GC content (about 70%) in the PRV genome, G4 DNA secondary structures are easily formed during DNA synthesis. The G4 structure can inhibit DNA synthesis and further hinder the replication and proliferation of the virus. Therefore, PRV is very likely to use TLS to maintain its genomic stability and ensure its normal proliferation. Inhibiting key proteins in the TLS pathway, such as REV1, may inhibit the replication of PRV.

[0006] JH-RE-06 is a small molecule compound that blocks the recruitment of downstream TLS polymerases by inducing the dimerization of REV1 and has potential value in chemotherapy applications. However, its role in antiviral therapy has not been reported. Summary of the Invention

[0007] The object of the present invention is to provide an application of JH-RE-06 in the preparation of a drug for inhibiting the DNA synthesis of pseudorabies virus. The present invention has found that JH-RE-06 has a very significant effect on anti-pseudorabies virus infection in pigs, can inhibit the replication of pseudorabies virus in pigs, reduce the cytopathic effect caused by pseudorabies virus, and can be used for the clinical prevention and treatment of pseudorabies in pigs.

[0008] The technical solution provided by the present invention is as follows: The application of JH-RE-06 in the preparation of a drug for inhibiting the DNA synthesis of pseudorabies virus, the CAS number of the JH-RE-06 is: 1361227-90-8, and its structural formula is as follows:

[0009]

[0010] In the above application, the JH-RE-06 prevents and / or treats pseudorabies in pigs by inhibiting the DNA synthesis of pseudorabies virus.

[0011] In the aforementioned application, the concentration of JH-RE-06 in the drug is 1-2 mg / kg.

[0012] In the aforementioned application, the concentration of JH-RE-06 in the drug is 1.6 mg / kg.

[0013] In the aforementioned application, the drug solvent includes 10% DMSO, 45% PEG300, 5% Tween-80, and 45% Saline by mass concentration.

[0014] Compared with the prior art, through research, the present invention has found that the translesion DNA synthesis pathway inhibitor JH-RE-06 has the characteristics of a REV1 inhibitor and can induce the dimerization of REV1. The REV1-mediated TLS pathway is essential for the DNA synthesis of pseudorabies virus. Therefore, JH-RE-06 can inhibit the proliferation of pseudorabies virus. The present invention has discovered the mechanism of action of JH-RE-06 in inhibiting the proliferation of pseudorabies virus, can use this drug for anti-pseudorabies virus infection, can inhibit the replication of pseudorabies virus in pigs, reduce the cytopathic effect caused by pseudorabies virus, and improve the survival rate of mice infected with the virus, providing a scientific and reliable theoretical basis for the clinical prevention and treatment of pseudorabies in pigs. Description of the Drawings

[0015] Figure 1Schematic diagram of cell viability detected by CCK-8 for JH-RE-06 at different concentrations for 24 h;

[0016] Figure 2 For TCID 50 Determination of the effect of JH-RE-06 on the infection of porcine pseudorabies virus in vero cells;

[0017] Figure 3 Effect of JH-RE- on the infection of pseudorabies virus in vero cells determined by Western blot;

[0018] Figure 4 Schematic diagram of the formation of PRV replication centers detected by IF after adding JH-RE-06 at different concentrations;

[0019] Figure 5 Statistical analysis chart of the formation area of virus replication centers;

[0020] Figure 6 Diagram of PCNA ubiquitination modification induced by PRV infection;

[0021] Figure 7 WB detection results chart of the knockdown effects of siRev1 and siRad18;

[0022] Figure 8 Diagram of the effect of siRev1 and siRad18 on the formation of replication centers detected by IF;

[0023] Figure 9 Statistical analysis chart of the formation area of replication centers detected by IF for siRev1 and siRad18;

[0024] Figure 10 For TCID of PRV-infected siRad18 and siRev1 Vero for 24 h 50 Detection results chart;

[0025] Figure 11 Detection results chart of the relative levels of viral genomes of PRV-infected siRad18 and siRev1 Vero for 24 h;

[0026] Figure 12 Detection results chart of the ubiquitination modification of exogenous PCNA after PRV infection after endogenous PCNA knockdown;

[0027] Figure 13 Diagram of the effect of PCNA-K164R on the formation of replication centers detected by IF;

[0028] Figure 14 Statistical analysis chart of the formation area of replication centers detected by IF for PCNA-K164R;

[0029] Figure 15 Flow chart for injecting mice

[0030] Figure 16 Survival curve of mice Detailed implementation manners

[0031] The present invention will be further described in detail below in conjunction with the specific implementation manners. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0032] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0033] Unless otherwise specified, in the following embodiments, quantitative tests are all set with three repeated experiments, and the results are averaged.

[0034] Example 1. Cytotoxicity detection of JH-RE-06

[0035] 1. Inoculate 100 μL of Vero cell suspension (about 5000 cells per well) in each well of a 96-well plate, and culture at 37 °C and 5% CO2 for 24 h until the cells adhere and spread.

[0036] 2. Add the test drug JH-RE-06 to Vero cells at the following concentrations of 0.5 μM, 1 μM, 1.5 μM, 2 μM, 2.5 μM, 3 μM, 4 μM, 5 μM, and culture in an incubator for 24 h.

[0037] 3. Add 10 μL of CCK-8 solution to each well. The CCK-8 kit is purchased from Abclonal Biotech Co., Ltd. Incubate at 37 °C and 5% CO2 for 1.5 h, mix well, and detect the absorbance at OD450nm with an enzyme-linked immunosorbent assay reader.

[0038] Result analysis: Cell survival rate (%) = [(As - Ab) / (Ac - Ab)] × 100;

[0039] Where, As = absorbance of the experimental well (absorbance of the well containing cells, medium, CCK-8 and the test compound);

[0040] Ab = absorbance of the blank well (absorbance of the well containing medium and CCK-8);

[0041] Ac = absorbance of the control well (absorbance of the well containing cells, medium and CCK-8);

[0042] Four replicates were set for each concentration, and the effects of JH-RE-06 on the growth and viability of Vero cells were observed after 24 h of addition.

[0043] At the tested concentrations of 0 - 2.5 μM, JH-RE-06 had no obvious effect on cell viability. The results are shown in Figure 1 . This indicates that the inhibitory activity of JH-RE-06 against PRV at this concentration is not related to its cytotoxicity.

[0044] Example 2: Inhibition of PRV proliferation by JH-RE-06

[0045] 1. Add 5×10 5 Vero cells per well to a 24-well plate, inoculate PRV virus (PRV virus is the laboratory isolated strain PRV-SC, GenBank: KT809429.1) at an MOI of 0.01, and simultaneously add different concentrations of JH-RE-06 (0.5 μM, 1 μM, 1.5 μM, 2 μM, 2.5 μM). Vero cells without added virus serve as the negative control. Incubate at 4 °C for 1 h, discard the supernatant, replace it with complete medium, transfer to 37 °C and culture for 24 h, then freeze-thaw once at -80 °C.

[0046] 2. Perform TCID 50 detection on the freeze-thawed cell supernatant. Take out a 96-well cell culture plate, add approximately 8000 - 10000 cells per well. The cells in each well should form a monolayer with an abundance of approximately 80% before inoculating the virus. Dilute the virus solution to be tested, dilute the virus according to the number of wells to be inoculated. Generally, inoculate 4 wells for each dilution, so prepare 500 μl for each dilution. Take the cell culture plate and add the diluted virus solution to the 96-well plate, 100 μl per well. Place the culture plate in a 37 °C CO₂ incubator, incubate for 1 h, take out the culture plate, discard the supernatant, wash once with PBS, add 100 μl of maintenance medium (2% FBS, 1% double antibody), and continue to culture in a 37 °C, CO₂ incubator for 3 - 5 days. Take out the culture plate and observe the cytopathic effect under a microscope. Calculate the TCID 50 of the virus solution according to the Spearman-Karbe method and the Reed-Muench method. The results are shown in Figure 2 . The addition of different concentrations of JH-RE-06 showed a dose-dependent inhibitory effect on PRV proliferation. When 2.5 μM JH-RE-06 was added, the PRV virus titer decreased significantly.

[0047] 3. Add 1×10 6Vero cells were inoculated with PRV virus at an MOI of 0.01, and different concentrations of JH-RE-06 (0.5 μM, 1 μM, 1.5 μM, 2 μM) were added simultaneously. Incubate at 4 °C for 1 h, discard the supernatant, replace it with complete medium, transfer to a 37 °C, CO₂ incubator and culture for 24 h. Discard the cell supernatant, lyse the cells with RIPA (added with protease inhibitor), add 150 μL of lysis buffer to each well, completely cover the cells, lyse on ice for half an hour and then sonicate, 60 W, work for 3 s, stop for 3 s, sonicate for about 2 min. When there are no cell clumps and viscous liquids in the product, it is completed. Centrifuge at 4 °C, 12,000 g for 10 min, take 80 μL of the supernatant and 5 * loading buffer, act at 95 °C for 5 min. Detect and calibrate the protein concentration with a BCA protein concentration detection kit (Beyotime, P0009). Measure the absorbance at a wavelength of 562 nm with an enzyme-linked immunosorbent assay reader. Calculate the protein concentration of the sample according to the standard curve and the volume of the sample used. Add the same amount of protein sample for WB detection. First, run at 80 V for 30 min, then at 120 V for 1.5 h, then transfer to an NC membrane, 100 V, 120 min. Block with 5% skim milk (TBST) for 2 h, RT, incubate with primary antibody GADPH (mouse, proteintech) 1:10000 and VP5 polyclonal antiserum (Rabbit, prepared in our laboratory) at 4 °C overnight, wash the membrane with TBST for 30 min, RT, incubate with secondary antibody HRP-conjugated Affinipure Goat Anti-Mouse IgG(H+L), 1:5000 and HRP-conjugated Affinipure Goat Anti-Rabbit IgG(H+L), 1:5000, wash the membrane with PBST for 30 min, expose with an enhanced ECL chemiluminescence detection kit (Vazyme, E411-04), and the results are shown in Figure 3 . It can be seen that the concentration of PRV virus VP5 protein shows a dose-dependent decrease with JH-RE-06.

[0048] Example 3: JH-RE-06 inhibits the formation of PRV replication centers

[0049] Add 5×10 5Vero cells were used, and when the cell density reached 80%, PRV virus was inoculated at an MOI of 2. Different concentrations of JH-RE-06 (2.5 μM, 5 μM) were added simultaneously. After incubation at 4°C for 1 h, the cells were transferred to 37°C for 8 h and then fixed with 4% PFA. After washing once with PBS, the cells were permeabilized overnight with PBST (0.5% triton-X100), blocked with PBSA (3% BSA, 0.5% triton-X100) for 1 h. The primary antibody was ICP8-mouse antibody, and the secondary antibody was Goat anti-Mouse IgG(H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor TM 568. After mounting with an anti-fluorescence quenching mounting medium (containing DAPI), the slides were air-dried in a laminar flow hood and then detected with an upright fluorescence microscope. The results are shown in Figure 4 and Figure 5 The indirect immunofluorescence images and statistical charts. It can be seen that both 2.5 μM and 5 μM JH-RE-06 can significantly inhibit the formation of virus replication centers, and the effect of 5 μM JH-RE-06 is more significant.

[0050] Example 4: RNAi-mediated blockade of TLS can inhibit the formation and proliferation of PRV centers.

[0051] By knocking down RAD18 or REV1 through RNAi, or inhibiting the ubiquitination of the PCNA K164 site to block TLS, the replication of PRV was detected. As Figure 6 shown, the specific implementation is as follows:

[0052] siRNAs were designed against the CDS regions of Rev1 and Rad18. Twenty-four hours before transfection, Vero cells were seeded in six-well plates at a density of 50% for transfection. The transfection complexes for each well of the six-well plates were prepared as follows: 80 pmol of siRNA was taken and added to 125 μL of serum-free dilution solution, and mixed well to prepare an RNA dilution solution with a final volume of 125 μL. 5 μL of Lipofectamine TM RNAiMAX was added to 125 μL of serum-free dilution solution, and mixed well to a final volume of 130 μL. After standing at room temperature for 5 min, the RNA dilution solution and Lipofectamine TM RNAiMAX dilution solution were mixed well and then allowed to stand at room temperature for 15 min to obtain the transfection complex. The cells were changed to serum-free medium, and then the transfection complex was added dropwise to the cells. Two wells of the six-well plate were transfected with each siRNA. After 16 h of transfection, the cells were changed to complete medium. After 18 h of transfection, the cells in one well were re-seeded into 24-well plates, and the knockdown efficiency of the other well was detected by WB.

[0053] At 48 - 72 h after transfection, the cells were harvested, lysed, and then detected by WB. The results are shown in Figure 7 , it can be seen that the expression levels of Rev1 and Rad18 proteins were significantly decreased, proving that the target proteins were significantly knocked down. Based on this, subsequent experiments were carried out.

[0054] At 48 h after transfection, vero cells were infected with the virus, and the formation of virus replication centers was detected by IF. The specific steps refer to Part Two. The results are shown in Figure 8 , after knocking down Rev1 and Rad18, the staining area of ICP8 was significantly reduced. Statistical analysis is shown in Figure 9 , proving that it effectively slowed down the formation of virus replication centers.

[0055] At 48 h after transfection, vero cells were infected with the virus, and the number of infectious virus particles was detected by TCID 50 . The specific steps of the TCID 50 detection method refer to Part Three. The virus was inoculated at an MOI of 0.05. The results are shown in Figure 10 , it can be seen that the virus titer of Rev1 and Rad18 knockdown was significantly reduced.

[0056] The frozen - thawed virus solution was subjected to qPCR detection. The cell culture supernatant was collected, and the virus genome was extracted using the Tiangen genomic DNA extraction kit. Primers were designed in the gD region:

[0057] PRV - gD - qF1: atgcggccctttctgctg;

[0058] PRV - gD - qR1: tccctcagggaggcgagg;

[0059] β - actin was used as an internal reference to design primers;

[0060] β - actin - qF: CGGCATCGTCACCAACTGGG;

[0061] β - actin - qR: AGCGCCTACCTGAGTCATCT.

[0062] qPCR detection was performed using the CFX96TM Real - Time PCR System (Bio - Rad, Hercules, CA) to obtain the ct value. By the relative quantification method, a double - Δ analysis was performed between the experimental group and the control group. The sample with only the virus added was used as a positive control, denoted as 1, and the proportional relationship between the drug - added group and the virus group was calculated. The results are shown in Figure 11 , compared with the control group, the relative content of the siRev1 and siRad18 PRV genomes was significantly reduced.

[0063] Establish vero-PCNA-WT and vero-PCNA-K164R overexpression cell lines. Add the CDS region of PCNA with a Myc tag for PCR amplification. Digest the PCDH-EF1-T2A-Puro plasmid with Nhe1 and Sal1, and perform homologous recombination (Novoprotein, C112-01) between the backbone and the PCR product. After ligation and transformation, extract the plasmid from the successfully sequenced bacteria and rename them as PCDH-EF1-T2A-Puro-PCNA-WT-Myc and PCDH-EF1-T2A-Puro-PCNA-K164R-Myc. Infect vero cells with the virus supernatant obtained by packaging these two plasmids into lentivirus. After 48 h, screen with puro (5 μg / mL). When the cell density is about 30%, continuously screen for one week, and the surviving cells are positive cells. Endogenously knockdown PCNA in the positive cells (WT / K164R) with siPCNA-3'-UTR. After 48 h of knockdown, add HU (2 mM) for 16 h as a positive control. The experimental group is infected with PRV (MOI = 5). The results are shown in Figure 12 . Vero-PCNA-WT detects ubiquitination modification of exogenous Myc-PCNA under PRV infection and HU conditions, while vero-PCNA-K164R cells have no ubiquitination modification. From the abundance of the VP5 protein, after losing ubiquitination modification, virus replication is significantly inhibited. Perform siPCNA-3'-UTR on vero-PCNA-WT and vero-PCNA-K164R. Infect with PRV (MOI = 5) 48 h after knockdown, and detect the formation of virus replication centers by IF. The results are shown in Figure 13 and 14 . The formation rate of the replication center of vero-PCNA-K164R is significantly slowed down, proving that the ubiquitination modification at the PCNA K164 site plays an important role in virus infection.

[0064] Example 5: JH-RE-06 can improve the survival rate of PRV-infected mice

[0065] Randomly divide 30 C57 strain mice at 6 - 8 weeks old into an experimental group, a control group, and a blank group, with five mice in each group. The blank group is intraperitoneally injected with 100 μL of the JH-RE-06 solvent, the control group is intraperitoneally injected with PRV cell culture virus (5×10 4 TCID 50 ), and the experimental group is intraperitoneally injected with 100 μL of PRV cell culture virus (5×10 4 TCID 50) and JH-RE-06 (1.6 mg / kg). The solvent of JH-RE-06 is 10% DMSO, 45% PEG300, 5% Tween-80 and 45% Saline by mass concentration. The animals were inoculated with the drug and the virus simultaneously. On the third day after virus challenge, the control group was intraperitoneally injected with JH-RE-06, and the vital signs of the mice were observed, such as Figure 15 as shown.

[0066] The vital signs of the mice were observed daily. The dead mice were dissected, and the liver, lungs, intestines and trigeminal ganglia were fixed with paraformaldehyde, and the remaining tissues were stored at -80 °C.

[0067] This experiment was conducted twice in total to analyze the survival rate of the mice. The typical symptom of the mice after PRV infection was neurological symptoms, that is, the mice scratched their heads and turned around unconsciously. With the slight difference in the virus challenge dose and the differences in the age and individual of the mice, the death time of the mice was about 4 - 7 days. The test results are shown in Figure 16 . All the mice in the experimental group injected with only the PRV virus died. The survival rate of the mice injected with JH-RE-06 and the PRV virus was about 75%, and the survival of the mice was better at 14 days, showing no difference from the Mock group, which proved that the injection of JH-RE-06 could effectively inhibit the PRV virus infection and reduce the mortality of the mice. The surviving mice were sacrificed by cervical dislocation at 14 days, and the tissues were fixed with formaldehyde and the remaining samples were stored at -80 °C.

[0068] In summary, through research, it was found that the translesion DNA synthesis pathway inhibitor JH-RE-06 has the characteristics of a REV1 inhibitor, can induce the dimerization of REV1, and the TLS pathway mediated by REV1 is essential for the DNA synthesis of porcine pseudorabies virus. Therefore, JH-RE-06 can inhibit the proliferation of porcine pseudorabies virus. The present invention discovered the mechanism of action of JH-RE-06 in inhibiting the proliferation of pseudorabies virus, and can use this drug for anti-pseudorabies virus infection, inhibit the replication of porcine pseudorabies virus, reduce the cytopathic effect caused by porcine pseudorabies virus, and improve the survival rate of virus-infected mice, providing a scientific and reliable theoretical basis for the clinical prevention and treatment of porcine pseudorabies.

[0069] The above is only a preferred specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed by the present invention should be covered within the protection scope of the present invention.

Claims

1. Application of JH-RE-06 in the preparation of a drug for inhibiting pseudorabies virus DNA synthesis, characterized in that: The CAS number of JH-RE-06 is: 1361227-90-8, and its structural formula is as follows:

2. The application according to claim 1, wherein: JH-RE-06 prevents and / or treats porcine pseudorabies by inhibiting the DNA synthesis of pseudorabies virus.

3. The application according to claim 1, characterized in that: The concentration of JH-RE-06 in the drug is 1-2 mg / kg.

4. The application according to claim 3, wherein: The concentration of JH-RE-06 in the drug is 1.6 mg / kg.

5. The application according to claim 3 or 4, characterized in that: The drug solvent includes 10% DMSO, 45% PEG300, 5% Tween-80, and 45% salt by mass concentration.