An anti-inflammatory peptide targeting ASK1

Abstract

A small molecule polypeptide AIP203, the amino acid sequence of which is shown in SEQ ID NO.1, can be seen from cell experiments: the plasmid expressing AIP203 is transferred into HEK293T cells, and IP experiments show that AIP203 reduces the N-terminal dimerization of ASK1, and the chronic disease overexpressing AIP203 is transfected into RAW264.7 cells, mouse primary hepatocytes (PMH) or human umbilical vein endothelial cells (HUVEC) to reduce JNK phosphorylation in inflammatory response and inhibit the level of MMP9 or inflammatory factors. These results show that AIP203 targets the N-terminal dimerization of ASK1 and antagonizes macrophage inflammation, and can be used as a new anti-inflammatory polypeptide.

Description

Technical Field

[0001] The invention belongs to the field of drug therapy, and specifically relates to a polypeptide with anti-inflammatory activity. Background Art

[0002] Chronic inflammatory diseases are characterized by long-term inflammation of body tissues. Unlike acute inflammation, chronic inflammation is usually progressive, lasts longer, and is associated with immune system disorders. Chronic inflammatory diseases can affect multiple organs and systems, such as rheumatoid arthritis, rheumatoid arthritis, inflammatory bowel disease (such as Crohn's disease and ulcerative colitis), cardiovascular disease, autoimmune diseases, etc. These diseases are often caused by the immune system's misguided attack on body tissues, causing the inflammatory response to persist in the body. Targeting inflammation is an important strategy for the treatment of chronic inflammatory diseases. In clinical trials, the use of anti-inflammatory drugs canakinumab and colchicine can reduce the occurrence of adverse cardiovascular events, but there are still many problems to be further resolved. Therefore, finding more effective inflammation intervention strategies has become an urgent problem that needs to be solved.

[0003] Macrophages are an important component of the immune system that plays a key defensive role in the human body. However, when macrophages are dysfunctional or overactive, macrophage inflammation and related diseases may result. Macrophage inflammation refers to the response of macrophages to infection, injury, or other stimuli to release inflammatory mediators to regulate immune and inflammatory processes. Although the inflammatory response is beneficial in the short term, if macrophage inflammation is excessive or persistent, it may lead to tissue damage and chronic diseases. Recent studies have shown that the inflammatory response of macrophages is associated with a variety of common chronic diseases, including: atherosclerosis, rheumatoid arthritis, diabetes, etc. Therefore, targeted regulation of macrophage inflammatory response is the key to the treatment of a variety of chronic inflammatory diseases.

[0004] Apoptosis signal-regulating kinase 1 (ASK1) is a key node molecule in the macrophage inflammatory signaling pathway. After being activated by endoplasmic reticulum stress, oxidative stress, etc., it will undergo N-terminal dimerization and further autophosphorylation, activating downstream signaling pathways and aggravating chronic inflammatory responses. Existing ASK1 inhibitors are all targeted at its kinase domain. Because the structures of the kinase domains of kinases are similar, there are often off-target effects between kinase inhibitors, and they cannot specifically antagonize the activity of kinases. Therefore, developing drugs targeting other domains of kinases is a new strategy to inhibit the activity of target kinases. Summary of the invention

[0005] The present invention provides a polypeptide and pharmaceutical use thereof, which can be used to inhibit the ASK1-JNK pathway and reduce the level of MMP9 or inflammatory factors.

[0006] A polypeptide, the amino acid sequence of the polypeptide is shown as SEQ ID NO.1.

[0007] The nucleic acid encoding the aforementioned polypeptide, the sequence of the nucleic acid is shown in SEQ ID NO.2.

[0008] Use of the aforementioned polypeptide or the aforementioned nucleic acid in the preparation of anti-inflammatory drugs.

[0009] An anti-inflammatory drug, the active ingredient of which includes the aforementioned polypeptide.

[0010] The beneficial effects of the present invention are:

[0011] The polypeptide AIP203 provided by the present invention, whose amino acid sequence is shown in SEQ ID NO.1, can inhibit JNK activation and reduce the secretion of MMP9 in RAW264.7 cells, and reduce the levels of inflammatory factors in PMH and HUVEC. These results indicate that AIP203 can be used as a new anti-inflammatory polypeptide. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 Virtual binding diagram of peptide fragment and target molecule ASK1;

[0013] Figure 2 Flow chart of the experimental steps for detecting peptide fragments inhibiting ASK1 N-terminal dimerization;

[0014] Figure 3 Flow chart of the experimental steps for detecting the function of peptide fragments on RAW264.7;

[0015] Figure 4 Flow chart of the experimental steps for testing the function of peptide fragments on PMH;

[0016] Figure 5 Flow chart of the experimental steps for detecting the function of peptide fragments on HUVEC;

[0017] Figure 6 This is a Western blot result of the peptide fragment inhibiting ASK1 N-terminal dimerization experiment;

[0018] Figure 7 This is a graph showing the results of a Western blot experiment on RAW264.7 cell function.

[0019] Figure 8 This is a graph showing the results of a Western blot experiment on RAW264.7 cell function.

[0020] Fig. 9 This is a graph showing the results of a Western blot experiment of PMH function;

[0021] Fig.10 The results of PMH RT-qPCR experiments after lentivirus and PA treatment are shown in Figure 1. Fig.10 A is the level of IL-1β, Fig.10 B is the IL-6 level, Fig.10 C is the CCL2 level;

[0022] Fig.11 This is a graph showing the results of a Western blot experiment of HUVEC function;

[0023] Fig.12 This is the result of HUVEC RT-qPCR experiment after lentivirus and LPS treatment, among which, Fig.12 A is the level of IL-1β, Fig.12 B is the IL-6 level, Fig.12 C is the CCL2 level. DETAILED DESCRIPTION

[0024] The present invention is further explained below with reference to the examples, but the examples do not limit the present invention in any form.

[0025] SEQ ID NO.1:

[0026] GNAKAEAESRAEAARIEGE

[0027] SEQ ID NO.2:

[0028] ggtaatgctaaagctgaagctgaatctcgtgctcaagctgctcgtattgaaggtgaa.

[0029] Embodiment 1:

[0030] 1. Reagents and related instruments and equipment:

[0031] Peptide: Ubao Biotech was commissioned to synthesize the peptide shown in SEQ ID NO.1. Figure 1 Shown: Virtual binding diagram of polypeptide fragment and target molecule ASK1, showing that the AIP203 (MVP (729-747)) fragment shown in SEQ ID NO.1 is most likely to bind to the ASK1 molecule.

[0032] Overexpression plasmid vector: anti-inflammatory peptide overexpression plasmid: PLVX-SP-Flag-AIP-P2A-mCherry (purchased from Youbao Bio); ASK1 N-terminal plasmid: pcDNA3.1-HA / Myc-ASK1 (1-658) (purchased from Youbao Bio).

[0033] Cells: human embryonic kidney cells (HEK293T), mouse mononuclear macrophage leukemia cells (RAW264.7), mouse primary hepatocytes (PMH), human umbilical vein endothelial cells (HUVEC);

[0034] Reagents: DMEM / F12, DMEM, ECM, fetal bovine serum FBS, penicillin / streptomycin (PS), lipopolysaccharide (LPS), palmitic acid (PA), protein A / G PLUS-Agarose beads, Western blot antibodies (p-JNK, JNK, MMP9, β-actin, HA, Myc);

[0035] Instruments: cell culture incubator (Thermofisher), constant temperature horizontal shaker, real-time fluorescence quantitative PCR instrument.

[0036] 2. Experiment:

[0037] 1. Binding experiment to detect the inhibition of ASK1 N-terminal dimerization by peptide fragments

[0038] (1) HEK293T cells were seeded into 6 cm dishes and 4 mL of DMEM / F12 + 10% FBS + 1% PS was added to each well until the cell density reached 80%.

[0039] (2) The culture medium supernatant was discarded and 2 mL of DMEM / F12 + 10% FBS + anti-inflammatory peptide overexpression lentivirus Lenti-AIP was added to each well.

[0040] (3) After 18 hours, the culture supernatant was discarded and 2 mL of DMEM / F12+10% FBS+pcDNA3.1-HA / Myc-ASK1(1-658) was added to each well.

[0041] (4) After 24 h, cells were collected for IP experiments, and the ASK1 N-terminal binding was detected by Western blot ( Figure 2 ).

[0042] The results showed that HEK293T cells were transfected with ASK1 N-terminal plasmids with HA or Myc tags, and peptides with FLAG tags, including AIP60 and its three truncated peptides AIP201, AIP202 and AIP203. Among them, only AIP60 and AIP203 can inhibit ASK1 N-terminal dimerization, while AIP201 and AIP202 do not affect ASK1 N-terminal dimerization, indicating that AIP203 shown in SEQ ID NO.1 is an effective truncation of AIP60 ( Figure 6 ),

[0043] 2. RAW264.7 cell function experiment

[0044] (1) RAW264.7 cells were seeded into 12-well plates, 1 mL of DMEM+10% FBS+1% PS was added to each well, and the cells were cultured in an incubator at 37° C. until the cell density reached 60%.

[0045] (2) Discard the culture medium supernatant and add 500 μL DMEM+10% FBS+Lenti-AIP to each well.

[0046] (3) After 18 hours, discard the culture supernatant and add 1 mL of DMEM + 10% FBS + 1% PS to each well and continue culturing for 48-72 hours.

[0047] (4) The culture medium supernatant was discarded and 500 μL DMEM + 0.1% FBS was added to each well for starvation treatment for 6 h.

[0048] (5) After treatment with 100 ng / mL LPS for 30 min, cells were collected for Western blot to detect JNK phosphorylation levels, or after treatment with 100 ng / mL LPS for 6 h, cells were collected for Western blot to detect MMP9 secretion ( Figure 3 ).

[0049] The results showed that RAW264.7 cells were transfected with control, Yang Shen AIP60 and its three truncated forms AIP201, AIP202 and AIP203 overexpressing lentiviruses, respectively. After 30 minutes of LPS stimulation, compared with the control virus group, only the cells transfected with lentiviruses overexpressing Yang Shen AIP60 and its truncated form AIP203 had significantly reduced JNK phosphorylation levels, while overexpression of AIP201 and AIP202 lentiviruses did not affect the phosphorylation level of JNK, indicating that overexpression of AIP203 shown in SEQ ID NO.1 inhibited LPS-induced JNK phosphorylation in RAW264.7 cells ( Figure 7 ).

[0050] RAW264.7 cells were transfected with control, Yang Shen AIP60 and its three truncated forms AIP201, AIP202 and AIP203 overexpressing lentiviruses, respectively. After 6 hours of LPS stimulation, compared with the control virus group, only the cells transfected with lentiviruses overexpressing Yang Shen AIP60 and its truncated form AIP203 had significantly reduced MMP9 levels, while overexpression of AIP201 and AIP202 lentiviruses had no effect on MMP9 levels, indicating that overexpression of AIP203 shown in SEQ ID NO.1 inhibited LPS-induced MMP9 secretion in RAW264.7 cells ( Figure 8 ).

[0051] 3. PMH functional experiment

[0052] (1) PMH were seeded into 12-well plates, 1 mL of DMEM + 10% FBS + 1% PS was added to each well, and the plates were cultured in an incubator at 37°C.

[0053] (2) After 24 hours, the culture supernatant was discarded and 500 μL of DMEM+10% FBS+Lenti-AIP was added to each well.

[0054] (3) After 18 hours, the culture supernatant was discarded and 1 mL of DMEM + 10% FBS + 1% PS was added to each well and culture was continued for 12 hours.

[0055] (4) The culture medium supernatant was discarded and 500 μL DMEM + 0.1% FBS was added to each well for starvation treatment for 6 h.

[0056] (5) Treat with 0.3 mM PA for 1 h and collect cells for Western blot experiments, or treat with 0.3 mM PA for 12 h and collect cells for RT-PCR experiments ( Figure 4 ).

[0057] The results showed that: Western blot results showed that when PMH transfected with control or AIP203 overexpressing lentivirus were treated with or without PA, PA increased the JNK phosphorylation level of PMH transfected with control virus compared with the background state, and this phenomenon was inhibited after overexpression of AIP203, indicating that overexpression of AIP203 shown in SEQ ID NO.1 inhibited PMH JNK phosphorylation induced by PA ( Fig. 9 ).

[0058] The results of RT-PCR experiments showed that PMH transfected with control or AIP203 overexpressing lentivirus were treated with or without PA. Compared with the background state, LPS increased the expression of IL-1β( Fig.10 A) IL6( Fig.10 B) and CCL2( Fig.10 C), and this phenomenon was inhibited after overexpression of AIP203, indicating that overexpression of AIP203 shown in SEQ ID NO.1 inhibited the level of PMH inflammatory factors induced by PA ( Fig.10 ).

[0059] 4. HUVEC functional experiments

[0060] (1) HUVECs were seeded into 6-well plates, and 2 mL of ECM + 10% FBS + 1% PS was added to each well until the cell density reached 60%.

[0061] (2) Discard the culture medium supernatant and add 1 mL of ECM + 10% FBS + Lenti-AIP to each well.

[0062] (3) After 18 hours, discard the culture supernatant and add 1 mL of ECM + 10% FBS + 1% PS to each well and continue culturing for 48-72 hours.

[0063] (4) The culture medium supernatant was discarded and 1 mL of ECM + 0.1% FBS was added to each well for starvation treatment for 8 h.

[0064] (5) Treat with 100 ng / mL LPS for 30 min and collect cells for Western blot experiments, or treat with 100 ng / mL LPS for 12 h and collect cells for RT-PCR experiments ( Figure 5 ).

[0065] The results showed that: Western blot results showed that HUVECs transfected with control or AIP203 overexpressing lentivirus were treated with or without LPS. Compared with the background state, LPS increased the JNK phosphorylation level of HUVECs transfected with the control virus, and this phenomenon was inhibited after overexpression of AIP203, indicating that overexpression of AIP203 shown in SEQ ID NO.1 inhibited LPS-induced HUVEC JNK phosphorylation ( Fig.11 ).

[0066] The results of RT-PCR experiments showed that when HUVECs transfected with control or AIP203 overexpressing lentivirus were treated with or without LPS, LPS increased the expression of IL-1β( Fig.12 A) IL6( Fig.12 B) and CCL2( Fig.12 C) RNA level, and this phenomenon was inhibited after overexpression of AIP203, indicating that overexpression of AIP203 shown in SEQ ID NO.1 inhibited the level of LPS-induced HUVEC inflammatory factors.

[0067] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A polypeptide, characterized in that The amino acid sequence of the polypeptide is shown in SEQ ID NO.

1.

2. A nucleic acid encoding the polypeptide according to claim 1, characterized in that The sequence of the nucleic acid is shown in SEQ ID NO.

2.

3. Use of the polypeptide according to claim 1 or the nucleic acid according to claim 2 in the preparation of anti-inflammatory drugs.

4. An anti-inflammatory drug, characterized in that: The active ingredient of the medicine comprises the polypeptide according to claim 1.

Images