ZmDAR1b protein and methods of modulating corn plant height and organ size
By cloning and editing the maize gene ZmDAR1b, and creating ZmDAR1b gene-edited mutants using CRISPR/Cas9 technology, the problem of regulating plant height and organ size in maize breeding has been solved, maize biomass and breeding efficiency have been improved, and the breeding cycle has been shortened.
Patent Information
- Application Number
- CN202410555443.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-07
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2044-05-07
AI Technical Summary
Existing technologies make it difficult to effectively control plant height and organ size in maize breeding, resulting in long breeding cycles and low efficiency, which cannot meet the growing demand for feed grains and industrial grains.
By cloning the maize gene ZmDAR1b, analyzing its tissue expression pattern, and using CRISPR/Cas9 technology to create a ZmDAR1b gene-editing knockout mutant, the expression or activity of the ZmDAR1b protein was regulated, thereby controlling maize plant height and organ size.
It significantly increased maize plant height, stem internode length, and kernel size, increased maize biomass, shortened the breeding cycle, provided genetic resources for the selection of superior varieties, and enriched the functional understanding of DA1-Related proteins.
Smart Images

Figure CN118598956B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a method for regulating the height and organ size of corn plants by ZmDAR1b protein, relates to C12N, and particularly relates to the field of microorganisms and compositions thereof. BACKGROUND
[0002] As the first major food crop in China, corn is also an important feed and industrial raw material. In recent years, due to the adjustment of agricultural industrial structure, the demand for feed and industrial grain has increased significantly. In traditional corn breeding work, the accurate identification of important agronomic traits is not perfect, the breeding cycle is long, the selection efficiency is low, and the independent gene mining and utilization of major application value is not enough. Using biotechnology for corn breeding can greatly accelerate the mutation rate of genetic genes, greatly shorten the breeding cycle, accelerate the cultivation of new varieties, and save time and resources. In practical application, the efficiency of gene editing is different, and for growth and development genes, complete knockout may cause plant death and cannot obtain knockout mutants, and the efficiency of gene transformation is too low. In recent years, due to the adjustment of agricultural industrial structure, and the sharp increase in demand for feed and industrial grain, it is urgent to improve the biomass and yield of corn. The height, leaf length, leaf width, and grain size of corn are key factors affecting corn yield. Therefore, exploring the key genes that regulate the size of corn organs and analyzing their genetic regulatory networks lay an important theoretical foundation for further improving corn yield, and have important guiding significance for ensuring national food security and effective supply of agricultural products.
[0003] Chinese invention patent CN105349574A discloses a method for inhibiting the expression of corn ZmDAR1 family genes to improve corn grain yield, which improves the ear weight of corn by inhibiting the expression of corn ZmDAR1 family genes, increases the proportion of double ears, and thus improves the corn grain yield, but does not involve the growth of corn height, leaf and other organs. Chinese invention patent CN117778457A discloses the application of protein ZmERF018 and its encoding gene in corn drought response, which realizes the drought resistance effect of corn by regulating protein ZmERF018, but does not involve the growth and development effect of corn height, organs, and grains. SUMMARY
[0004] In order to optimize the height of corn plants, increase the leaf length and leaf width of corn, increase the biomass of corn, and ensure the demand for feed and industrial grain, the first aspect of the present application provides a ZmDAR1b protein, the amino acid sequence of which is sequence 1; the amino acid base sequence of the ZmDAR1b protein is sequence 2; and the genomic sequence of the ZmDAR1b protein is sequence 3.
[0005] The second aspect of the present application provides a method for regulating the plant height of corn by using ZmDAR1b protein, comprising the following steps:
[0006] S1 cloning the corn gene ZmDAR1b;
[0007] S2 analyzing the tissue expression pattern of the corn gene ZmDAR1b;
[0008] S3 creating a corn ZmDAR1b gene editing knockout mutant.
[0009] As a preferred embodiment, the method for cloning the corn gene ZmDAR1b in step S1 is as follows:
[0010] M1 extracting the total RNA of corn seeds, and then performing reverse transcription;
[0011] M2 designing specific primers according to the full-length cDNA sequence of the ZmDAR1b gene in the B73 corn genome, and then performing PCR reaction, and sequencing the PCR reaction product, the ZmDAR1b amino acid sequence is shown in sequence 1, and the nucleic acid sequence of the ZmDAR1b amino acid is shown in sequence 2.
[0012] Sequence 1 is as follows:
[0013] MNFNALSYNNEPDIGHNLAEDEQLARALQESMNDGPPRQHIPVEDVNSESTPASILPSNIFRTSGLRVCAGCRSPIGRGRFLSCMDSVWHPECFRCYACDRPISEYEFAVHENHAYHRPCYKERFHPKCDVCSSFIPTDKNGLIEYRAHPFWMQKYCPSHENDGTPRCCSCERMEPKDSQYITLDDGRRLCLECLHTAIMETNECQPLYIDIQEFYEGMNMKVEQQVPLLLVERQALNEAMEAEKSVHHLPETRGLCLSEEQIVRTILKGPIGPGNRIIDMVTGPYKLIRRCEVTAILILYGLPRLLTGSILAHEMMHAYLRLKGYRTLSPEVEEGICQVLAHLWLESEITSGSGSMSTTSDASSSSSTSSSSKKGAKTEFEKRLGEFFKYQIETDSSVAYGDGFRAGMRAIERYGLRSTLDHIKMTGSFPC
[0014] Sequence 2 is as follows:
[0015]
[0016] As a preferred embodiment, the method of extracting total RNA of corn seed in step M1 is as follows:
[0017] (1) Liquid nitrogen quick-freezing grinding sample, using Trizol method to extract total RNA, high temperature heating sterilization inactivation mortar and grinding rod, pre-cooling liquid nitrogen grinding sample three times to powder, pick up the powder to 2 mL RNA free EP tube, add 1 mL Trizol extraction liquid, place in vortex shaker to fully shake and mix, ice on dark for 10 min;
[0018] (2) After adding 500 μL RNA nucleic acid extraction liquid (the volume ratio of sample to RNA nucleic acid extraction liquid is 1:24), vortex for 10 s, mix evenly, and stand on ice for 10 min to extract impurities;
[0019] (3) Using high-speed desktop centrifuge, 12000xg, 4℃ centrifugation for 10 min;
[0020] (4) Take 600 μL supernatant and transfer to a new 1.5 mL RNA free EP tube, add an equal volume of isopropanol, mix repeatedly, and stand on ice for 10 min;
[0021] (5) Using high-speed desktop centrifuge, 12000xg, 4℃ centrifugation for 10 min;
[0022] (6) Discard the supernatant, add 1 mL 75wt% ethanol (DEPC water configuration), mix evenly;
[0023] (7) Using high-speed desktop centrifuge, 12000xg, 4℃ centrifugation for 3 min;
[0024] (8) Repeat steps (6) and (7), using high-speed desktop centrifuge, 12000xg, 4℃ centrifugation for 3 min;
[0025] (9) Dissolve the RNA precipitate with 50 μL DEPC water;
[0026] (10) Measure the concentration ng / uL and OD 260 / 280 value of RNA, and detect the quality of RNA by using nucleic acid gel electrophoresis, and the extracted RNA is stored at -80℃ for use.
[0027] As a preferred embodiment, the sequence of the specific primer in step M2 is as follows: ZmDAR1b-F: ATGAACTTTAATGCTTTGTCTTATAATA;
[0028] ZmDAR1b-F: GCATGGAAAAGACCCCGTC.
[0029] As a preferred embodiment, the method of analyzing the tissue expression pattern of the corn gene ZmDAR1b in step S2 is as follows: according to the full-length coding sequence of the ZmDAR1b gene, a specific quantitative primer is designed, the product length is set within 200 bp, the primer length is set to 20 bp, the Tm value is set to 58-60°C, and the GC% content is 50-60%.
[0030] As a preferred embodiment, the specific quantitative primer sequence includes a forward primer and a reverse primer, the forward primer sequence is: TTGTGCTGGATGCAGAAGTC; and the reverse primer sequence is: GGAAACGCTCCTTGTAGCAG.
[0031] As a preferred embodiment, the template in the tissue expression pattern is selected from one or more combinations of Root (Root-V4), Stem (Stem-V4), Leaf (Leaf-V4), Bract (Bract-V17), Ear (Ear-V17), Silk (Silk-V17), Pollen (Pollen-R1), Embryo (Embryo-40 DAP), Endosperm (Endosperm-40DAP), and Seed (Seed-40DAP).
[0032] As a preferred embodiment, the method of creating a corn ZmDAR1b gene editing knockout mutant in step S3 is as follows:
[0033] H1 designs a knockout target according to the corn gene ZmDAR1b genomic sequence 3;
[0034] H2 constructs a corn ZmDAR1b gene editing knockout mutant vector;
[0035] H3 genetic transformation of corn ZmDAR1b gene editing knockout mutant;
[0036] H4 identification of the knockout mode of the corn ZmDAR1b gene in the knockout line;
[0037] H5 detection of the expression amount of the corn ZmDAR1b gene in the knockout line.
[0038] As a preferred embodiment, the method of designing a knockout target according to the corn gene ZmDAR1b genomic sequence 3 in step H1 is as follows: two target points are selected on the ZmDAR1b protein domain sequence, an expression cassette of double-target sgRNA and Cas9 protein is constructed, and it is inserted into the binary expression vector pCXB-053-CCDB to complete the construction of the CRISPR / Cas9 knockout vector.
[0039] As a preferred embodiment, the two sgRNAs targeting ZmDAR1b gene are sgRNA1 and sgRNA2 respectively. The nucleotide sequence of the sgRNA1 target site is 5'-TGGAAACGCTCCTTGTAGCAGGG-3', targeting the 1866-1888th nucleotide of sequence 3 of ZmDAR1b gene; the nucleotide sequence of the sgRNA2 target site is 5'-ATGAAAATGATGGTACACCTAGG-3', targeting the 2098-2120th nucleotide of sequence 3.
[0040] Sequence 3 is as follows:
[0041]
[0042] As a preferred embodiment, the method for constructing the ZmDAR1b gene editing knockout mutant vector in step H2 is as follows: the CCDB sequence in the pCXB-053-CCDB vector is cut off by BSAI enzyme, two independent single-target vectors are constructed by T4 ligase respectively, and then the sgRNA2 is connected by recombinase to form a double-target knockout vector of ZmDAR1b-sgRNA1-sgRNA2.
[0043] As a preferred embodiment, the specific steps of the method for constructing the ZmDAR1b gene editing knockout mutant vector are as follows: 1) synthesizing primers and dissolving them in ultrapure water to mix uniformly; 2) preparing annealing buffer (Tris-HCl 10.0 mM, pH 8.0, EDTA 0.1 mM, NaCl: 50.0 mM); 3) annealing and connecting, 50.0 μL of annealing buffer, 5.0 μL of primer mixture, 95°C, 3 min, and cooling to 16°C.
[0044] As a preferred embodiment, the specific method for detecting the expression amount of the ZmDAR1b gene in the knockout strain is as follows: wild type and homozygous ZmDAR1b #KO1 , ZmDAR1b #KO2 , and ZmDAR1b #KO3 strains are selected respectively, and are planted in a greenhouse, and when they grow to five or six leaves, sufficient well-grown leaves are selected for DNA extraction and RNA extraction, and the extracted RNA is subjected to reverse transcription to obtain cDNA.
[0045] As a preferred embodiment, the primers are designed according to the position of the knockout target and the sequence in sequence 2, and the primer sequences are as follows:
[0046] ZmDAR1b-k-F: CTCTGTTTGGCATCCCGAGT
[0047] ZmDAR1b-k-R: GTAAACATAACACTAACCTCCATCCG
[0048] According to the sequence of sequence 2, the quantitative primers are designed, and the quantitative primer sequences are as follows:
[0049] ZmDAR1b-RT-F: TTGGATGCAGAAGTATTGTCCTT
[0050] ZmDAR1b-RT-R: GGCATTCATTGGTCTCCATAATA
[0051] As a preferred embodiment, the method for extracting corn leaf genomic DNA is as follows (raw materials are derived from the kit SteadyPure Plant Genomic DNA Extraction Kit):
[0052] X1 take 0.1 g of corn leaves for liquid nitrogen grinding, then quickly add 500 μL of Buffer LS-3 and 10 μL of 50×DTT Buffer to the ground sample powder, and then add 10 μL of RNase A,
[0053] fully oscillate and mix;
[0054] X2 place the centrifugal tube in a 56℃ water bath for heating for 10 min (invert and mix during heating) ;
[0055] X3 add 62.5 μL of Buffer PA and fully mix; place on ice for 5 min, and centrifuge at 12000 rpm at room temperature for 5 min; take the supernatant, add Buffer BS-2 in an equal volume to the supernatant, and fully mix;
[0056] X4 transfer the above solution to a centrifugal adsorption column, stand at room temperature for 1 min, then centrifuge at 12000 rpm at room temperature for 1 min, and discard the filtrate;
[0057] X5 add 500 μL of Buffer WA to the centrifugal adsorption column, centrifuge at 12000 rpm at room temperature for 1 min, and discard the filtrate;
[0058] X6 add 750 μL of Buffer WB to the centrifugal adsorption column, centrifuge at 12000 rpm at room temperature for 1 min, and discard the filtrate;
[0059] X7 repeat step X6 once;
[0060] X8 place the adsorption column on a new 1.5 mL centrifugal tube, add 50 μL of ddH2O at the center of the adsorption column membrane, stand at room temperature for 2 min, then centrifuge at 12000 rpm at room temperature for 2 min, and store the eluted DNA sample at -20℃ for use.
[0061] The third aspect of the present application provides a method for regulating corn organ size by ZmDAR1b protein.
[0062] Compared with the prior art, the present application has the following beneficial effects:
[0063] (1) The ZmDAR1b protein of the present application can regulate plant height, stem node length, cell expansion, and kernel size.
[0064] (2) After reducing the expression of the ZmDAR1b protein or inhibiting the activity of ZmDAR1b, the plant height of corn can be increased, the stem node length can be increased, the cell expansion can be promoted, the kernel thickness can be increased, and the hundred-grain weight can be increased.
[0065] (3) The present application obtains a ZmDAR1b transgenic knockout mutant material through a gene editing technology and a corn genetic transformation technology, and performs multi-year and multi-point field tests and observations, determines the biological function of the ZmDAR1b gene in corn, provides important gene resources for corn excellent variety breeding, has very important application value, determines that the ZmDAR1b participates in the ubiquitin-protease system to regulate the development of corn organs, lays a foundation for subsequent in-depth research, and proves that the ZmDAR1b has the biological function of regulating the plant height and organ size of corn, enriches the function cognition of the DA1-Related protein in corn, and provides a good example for in-depth research on the biological function of the DA1-Related protein in other species. BRIEF DESCRIPTION OF DRAWINGS
[0066] Figure 1 The expression test results of the ZmDAR1b gene in different tissues of corn are shown in Table 1.
[0067] Figure 2 The test results of real-time fluorescent quantitative PCR experiments are shown in Table 2, and three knockout modes of the ZmDAR1b gene in knockout lines are shown in Table 3. Figure 2 The gene expression test results are shown in Table 4. Figure 2
[0068] Figure 3 The plant height observation results of wild type and ZmDAR1b gene knockout mutant lines are shown in Table 5, and the actual figure is shown in Table 6. Figure 3 The plant height statistical data graph is shown in Table 7. Figure 3
[0069] Figure 4 The stalk length observation results of wild type and ZmDAR1b gene knockout mutant lines at the ear position are shown in Table 8, and the actual figure is shown in Table 9. Figure 4 The stalk length statistical data graph at the ear position is shown in Table 10. Figure 4
[0070] The leaf length statistical data graph is shown in Table 11. Figure 5 The leaf width statistical data graph is shown in Table 12. Figure 5 Figure 5 Figure 5
[0071] Figure 6 Fig. 1 is a microscope image of the leaf epidermal cell phenotype analysis results of the wild type and the ZmDAR1b gene knockout mutant strain. Figure 6 Fig. 1A is a cell area statistical data chart. Figure 6 Fig. 1B is a cell number statistical data chart. Figure 6 Fig. 1C.
[0072] Figure 7 Fig. 2 is the observation results of the ear and kernel of the wild type and the ZmDAR1b gene knockout mutant strain. Figure 7 Fig. 2A is an ear chart. Figure 7 Fig. 2B is a kernel chart. Figure 7 Fig. 2C is a kernel width chart. Figure 7 Fig. 2D is a kernel length chart. Figure 7 Fig. 2E is a kernel width statistical data chart. Figure 7 Fig. 2F is a kernel thickness statistical data chart. Figure 7 Fig. 2G is a kernel hundred-grain weight statistical data chart. Figure 7 Fig. 2H. DETAILED DESCRIPTION
[0073] Embodiment 1
[0074] A ZmDAR1b protein, wherein the amino acid sequence of the ZmDAR1b protein is Sequence 1; the amino acid base sequence of the ZmDAR1b protein is Sequence 2; and the genomic sequence of the ZmDAR1b protein is Sequence 3.
[0075] A method for regulating the plant height of corn by using a ZmDAR1b protein, comprising the following steps:
[0076] S1 cloning a corn gene ZmDAR1b;
[0077] S2 analyzing the tissue expression pattern of the corn gene ZmDAR1b;
[0078] S3 creating a corn ZmDAR1b gene editing knockout mutant.
[0079] The method for cloning the corn gene ZmDAR1b in the step S1 is as follows:
[0080] M1 extracting the total RNA of the corn seed, and then performing reverse transcription;
[0081] M2 designing specific primers according to the cDNA full-length sequence of the ZmDAR1b gene in the B73 corn genome, and then performing a PCR reaction, and sequencing the PCR reaction product, wherein the ZmDAR1b amino acid sequence is Sequence 1, and the nucleic acid sequence of the ZmDAR1b amino acid is Sequence 2.
[0082] The method for extracting the total RNA of the corn seed in the step M1 is as follows:
[0083] (1) Liquid nitrogen quick-freezing grinding sample, using Trizol method to extract total RNA, high temperature heating sterilization inactivation mortar and grinding rod, pre-cooling after liquid nitrogen grinding sample three times to powder, pick up the powder to 2 mL RNA free EP tube, add 1 mL Trizol extraction liquid, place in vortex shaker to mix well, ice on dark for 10 min;
[0084] (2) After adding 500 μL RNA nucleic acid extraction liquid (the volume ratio of sample to RNA nucleic acid extraction liquid is 1:24), vortex for 10 s, mix well, and extract impurities on ice for 10 min;
[0085] (3) Use high-speed benchtop centrifuge 12000xg, 4℃ centrifuge for 10 min;
[0086] (4) Take 600 μL supernatant to a new 1.5 mL RNA free EP tube, add an equal volume of isopropanol, mix well by repeatedly inverting, and stand on ice for 10 min;
[0087] (5) Use high-speed benchtop centrifuge 12000xg, 4℃ centrifuge for 10 min;
[0088] (6) Discard the supernatant, add 1 mL 75wt% ethanol (DEPC water configuration), mix well;
[0089] (7) Use high-speed benchtop centrifuge 12000xg, 4℃ centrifuge for 3 min;
[0090] (8) Repeat steps (6) and (7), use high-speed benchtop centrifuge 12000xg, 4℃ centrifuge for 3 min;
[0091] (9) Dissolve the RNA precipitate with 50 μL DEPC water;
[0092] (10) Measure the concentration ng / uL and OD 260 / 280 value of RNA, and detect the quality of RNA by using nucleic acid gel electrophoresis, and the extracted RNA is stored at -80℃ for use.
[0093] The sequence of the specific primer in step M2 is as follows:
[0094] ZmDAR1b-F: ATGAACTTTAATGCTTTGTCTTATAATA;
[0095] ZmDAR1b-F: GCATGGAAAAGACCCCGTC.
[0096] The method for analyzing the tissue expression pattern of the corn gene ZmDAR1b in step S2 is as follows: according to the full-length coding sequence of the ZmDAR1b gene, a specific quantitative primer is designed, the product length is set within 200 bp, the primer length is set to 20 bp, the Tm value is set to 58-60°C, and the GC% content is 50-60%.
[0097] The specific quantitative primer sequence includes a forward primer and a reverse primer, the forward primer sequence is: TTGTGCTGGATGCAGAAGTC; and the reverse primer sequence is:
[0098] GGAAACGCTCCTTGTAGCAG.
[0099] The template in the tissue expression pattern is a combination of roots, stems, leaves, bracts, female ears, filaments, stamens, pollen, embryos, endosperms, and kernels.
[0100] The method for creating a corn ZmDAR1b gene editing knockout mutant in step S3 is as follows:
[0101] H1 designs a knockout target according to the corn gene ZmDAR1b genomic sequence 3;
[0102] H2 constructs a corn ZmDAR1b gene editing knockout mutant vector;
[0103] H3 genetic transformation of the corn ZmDAR1b gene editing knockout mutant (completed by Wumi Biotechnology (Jiangsu) Co., Ltd.);
[0104] H4 identifies the knockout mode of the corn ZmDAR1b gene in the knockout line;
[0105] H5 detects the expression amount of the corn ZmDAR1b gene in the knockout line.
[0106] The method for designing a knockout target according to the corn gene ZmDAR1b genomic sequence 3 in step H1 is as follows: two target points are selected on the ZmDAR1b protein domain sequence, an expression cassette of double-target sgRNA and Cas9 protein is constructed, and it is inserted into the binary expression vector pCXB-053-CCDB to complete the construction of the CRISPR / Cas9 knockout vector. The CRISPR / Cas9 basic vector (pCXB-053-CCDB vector) is donated by Wumi Biotechnology (Jiangsu) Co., Ltd.
[0107] The sgRNA targeting the ZmDAR1b gene is sgRNA1 and sgRNA2. The nucleotide sequence of the sgRNA1 target site is 5'-TGGAAACGCTCCTTGTAGCAGGG-3', targeting the 1866-1888th nucleotide of sequence 3 of the ZmDAR1b gene; the nucleotide sequence of the sgRNA2 target site is 5'-ATGAAAATGATGGTACACCTAGG-3', targeting the 2098-2120th nucleotide of sequence 3.
[0108] The method for constructing the maize ZmDAR1b gene editing knockout mutant vector in step H2 is as follows: the CCDB sequence in the pCXB-053-CCDB vector is cut off by BSAI enzyme digestion, two independent single-target vectors are first constructed by T4 ligase, and then the sgRNA2 is connected by recombinase to form a double-target knockout vector of ZmDAR1b-sgRNA1-sgRNA2.
[0109] The specific steps of the method for constructing the ZmDAR1b gene editing knockout mutant vector are as follows: 1) synthesizing primers and dissolving them in ultrapure water to mix uniformly; 2) preparing annealing buffer (Tris-HCl 10.0 mM, pH 8.0, EDTA 0.1 mM, NaCl: 50.0 mM); 3) annealing and ligation, annealing buffer 50.0 μL, primer mixture 5.0 μL, 95°C, 3 min, cooling to 16°C).
[0110] The specific method for detecting the expression amount of the maize ZmDAR1b gene in the knockout strain is as follows: wild type and homozygous ZmDAR1b #KO1 , ZmDAR1b #KO2 , ZmDAR1b #KO3 strains are selected respectively, and are planted in a greenhouse. When they grow to five or six leaves, sufficient and well-grown leaves are selected for DNA extraction and RNA extraction respectively, and the extracted RNA is subjected to reverse transcription to obtain cDNA.
[0111] According to the position of the knockout target and in combination with the sequence in sequence 2, primers are designed, and the primer sequences are as follows:
[0112] ZmDAR1b-k-F: CTCTGTTTGGCATCCCGAGT
[0113] ZmDAR1b-k-R: GTAAACATAACACTAACCTCCATCCG
[0114] According to the sequence of sequence 2, quantitative primers are designed, and the quantitative primer sequences are as follows:
[0115] ZmDAR1b-RT-F: TTGGATGCAGAAGTATTGTCCTT
[0116] ZmDAR1b-RT-R: GGCATTCATTGGTCTCCATAATA
[0117] The method of extracting corn leaf genomic DNA is as follows (the raw material is from the kit SteadyPure Plant Genomic DNA Extraction Kit):
[0118] X1 Take 0.1 g of corn leaves for liquid nitrogen grinding, then quickly add 500 μL of Buffer LS-3 and 10 μL of 50×DTT Buffer to the ground sample powder, and then add 10 μL of RNase A,
[0119] shake well and mix;
[0120] X2 Place the centrifuge tube in a 56℃ water bath for heating for 10 min (invert and mix during heating);
[0121] X3 Add 62.5 μL of Buffer PA and mix well; place on ice for 5 min, and centrifuge at 12000 rpm at room temperature for 5 min; take the supernatant, add Buffer BS-2 in an equal volume to the supernatant, and mix well;
[0122] X4 Transfer the above solution to a centrifugal adsorption column, stand at room temperature for 1 min, then centrifuge at 12000 rpm at room temperature for 1 min, and discard the filtrate;
[0123] X5 Add 500 μL of Buffer WA to the centrifugal adsorption column, centrifuge at 12000 rpm at room temperature for 1 min, and discard the filtrate;
[0124] X6 Add 750 μL of Buffer WB to the centrifugal adsorption column, centrifuge at 12000 rpm at room temperature for 1 min, and discard the filtrate;
[0125] X7 Repeat step X6 once;
[0126] X8 Place the adsorption column on a new 1.5 mL centrifuge tube, add 50 μL of ddH2O at the center of the adsorption column membrane, stand at room temperature for 2 min, then centrifuge at 12000 rpm at room temperature for 2 min, and store the eluted DNA sample at -20℃ for use.
[0127] Performance test
[0128] 1. The expression test results of ZmDAR1b gene in different tissues of corn, the test results are shown in Figure 1The results show that the ZmDAR1b gene is expressed in different tissues of corn, with the highest expression in roots, stem nodes, leaves and filaments, and also expressed in kernels, suggesting that the gene plays an important role in regulating corn height and organ development.
[0129] 2. Three knockout modes of ZmDAR1b gene in knockout lines were detected by PCR amplification (such as Figure 2 A), and all three modes appeared premature termination of translation. Through real-time fluorescent quantitative PCR experiment, the results show that the expression of ZmDAR1b gene in three knockout modes of corn is less than 0.5 compared with wild type (such as Figure 2 B), indicating that the knockout material can be further observed for phenotype.
[0130] 3. Phenotypic analysis of ZmDAR1b gene knockout mutant plant height:
[0131] Select wild type KN5585 and ZmDAR1b gene knockout mutant lines, and plant them in large area in the corn molecular breeding base of Nongcuiyuan of Anhui Agricultural University. Measure the plant height 20 days after pollination. Compared with the wild type, ZmDAR1b #KO1 is slightly higher but not significant, ZmDAR1b #KO2 and ZmDAR1b #KO3 are significantly higher than the wild type (such as Figure 3 ), and the physical map is shown in Figure 3 A, and the data analysis chart is shown in Figure 3 B. It is shown that reducing the expression of ZmDAR1b gene or inhibiting the activity of ZmDAR1b protein is helpful to promote the development of corn plant height, and thus increase the biomass of corn.
[0132] 4. Phenotypic analysis of ZmDAR1b gene knockout mutant stem node:
[0133] Select different ZmDAR1b gene knockout mutant lines and wild type 20 days after pollination, strip the stems and decompose them, measure all stem nodes except the tassel, and compare and analyze with the wild type (such as Figure 4 ). The physical map is shown in Figure 4 A, and the data analysis chart is shown in Figure 4 B. The results show that compared with the wild type, the stem length at the tassel position of ZmDAR1b #KO1 is significantly greater than that of the wild type; compared with the wild type, the stem length at the tassel position and above of ZmDAR1b #KO2 and ZmDAR1b #KO3 are significantly greater than that of the wild type. The results show that reducing the expression of ZmDAR1b or inhibiting the activity of ZmDAR1b promotes the elongation of the stem.
[0134] 5. Leaf phenotype analysis of ZmDAR1b gene knockout mutants
[0135] Different ZmDAR1b gene knockout mutant lines and wild type after powdering were selected, and the ear leaves and the leaves above and below each three places were measured and analyzed (such as Figure 5 ). The actual figure is shown in Figure 5 A, the leaf length data analysis chart is shown in Figure 5 B, and the leaf width statistical data is shown in Figure 5 C. The results show that compared with the wild type, the leaf length of ZmDAR1b #KO2 and ZmDAR1b #KO3 above the ear is significantly increased, and the leaf width is slightly increased, and the leaf width at L+3 is significantly different. The leaf length and width of ZmDAR1b #KO1 above the ear are slightly increased, but the difference is not obvious, which shows that reducing the expression of ZmDAR1b or inhibiting the activity of ZmDAR1b promotes the elongation of the leaf.
[0136] 6. Leaf epidermal cell phenotype analysis of ZmDAR1b gene knockout mutants
[0137] In order to more clearly understand the difference in leaf phenotype, the leaf epidermal cells of different lines at the same position (L+3) were observed, and the leaf epidermal cell observation method was as follows:
[0138] (1) Take the mature corn leaves, cut into 5mm x 5mm size, and put into 2.0mL centrifuge tube;
[0139] (2) Add appropriate amount of decolorizing solution (75wt% ethanol and 25wt% acetic acid), and stand at room temperature overnight;
[0140] (3) Discard the decolorizing solution, add appropriate amount of alkaline solution (7wt% sodium hydroxide and 60wt% ethanol), and stand for 15min;
[0141] (4) Gradient ethanol (40wt%, 20wt%, 10wt%) rehydration, 15min / time, room temperature;
[0142] (5) (5wt% ethanol and 25wt% glycerol) room temperature for 30min;
[0143] (6) The sample is stored in 50wt% glycerol;
[0144] (7) Optical microscope observation.
[0145] The results show that the leaf epidermal cell area of ZmDAR1b gene knockout mutant is significantly increased, and the leaf epidermal cell number is significantly reduced (such as Figure 6 ). The actual figure is shown in Figure 6A, cell area data analysis chart see Figure 6 B, cell number statistics data see Figure 6 C. These results show that reducing the expression of ZmDAR1b or inhibiting the activity of ZmDAR1b promotes the expansion of leaf cells and thus affects the size of the leaf.
[0146] 7. The effect of ZmDAR1b gene on kernel development:
[0147] Different strains of corn ears were harvested and dried to constant weight, and then the corn kernels were measured and analyzed (such as Figure 7 ). Ear chart see Figure 7 A, kernel chart see Figure 7 B, kernel width chart see Figure 7 C, kernel length chart see Figure 7 D, kernel length statistics chart see Figure 7 E, kernel width statistics chart see Figure 7 F, kernel thickness statistics chart see Figure 7 G, kernel hundred-grain weight statistics chart see Figure 7 ). The results show that the length of the kernel of the ZmDAR1b knockout mutant is reduced compared with the wild type, especially the ZmDAR1b #KO3 The kernel length is significantly reduced, the kernel width of the ZmDAR1b knockout mutant is not significantly different from the wild type, and the kernel thickness is significantly greater than the wild type, which leads to the kernel hundred-grain weight of the ZmDAR1b gene mutant to increase by 1.79%, 6.94%, and 8.32% compared with the wild type. In summary, ZmDAR1b gene plays an important role in regulating kernel size.
[0148] SEQUENCE LISTING
[0149] <110> Anhui Agricultural University
[0150] <120> Method of ZmDAR1b protein in regulating corn plant height and organ size
[0151] <141> 2024-04-11
[0152] <160> 2
[0153] <170> Maize ZmDAR1 family ZmDAR1b gene
[0154] <210> 1
[0155] <211> 776
[0156] <212> cRNA
[0157] <213> Zea mays
[0158] <400>1
[0159] ATGAACTTTAATGCTTTGTCTTATAATAATGAACCAGATATTGGTCATAACCT
[0160] AGCTGAAGACGAACAGCTTGCACGGGCTCTGCAAGAAAGTATGAATG 60
[0161] ATGGACCTCCTCGTCAGCACATTCCAGTTGAAGATGTTAACTCAGAAAGTA
[0162] CTCCAGCAAGCATCTTGCCCTCAAATATTTTCCGCACAAGTGGCTTGAG 120
[0163] GGTTTGTGCTGGATGCAGAAGTCCAATTGGCCGCGGTCGGTTTCTCAGTTG
[0164] TATGGACTCTGTTTGGCATCCCGAGTGCTTCAGGTGTTATGCTTGTGAT 180
[0165] AGACCAATATCAGAGTATGAGTTTGCTGTTCATGAAAACCATGCCTACCAC AGGCCCTGCTACAAGGAGCGTTTCCATCCTAAATGTGATGTTTGCAGTA 240
[0166] GCTTTATTCCCACAGATAAAAATGGCCTCATTGAATACCGGGCCCATCCTTT
[0167] TTGGATGCAGAAGTATTGTCCTTCCCATGAAAATGATGGTACACCTAG 300
[0168] GTGCTGCAGTTGTGAACGAATGGAGCCAAAGGACAGTCAATACATAACATT
[0169] AGATGATGGCCGGAGACTCTGCTTGGAGTGTCTGCATACTGCTATTATG 360
[0170] GAGACCAATGAATGCCAGCCACTGTACATTGATATTCAAGAATTTTATGAGG
[0171] GTATGAACATGAAAGTAGAGCAACAAGTTCCCTTGCTTTTGGTTGAGC 420
[0172] GACAAGCTTTAAATGAAGCCATGGAAGCAGAGAAATCTGTGCACCACCTT
[0173] CCTGAAACAAGAGGCCTCTGCCTATCTGAGGAGCAGATTGTCAGAACTAT 480
[0174] ATTGAAAGGACCAATTGGACCAGGCAACAGAATCATAGATATGGTCACAGG
[0175] ACCATACAAACTCATTAGACGGTGTGAAGTGACTGCAATTCTTATACTG 540
[0176] TACGGGCTGCCAAGGCTGCTAACTGGCTCGATTCTGGCTCATGAGATGATG
[0177] CATGCTTACCTCCGACTTAAAGGATACCGAACCCTGAGTCCAGAGGTTG 600
[0178] AAGAAGGCATCTGTCAGGTTCTAGCTCATCTTTGGCTTGAGTCAGAAATCA
[0179] CATCAGGTTCTGGTAGCATGTCAACCACCTCAGATGCGTCATCGTCATC 660
[0180] TTCAACATCTTCATCATCGAAAAAGGGCGCAAAGACGGAATTTGAAAAAA
[0181] GACTCGGGGAGTTCTTCAAGTACCAAATTGAAACAGATTCTTCTGTCGCT 720
[0182] TATGGAGATGGGTTTCGAGCAGGCATGCGAGCCATTGAGCGGTACGGCTTG
[0183] AGAAGCACCCTTGATCATATCAAGATGACGGGGTCTTTTCCATGC 776
[0185] <210>2
[0186] <211>776
[0187] <212>cRNA
[0188] <213>Zea mays
[0189] <400>2
[0190] ATGAACTTTAATGCTTTGTCTTATAATAATGAACCAGATATTGGTCATAACCT
[0191] AGCTGAAGACGAACAGCTTGCACGGGCTCTGCAAGAAAGTATGAATG 60
[0192] ATGGACCTCCTCGTCAGCACATTCCAGTTGAAGATGTTAACTCAGAAAGTA<AAGATTGTTGAGTAAGACCACTCACACAATCATCGGGACACAAACTGA 240
[0199] GTTCAATTAAGTAATTATTGAACACATGTTATGAGGTACTTATTGGGGATGCT GCCTTCGCTGTTCTTAATAGAAAGTCTAGAATACCCCTAAGCTACCA 300
[0201] TTTACAACCCTTCTTATACTCAAGGGCATAGTAGTCATTACATCTTTGATTCG
[0202] GTGTTTTATATGTCACAAGTGACCTTCGGGTAGGGAGCATCAGCGAC 360
[0204] GAGGCTTCACGTTTTGAAGATAAGTCACACTGCTTCCATCCGCTTTGACTTC ACCTAGAAGCGAACAAGTGACTACATCTTCCGAACTGCAGCGAAGTGA 420
[0205] ACTGGGTGACGTTGTGCACTCTCTGTCTTCGCACTCAAGCGAAATGGTCTG
[0206] ACTGTCTTAGCTTTCTCCCTTCATTTCTCCAGACAAAGATACTTCTAAA 480
[0207] AACAAGCATTAACAAAGCTACTATTAGTTCTGACCGAAGTACCGAACCATC GGGGACTGTTTGTGCGAGGTCAAATCCCCAACAAAGATACTTCTGATAA 540
[0208] TCAGACGTGTTAAGACTTGGATCCATAGCATTAGCTTTTTGGTTTCTTACAC
[0209] ACAACAAAAA ACAACAACTG AGTTTGGGTT CTACGGCTAC ACTTTGAG 600
[0210] TTTCTAGAAG CACCATTTGT TCTGGAAACA GGATACGACT GCAAACTCAT AT
[0211] ATTCCAAAGGCTACCCAAGTGTGATATATATTATAAAAAACTCAACTT 660
[0213] GTGGGGGGTA AGACAGCCTC TCGGGCATTG TATTAAGAAG AAGACTTTCT C
[0214] ACACAGGTCG AGAAAACCCC CGAATCCCTG CCCACCCATA CACAGCGG 720
[0215] CACTGTAGCC ATGTGAGAAC GACCGCGACC GGGGCCGGGC CTTAGACCTG
[0216] TGCTTTTGGC GTGGGACAGA CGAGTGGATT TTTTTAAACC CCGGCCTGAA A 780
[0217] TTCGCTCCCACGGGAAGTCGAACACAAGACCTGAGGAGTGCAACTCAAAC
[0218] CACCTAACCA ACTCAGCTAG ATGCCCTTTC GCTGATATAT ATTATAGAAT 840
[0219] GAGCTAGTA TTCAAAGAAG GCTAGATACA GAAGTATAAT ATGGCTCAGA TTG
[0220] TCTACATCTAATACTATAGTATTACTTCACTGGATATGCAACATGGAT 900
[0222] CAATTTGTCT GATTATCTGA GCCTTGTTCT AGTGTGACGG AGAATTTTAT CAT
[0223] CTGATTTTCTCTCATTCTCTCTGATTAAGCTTTTTCTGGTCTATAAT 960
[0225] TTTTGTGTATCTGGTTGCACCACTGCCTTCTGTAGGGTTTGTGCTGGATGCA
[0226] GAAGTCCAATTGGCCGCGGTCGGTTTCTCAGTTGTATGGACTCTGTTT 1020
[0228] GGCATCCCGAGTGCTTCAGGTGTTATGCTTGTGATAGACCAATATCAGAGTA
[0229] TGAGGTATACAATTGAACATTCCTGACCTAACATTCTTCAGCTTCACA 1080
[0230] AGATAATTAACACCAGCCTTTCTCTTTGTAAGTTTGCTGTTCATGAAAACCA TGCCTACCACAGGCCCTGCTACAAGGAGCGTTTCCATCCTAAATGTGA 1140
[0232] TGTTTGCAGTAGCTTTGTAAGCACTCTTCACTTTGATTTGATAGATGAGCTT
[0233] GAAAATTTAGTAGTAAATAATCTTGATTATCCATTTGGTTATTCTTAT 1200
[0235] TTCTGATGGAATTTTGGTAACCAGATTCCCACAGATAAAAATGGCCTCATTG
[0236] AATACCGGGCCCATCCTTTTTGGATGCAGAAGTATTGTCCTTCCCATG 1260
[0238] AAAATGATGGTACACCTAGGTGCTGCAGTTGTGAACGAATGGAGGTTAGTG TTATGTTTACATACAATAATATATATATATATATATATATATATATA 1320
[0240] TATATATATTATTGATGGATTCATAAAAAATAAAATGTGGATCCCAAATGCTAT
[0241] TTCAAATACTCCAGCAGCTGCATTTGTGTGTCTCATTTCAGAAATT 1380
[0243] TACCTGCGAATTTGATGAATTGTATTATCTTGTGCCGCCTATAGCACACATCT
[0244] TCCTGATTTTGGCTTTCCAATGACATTTCCTTCTTTTATTGTTTTGT 1440
[0246] TGTCAACCCTAGCCAAAGGACAGTCAATACATAACATTAGATGATGGCCGG
[0247] AGACTCTGCTTGGAGTGTCTGCATACTGCTATTATGGAGACCAATGAAT 1500
[0248] GCCAGCCACTGTACATTGATATTCAAGAATTTTATGAGGGTATGAACATGAA AGTAGAGCAACAAGTTCCCTTGCTTTTGGTTGAGCGACAAGCTTTAAA 1560
[0250] TGAAGCCATGGAAGCAGAGAAATCTGTAAGTGACACCCTTTCCTTTATTAT
[0251] GTGGTATATATAACATATATCTAATGTACTCTCGTCGATTAGGTGCACC 1620
[0253] ACCTTCCTGAAACAAGAGGCCTCTGCCTATCTGAGGAGCAGATTGTCAGAA
[0254] CTGTATGATCTTAAAACATTTCCTTGTTTTGCTTAATTGGTCTACTGAA 1680
[0255] TTTGTGAGCTTCAAAGCCAATTACGATTAAACATAAATAACATAATGGTATT
[0256] GTCTAGATATTGAAAGGACCAATTGGACCAGGCAACAGAATCATAGAT 1740
[0257] ATGGTCACAGGACCATACAAACTCATTAGACGGTGTGAAGTGACTGCAATT CTTATACTGTACGGGCTGCCAAGGTGATTTTCTCTCTCATTATTTAACA 1800
[0259] AACTAATTACAATTGATGTAGTTTCCCTTTGATGAACGTTGATTCTACTGCC AATCCATGAGAATGCATTCATGTTCTAATTTTAATTTATTTAACTGCA 1860
[0261] TGCAGGCTGCTAACTGGCTCGATTCTGGCTCATGAGATGATGCATGCTTACC
[0262] TCCGACTTAAAGGTATTCTGGTTGTGCCTGTTTATCTACGTTTGCAGC 1920
[0264] ATCCTCTTCATTCTTCGATACCATTCTATGTTTGCACAACAGCAGTATTTACT
[0265] ATCTTAATACTTTTTTTGGGTAGGATACCGAACCCTGAGTCCAGAGG 1980
[0267] TTGAAGAAGGCATCTGTCAGGTTCTAGCTCATCTTTGGCTTGAGTCAGAAA
[0268] TCACATCAGGTTCTGGTAGCATGTCAACCACCTCAGATGCGTCATCGTC 2040
[0269] ATCTTCAACATCTTCATCATCGAAAAAGGGCGCAAAGACGGAATTTGAAAA
[0270] AAGACTCGGGGAGTTCTTCAAGTACCAAATTGAAACAGATTCTTCTGTC 2100
[0271] GCTTATGGAGATGGGTTTCGAGCAGGCATGCGAGCCATTGAGCGGTACGGC
[0272] TTGAGAAGCACCCTTGATCATATCAAGATGACGGGGTCTTTTCCATGCT 2160
[0273] GA 2162
Claims
1. A method for increasing the height of a maize plant by a ZmDAR1b protein, characterized in that, Includes the following steps: S1 clones the maize gene ZmDAR1b; S2 analysis of tissue expression patterns of the maize gene ZmDAR1b; S3 was used to prepare a maize ZmDAR1b gene-edited knockout mutant; The amino acid sequence of the ZmDAR1b protein is shown in SEQ ID No.
1.
2. The method for increasing the height of a maize plant by ZmDARlb protein according to claim 1, characterized in that, The method for cloning the maize gene ZmDAR1b in step S1 is as follows: Total RNA was extracted from maize seeds using M1 and then reverse transcribed. Based on the full-length cDNA sequence of the ZmDAR1b gene in the B73 maize genome, M2 designed specific primers, then performed a PCR reaction, and sequenced the PCR product. The nucleic acid sequence encoding ZmDAR1b is shown in SEQ ID No.
2.
3. The method for increasing the height of a maize plant by ZmDARlb protein according to claim 2, characterized in that, The sequences of the specific primers in step M2 are as follows: ZmDAR1b-F: ATGAACTTTAATGCTTTGTCTTATAATA; ZmDAR1b-R:GCATGGAAAAGACCCGTC.
4. The method for increasing the height of a maize plant by ZmDARlb protein according to claim 1, characterized in that, The method for analyzing the tissue expression pattern of the maize gene ZmDAR1b in step S2 is as follows: Based on the full-length coding sequence of the ZmDAR1b gene, specific quantitative primers are designed, the product length is set to be within 200 bp, the primer length is set to 20 bp, the Tm value is set to 58℃-60℃, and the GC content is 50%-60%.
5. The method for increasing the height of a maize plant by ZmDARlb protein according to claim 4, characterized in that, The specific quantitative primers include a forward primer and a reverse primer. The forward primer sequence is: TTGTGCTGGATGCAGAAGTC; the reverse primer sequence is: GGAAACGCTCCTTGTAGCAG.
6. The method for increasing maize plant height using ZmDAR1b protein according to claim 1, characterized in that, The method for preparing the maize ZmDAR1b gene editing knockout mutant in step S3 is as follows: H1 designed a knockout target based on SEQ ID No. 3 of the maize gene ZmDAR1b genome; Construction of H2 maize ZmDAR1b gene editing knockout mutant vector; Genetic transformation of H3 maize ZmDAR1b gene-edited knockout mutant; Identification of the knockout mechanism of the H4 maize ZmDAR1b gene in knockout lines; Expression level of H5 maize ZmDAR1b gene in knockout lines.
7. The method for increasing maize plant height using ZmDAR1b protein according to claim 6, characterized in that, The method for designing knockout target sites based on SEQ ID No. 3 of the maize gene ZmDAR1b genome in step H1 is as follows: Two target sites are selected on the ZmDAR1b protein domain sequence to construct a dual-target sgRNA and Cas9 protein expression cassette, which is then inserted into the binary expression vector pCXB-053-CCDB to complete the construction of the CRISPR / Cas9 knockout vector.
8. The method for increasing maize plant height using ZmDAR1b protein according to claim 7, characterized in that, The method for constructing the maize ZmDAR1b gene editing knockout mutant vector in step H2 is as follows: The CCDB sequence in the pCXB-053-CCDB vector is removed by BSAI digestion. Two independent single-target vectors are constructed by T4 ligase, and then ligated by recombinase to form a dual-target knockout vector of ZmDAR1b-sgRNA1-sgRNA2.
9. A method for regulating maize organ size via ZmDAR1b protein, characterized in that, Reducing the expression of ZmDAR1b protein can increase stem segment length or promote leaf elongation; the amino acid sequence of the ZmDAR1b protein is shown in SEQ ID No. 1.
Citation Information
Patent Citations
Method for inhibiting corn ZmDAR1 family gene expression to increase yield of core grains
CN105349574A
Application of protein ZmERF018 and coding gene thereof in corn drought response
CN117778457A