Application of BoEDR1 gene in Brassica vegetables against fungal diseases, gene editing system and expression vector

By using CRISPR/Cas9 technology to target and edit the BoEDR1 gene, inhibiting its expression and promoting salicylic acid synthesis, the problem of fungal diseases in broccoli cultivation was solved, resistance was improved, and breeding resources were provided.

CN118599900BActive Publication Date: 2026-08-25ZHEJIANG MITSUO SEED CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410872487.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-01
Publication Date
2026-08-25
Estimated Expiration
2044-07-01

AI Technical Summary

Technical Problem

Black spot and other fungal diseases are serious problems in broccoli cultivation. Current technology makes it difficult to obtain resistant materials through distant hybridization, which affects yield and marketability.

Method used

Using the BoEDR1 gene editing system, the EDR1 gene of Brassica vegetables was targeted and edited using CRISPR/Cas9 technology to inhibit its expression, promote salicylic acid synthesis, and improve resistance to fungal diseases.

Benefits of technology

The mutant plants obtained showed significant resistance to fungal diseases, improving the disease resistance of Brassica vegetables and providing new breeding resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118599900B_ABST
    Figure CN118599900B_ABST
Patent Text Reader

Abstract

The application discloses application of a BoEDR1 gene in resistance of Brassica vegetables to fungal diseases, a gene editing system and an expression vector, and relates to the technical field of plant molecular biology. A nucleotide sequence of the BoEDR1 gene is shown in SEQ ID No: 6, or a nucleotide after gene mutation of the nucleotide sequence shown in SEQ ID No: 6; the Brassica vegetables are selected from broccoli, cabbage, cauliflower, Chinese cabbage, kale and cabbage. By inhibiting the expression of the EDR1 gene, the Brassica vegetables can exhibit resistance to fungal diseases, and the application provides a good resource for cultivating the Brassica vegetables resistant to the fungal diseases. The EDR1 gene in the genome of the Brassica vegetables can be targeted by the gene editing system or the expression vector, and the system has the advantages of wide targeting range and wide application range, and the editing efficiency of the system for the target site DNA can reach 41%, so the system has the characteristics of high editing efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant molecular biology, and more specifically, to the application of the BoEDR1 gene in the resistance of Brassica vegetables to fungal diseases, gene editing systems, and expression vectors. Background Technology

[0002] Broccoli ( Brassica oleracea L. var. italica Broccoli, also known as Chinese broccoli, is hailed as the "crown of vegetables" due to its superior average nutritional value and disease-preventing effects compared to other vegetables. In recent years, with increasing consumer demand and expanding planting areas, crop rotation periods have become shorter, leading to a growing trend of pathogen damage and posing a significant threat to broccoli cultivation.

[0003] Black spot disease is a common disease in broccoli cultivation, occurring prevalent in both low- and high-latitude regions. In low-latitude areas, the disease is generally severe in spring (April-May) and autumn (September-October), while in high-latitude areas, it is severe in summer and autumn, especially during the later stages of broccoli growth. The pathogen causing black spot disease infects the leaves, stems, pods, and flower heads, forming concentric rings of grayish-brown to dark brown, nearly circular lesions. This significantly reduces the quality and yield of the vegetables, particularly impacting the marketability of broccoli where the flower head is the edible part.

[0004] Broccoli originated in the arid Mediterranean region of Italy. As a highly differentiated Brassica oleracea crop, its genetic resources are very limited, especially among commercially available broccoli varieties, which are highly similar and generally lack strong disease resistance. Currently, no highly resistant materials to black spot disease have been found among cultivated Brassica species, making it impossible to breed resistant materials from closely related species through distant hybridization. Therefore, researching and utilizing plant immune genes and pathogen-pathogen interaction genes using biotechnology is of great scientific and practical significance for improving the disease resistance, quality, and economic benefits of broccoli, and for ensuring a balanced vegetable supply in my country.

[0005] In view of this, the present invention is proposed. Summary of the Invention

[0006] The purpose of this invention is to provide the application of the BoEDR1 gene in the resistance of Brassica vegetables to fungal diseases, a gene editing system and an expression vector to solve the above-mentioned technical problems, and to provide new material resources and ideas for disease resistance breeding of Brassica vegetables.

[0007] This invention is implemented as follows: In a first aspect, the present invention provides the application of the BoEDR1 gene in improving the resistance of Brassica vegetables to fungal diseases or in cultivating Brassica vegetables resistant to fungal diseases. The nucleotide sequence of the BoEDR1 gene is shown in SEQ ID No:6, or the nucleotide sequence shown in SEQ ID No:6 after gene mutation. The Brassica vegetables are selected from broccoli, cabbage, cauliflower, Chinese cabbage, kale, and rapeseed.

[0008] Secondly, the present invention provides a Brassica vegetable CRISPR / Cas9 gene editing system, comprising: Cas9 protein and sgRNA, wherein the nucleotide sequence of sgRNA is shown in SEQ ID NO:1; the Brassica vegetable is selected from broccoli, cabbage, cauliflower, Chinese cabbage, kale and rapeseed.

[0009] Thirdly, the present invention also provides an expression vector for a CRISPR / Cas9 gene editing system for Brassica vegetables. The expression vector is a plasmid comprising a nucleotide sequence of sgRNA and a gene sequence encoding Cas9 protein. The nucleotide sequence of sgRNA is shown in SEQ ID NO:1. The Brassica vegetables are selected from broccoli, cabbage, cauliflower, Chinese cabbage, kale, and rapeseed.

[0010] Fourthly, the present invention also provides a kit or host cell for gene editing, the kit comprising: a Brassica vegetable CRISPR / Cas9 gene editing system or expression vector; The host cell includes the expression vector; Brassica vegetables are selected from broccoli, cabbage, cauliflower, Chinese cabbage, kale, and rapeseed.

[0011] Fifthly, the present invention also provides a method for improving the resistance of Brassica vegetables to fungal diseases or a method for cultivating Brassica vegetables resistant to fungal diseases, comprising: inhibiting the expression of the BoEDR1 gene in Brassica vegetables; the nucleotide sequence of the BoEDR1 gene is shown in SEQ ID No:6; the Brassica vegetables are selected from broccoli, cabbage, cauliflower, Chinese cabbage, kale, and rapeseed.

[0012] The present invention has the following beneficial effects: This invention provides a novel application of the BoEDR1 gene in enhancing the resistance of Brassica vegetables to fungal diseases or in cultivating fungus-resistant Brassica vegetables. By inhibiting the expression of the BoEDR1 gene, mutant plants exhibit resistance to fungal diseases. The EDR1 gene can negatively regulate the resistance immunity of Brassica vegetables via the salicylic acid pathway. Knocking out the EDR1 gene using gene editing and other technologies can promote salicylic acid synthesis, thereby enhancing the resistance of Brassica vegetables to fungal diseases. Therefore, this invention provides a valuable resource for cultivating fungus-resistant cruciferous plants.

[0013] The present invention also provides a CRISPR / Cas9 gene editing system for Brassica vegetables, which includes a specific sgRNA sequence that can target the BoEDR1 gene in the genome of Brassica vegetables. The system has an editing efficiency of up to 41% for the target site DNA, thus exhibiting high editing efficiency.

[0014] The gene editing system and expression vector described above can target the EDR1 gene in the genome of Brassica vegetables, and the construction method of the expression vector is simple and rapid. The mutant plants obtained by knocking out the EDR1 gene exhibit resistance to fungal diseases.

[0015] In addition, a kit and host cell for gene editing are provided. The kit has high editing activity and can be widely used in the field of gene editing of Brassica vegetables. Attached Figure Description

[0016] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 Schematic diagram of the BoEDR1 gene editing expression vector for broccoli; Figure 2 A schematic diagram illustrating the transgenic detection of resistant broccoli plants; Figure 3 Direct sequencing peak diagram of PCR products targeting the BoEDR1 gene site in broccoli; Figure 4 Figure showing the results of black spot disease resistance identification in broccoli BoEDR1 gene knockout plants; Figure 5 This is a graph showing the alignment results of the BoEDR1 gene in the NCBI database. Detailed Implementation

[0018] Reference will now be made to detailed embodiments of the present invention, one or more of which are described below. Each example is provided for explanation and not for limitation of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made to the invention without departing from its scope or spirit. For example, features described or illustrated as part of one embodiment may be used in another embodiment to produce further embodiments.

[0019] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. While any methods and materials similar to or equivalent to those described herein may be used in the practice or testing of formulations or unit doses herein, some methods and materials are described hereby. Unless otherwise stated, the techniques employed or considered herein are standard methods. Materials, methods, and examples are illustrative and not limiting in nature.

[0020] Unless otherwise specified, the practice of this invention will employ conventional techniques of plant physiology, plant molecular genetics, cell biology, molecular biology (including recombination techniques), microbiology, biochemistry, and immunology, which are within the capabilities of those skilled in the art. This technique is well explained in the literature, such as *Molecular Cloning: A Laboratory Manual*, 2nd edition (Sambrook et al., 1989); *Oligonucleotide Synthesis* (edited by M.J. Gait, 1984); *Plant Physiology* (Cang Jing et al., 2017); *Methods in Enzymology* (Academic Press, Inc.); *Handbook of Experimental Immunology* (edited by D.M. Weir and C.C. Blackwell); *Current Protocols in Molecular Biology* (edited by F.M. Ausubel et al., 1987); *Plant Molecular Genetics* (by Monica A. Hughes et al.); and *PCR: The Polymerase Chain Reaction* (edited by Mullis et al., 1994). Each of these references is explicitly incorporated herein by reference.

[0021] The EDR1 (Enhanced Disease Resistance 1) gene interacts with MKK4 and MKK5, acting as a negative regulator at the top of the MAPK cascade and activating it, regulating plant innate immunity via the salicylic acid pathway. However, the function of the EDR1 gene in regulating plant immunity or resistance in Brassica vegetables such as broccoli remains unknown. Therefore, cloning and screening EDR1 genes in Brassica vegetables using molecular biology techniques and revealing their biological functions through genetic engineering can provide new material resources and ideas for disease resistance breeding in Brassica vegetables.

[0022] In a first aspect, the present invention provides an application of the BoEDR1 gene in improving the resistance of Brassica vegetables to fungal diseases or in cultivating Brassica vegetables resistant to fungal diseases. The nucleotide sequence of the BoEDR1 gene is shown in SEQ ID No:6, or the nucleotide sequence shown in SEQ ID No:6 after gene mutation. The Brassica vegetables are selected from broccoli, cabbage, cauliflower, Chinese cabbage, kale, and rapeseed.

[0023] By editing genes to cause the endogenous BoEDR1 gene in Brassica vegetables to lose its function, or by introducing nucleotides encoding the BoEDR1 gene through hybridization, the endogenous BoEDR1 gene in Brassica vegetables can also lose or partially lose its function, thereby making Brassica vegetables resistant to fungal diseases. This invention provides resources for breeding new varieties of Brassica vegetables.

[0024] In a preferred embodiment of the present invention, gene mutation is caused by substitution, deletion, or insertion. The length of a deletion mutation can range from 1 nucleotide to over 100 nucleotides, including, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 4 The numbers 8, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, and 100 are listed. Such deletions can lead to almost no expression of the gene (RNA and / or protein), and the target protein will have no activity or reduced activity.

[0025] In a preferred embodiment of the present invention, the fungal disease is selected from at least one of black spot disease and downy mildew.

[0026] In a preferred embodiment of the present invention, the application includes any of the following: (1) When the nucleotide sequence of the BoEDR1 gene is as shown in SEQ ID No:6, the endogenous BoEDR1 gene of Brassica vegetables is genetically modified so that it is not expressed, is not expressed at all, or the function of the BoEDR1 protein is partially or completely lost. (2) When the nucleotide sequence of the BoEDR1 gene is obtained by gene mutation from the nucleotide sequence shown in SEQ ID No:6, the obtained BoEDR1 gene mutation is introduced into Brassica vegetable cells.

[0027] In a preferred embodiment of the present invention, gene modification of the endogenous BoEDR1 gene of Brassica vegetables refers to gene modification using gene editing technology. In a preferred embodiment of the present invention, the gene editing technology is zinc finger endonuclease technology, transcription activator effector nuclease technology, or CRISPR / Cas9 technology.

[0028] In one alternative implementation, the method introduced is selected from genetic transformation methods or genome editing methods.

[0029] The aforementioned genetic transformation methods include, but are not limited to, producing improved individuals with the purple trait through self-pollination of parent plants carrying the BoEDR1 mutant gene of Brassica vegetables (such as broccoli) or hybridization with other Brassica vegetable individuals (such as broccoli). In other embodiments, the aforementioned transformation methods include, but are not limited to, Agrobacterium-mediated gene transformation, gene gun transformation, and pollen tube pathway transformation.

[0030] Genome editing or gene mutation methods refer to the modifications made to target plants using conventional transgenic or gene editing techniques (such as zinc-finger nucleases, transcription activator-like effector nucleases, or CRISPR / Cas9) to induce the BoEDR1 mutant gene in Brassica vegetables, thereby obtaining the purple trait and improving new varieties. Therefore, regardless of the technique used, as long as it utilizes the BoEDR1 mutant gene in Brassica vegetables provided by this invention to confer resistance to fungal diseases, it falls within the scope of protection of this invention. Secondly, this invention provides a CRISPR / Cas9 gene editing system for Brassica vegetables, comprising: a Cas9 protein and sgRNA, the nucleotide sequence of which is shown in SEQ ID NO:1, specifically CCGCGAATCCTCAATCAGCC. This sgRNA targets the EDR1 (Enhanced Disease Resistance 1) gene in Brassica vegetables. This system achieves recognition, localization, cleavage, and gene editing of the target DNA through the combined action of the Cas9 protein and sgRNA. The Brassica vegetables are selected from broccoli, cabbage, cauliflower, Chinese cabbage, kale, and flowering cabbage.

[0031] The BoEDR1 gene of broccoli was cloned by inferring the gene sequence of Arabidopsis thaliana, which has the advantages of being simple and quick.

[0032] The inventors conducted homology analysis on the EDR1 gene of different Brassica genus vegetables, and the results are as follows: Figure 5 As shown in the diagram, the comparison results indicate that the EDR1 gene exhibits high homology and is relatively conserved among Brassica vegetables. Therefore, as long as the target site is CCGCGAATCCTCAATCAGCC, those skilled in the art can expect that the sgRNA in the CRISPR / Cas9 gene editing system of this invention can target the EDR1 gene in plants belonging to the same family, including but not limited to broccoli and cabbage, thereby achieving gene editing of the EDR1 gene.

[0033] In an alternative implementation, the nucleotide sequence of the sgRNA may also be the reverse complementary sequence of the sequence shown in SEQ ID NO:1.

[0034] In a preferred embodiment of the present invention, the amino acid sequence of the Cas9 protein is shown in SEQ ID NO:7.

[0035] Thirdly, this invention provides an expression vector for a CRISPR / Cas9 gene editing system in Brassica vegetables. The expression vector is a plasmid comprising a nucleotide sequence of sgRNA and a gene sequence encoding the Cas9 protein; the nucleotide sequence of the sgRNA is shown in SEQ ID NO:1. The Brassica vegetables are selected from broccoli, cabbage, cauliflower, Chinese cabbage, kale, and flowering cabbage.

[0036] The term "expression vector" refers to bacterial plasmids, yeast plasmids, or other vectors well known in the art. Any plasmid and vector can be used as long as it can replicate and remain stable within a host. An important characteristic of expression vectors is that they typically contain an origin of replication, a promoter, a marker gene, and translational control elements.

[0037] In a preferred embodiment of the present invention, the vector is a bacterial vector, such as an Escherichia coli or Agrobacterium expression vector.

[0038] In addition, the expression vector preferably contains one or more selective marker genes to provide phenotypic traits for selecting host cells for transformation, such as dihydrofolate reductase, neomycin resistance, and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline, ampicillin, kanamycin resistance, and carbenicillin resistance for Escherichia coli.

[0039] In an alternative embodiment, the expression vector may further include a signal peptide, such as a nuclear localization signal peptide. It may also include elements for controlling the expression of sgRNA or Cas9 protein; these expression control elements may be promoters, terminators, and / or enhancers.

[0040] In a preferred embodiment of this invention, the expression vector is obtained by ligating the nucleotide sequence of sgRNA to a base vector containing an expression cassette encoding the Cas9 protein. Specifically, the base vector containing the Cas9 protein expression cassette is pCAMBIA2301 (laboratory-preserved), wherein the Cas9 protein expression cassette was donated by Academician Liu Yaoguang of South China Agricultural University. The ligation method includes, but is not limited to, enzyme digestion ligation, seamless cloning, etc.

[0041] In a preferred embodiment of the present invention, the expression carrier includes the following elements: The gene sequence encoding the Cas9 protein expression cassette, the promoter that initiates sgRNA expression, the nucleotide sequence of the sgRNA, and the terminator that terminates sgRNA expression.

[0042] In a preferred embodiment of the present invention, the promoter for initiating sgRNA expression is selected from any one of AtU6-1, AtU6-26, AtU3b, and AtU6-29. In a preferred embodiment of the present invention, the terminator for terminating sgRNA expression is Tsp.

[0043] In a preferred embodiment of the present invention, the gene sequence encoding the Cas9 protein expression cassette includes a promoter for initiating Cas9 protein expression, a Cas9 protein coding sequence, and a terminator for terminating Cas9 protein expression. In a preferred embodiment of the present invention, the promoter for initiating Cas9 protein expression is selected from any one of 35S, Ubi, UBQ, SPL, CmYLCV and tissue-specific promoters YAO, CDC45, rbcS, inducible promoter XEV, or combinations thereof.

[0044] In a preferred embodiment of the present invention, the gene sequence encoding the Cas9 protein expression cassette has a type II restriction endonuclease recognition sequence 1 between it and the promoter that initiates sgRNA expression, and a type II restriction endonuclease recognition sequence 2 is present at the 3' end of the terminator that terminates sgRNA expression.

[0045] Type II restriction endonucleases specifically recognize rotationally symmetric nucleic acid sequences (also known as palindromic sequences) of tetranucleotides or hexanucleotides, and cleave the phosphodiester bonds in the DNA double strand at specific nucleotides within the recognition region, producing a defined restriction fragment and a gel-forming band. Type II restriction endonucleases are small monomeric proteins, requiring only Mg2+ to recognize and cleave double-stranded DNA molecules.2+ It is sufficient if it exists. This includes, but is not limited to, BamHI, KpnI, EcoRI, EcoRV, HindⅢ, NotI, XhoI, SbfI, and SacI.

[0046] In a preferred embodiment of the present invention, the type II restriction endonuclease corresponding to type II restriction endonuclease recognition sequence 1 is NotI; in a preferred embodiment of the present invention, the type II restriction endonuclease corresponding to type II restriction endonuclease recognition sequence 2 is SbfI and SacI.

[0047] Fourthly, the present invention also provides a kit or host cell for gene editing, the kit comprising: the above-described Brassica vegetable CRISPR / Cas9 gene editing system or the above-described expression vector. The Brassica vegetables are selected from broccoli, cabbage, cauliflower, Chinese cabbage, kale, and flowering cabbage.

[0048] The Brassica vegetable CRISPR / Cas9 gene editing system or the above-mentioned expression vector in the kit can be in lyophilized powder, liquid or semi-solid form.

[0049] The host cell includes the expression vectors mentioned above; In a preferred embodiment of the present invention, the host cell is a bacterium or a fungus.

[0050] In a preferred embodiment of the present invention, the bacteria are Agrobacterium, Mycobacterium, Streptomyces, Escherichia coli, or Bacillus subtilis.

[0051] The host cells mentioned above include transformants and transformed cells, which include primary transformed cells and their offspring, regardless of passage number. Offspring may not be entirely identical to parent cells in terms of nucleic acid content, but may contain mutations.

[0052] Fifthly, the present invention provides a method for improving the resistance of Brassica vegetables to fungal diseases or a method for cultivating Brassica vegetables resistant to fungal diseases, comprising: inhibiting the expression of the BoEDR1 gene in Brassica vegetables; the nucleotide sequence of the BoEDR1 gene is shown in SEQ ID No:6; the Brassica vegetables are selected from broccoli, cabbage, cauliflower, Chinese cabbage, kale, and flowering cabbage; In a preferred embodiment of the present invention, the method for inhibiting the expression of the BoEDR1 gene in Brassica vegetables is to knock out, silence, or directionally mutate the BoEDR1 gene in Brassica vegetables, or to introduce nucleotides with gene mutations of the nucleotide sequence shown in SEQ ID No:6 into Brassica vegetable cells through hybridization.

[0053] In a preferred embodiment of the present invention, the knockout, silencing, or targeted mutation of the BoEDR1 gene in Brassica vegetables includes gene editing using the aforementioned broccoli CRISPR / Cas9 gene editing system or the aforementioned expression vector.

[0054] In a preferred embodiment of the present invention, the above-mentioned broccoli CRISPR / Cas9 gene editing system or the above-mentioned expression vector is used to transform and edit broccoli cells. In a preferred embodiment of the present invention, the fungal disease is selected from at least one of black spot and downy mildew; the fungal disease also includes oomycete diseases. Any disease that can reduce the severity of disease in Brassica vegetables, decrease the number of diseased leaves, or shrink diseased lesions is within the scope of application of the present invention.

[0055] In a preferred embodiment of the present invention, the disease is black spot disease.

[0056] In a sixth aspect, the present invention also provides a method for gene editing using the above-mentioned Brassica vegetable CRISPR / Cas9 gene editing system, the above-mentioned expression vector, the above-mentioned kit, or host cells, comprising the following steps: transforming and gene editing Brassica vegetable cells using the above-mentioned broccoli CRISPR / Cas9 gene editing system, the above-mentioned expression vector, the above-mentioned kit, or host cells.

[0057] The inventors' research shows that mutations in the EDR1 gene significantly improve the resistance of Brassica vegetables, such as broccoli, to fungal diseases such as black spot.

[0058] Gene editing can cause mutations such as substitution, deletion, and insertion in the exon sequence of the EDR1 gene in Brassica vegetables, resulting in loss of gene function and enhancing the ability of Brassica vegetables to resist fungal diseases.

[0059] The specific steps include: First, the Brassica oleracea CRISPR / Cas9 gene editing system is delivered to the target DNA environment to be cut, either intracellularly or in vitro. Then, the Cas9 protein in the CRISPR / Cas9 gene editing system recognizes the PAM sequence on the target DNA to be edited in the cell or in vitro. Next, the sgRNA in the CRISPR / Cas9 gene editing system forms a base complementary pair with the target DNA sequence to be edited in the cell or in vitro. Then, the Cas9 protein in the CRISPR / Cas9 gene editing system cuts the target site on the target DNA, causing double-strand breaks, thereby achieving targeted cutting of the target DNA in the in vitro environment. When in the cell, further repair is carried out through intracellular non-homologous end joining repair or homologous recombination repair pathways, thereby completing the gene editing of the target DNA in the cell.

[0060] Transforming host cells with a vector can be done using conventional techniques well known to those skilled in the art.

[0061] In one alternative embodiment, the method for introducing the expression vector into the host cell is selected from genetic transformation methods. In other embodiments, the transformation methods described above include, but are not limited to, Agrobacterium-mediated gene transformation, gene gun transformation, and pollen tube pathway transformation.

[0062] The obtained transformants can be cultured using conventional methods to express the polypeptide encoded by the gene of this invention. Depending on the host cells used, the culture medium can be selected from various conventional media. Culture is carried out under conditions suitable for host cell growth. Once the host cells have grown to an appropriate cell density, the selected promoter is induced using a suitable method (such as temperature adjustment or chemical induction), and the cells are cultured for a further period.

[0063] In a seventh aspect, the present invention also provides the application of the above-described Brassica vegetable CRISPR / Cas9 gene editing system, expression vector, kit, or host cell in gene editing of Brassica vegetables. The Brassica vegetables are selected from broccoli, cabbage, cauliflower, Chinese cabbage, kale, and flowering cabbage.

[0064] In a preferred embodiment of the present invention, the Brassica genus CRISPR / Cas9 gene editing system, expression vector, or host cell is introduced into competent cells of Brassica genus, and then the gene-edited mutant strain is obtained by screening.

[0065] Transforming host cells with a vector can be done using conventional techniques well known to those skilled in the art.

[0066] In one alternative embodiment, the method for introducing the expression vector into the host cell is selected from genetic transformation methods. In other embodiments, the transformation methods described above include, but are not limited to, Agrobacterium-mediated gene transformation, gene gun transformation, and pollen tube pathway transformation.

[0067] The obtained transformants can be cultured using conventional methods to express the polypeptide encoded by the gene of this invention. Depending on the host cells used, the culture medium can be selected from various conventional media. Culture is carried out under conditions suitable for host cell growth. Once the host cells have grown to an appropriate cell density, the selected promoter is induced using a suitable method (such as temperature adjustment or chemical induction), and the cells are cultured for a further period.

[0068] Eighthly, the present invention also provides the application of the above-described Brassica vegetable CRISPR / Cas9 gene editing system, expression vector, kit, or host cell in the cultivation of Brassica vegetables resistant to fungal diseases. The Brassica vegetables are selected from broccoli, cabbage, cauliflower, Chinese cabbage, kale, and flowering cabbage.

[0069] In a preferred embodiment of the present invention, the fungal disease is selected from at least one of black spot, downy mildew and soft rot; In a preferred embodiment of the present invention, the disease is black spot disease.

[0070] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0071] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0072] In this invention, "BoEDR1 gene" and "EDR1 gene" are synonymous.

[0073] Example 1 This embodiment provides a gene editing expression vector for broccoli BoEDR1, and the specific construction method is as follows: (1) Cloning of the BoEDR1 gene sequence of broccoli: A specific primer pair (AtEDR1-F: 5') was designed based on the Arabidopsis thaliana AtEDR1 gene sequence (AT1G08720.1). ATGAAGCATATTTTCAAGAAGC 3' (SEQ ID NO: 2); AtEDR1-R: 5' CCTTGAAAAGCAGAGCACGATGCC 3' (SEQ ID NO:3)) PCR amplification was performed using broccoli DNA as a template. The amplified fragment was cloned into pClone007Simple Vector. Single-clone sequencing yielded a 1045bp partial sequence fragment of the broccoli BoEDR1 gene. The broccoli EDR1 (BolC08g056960.2J) gene sequence was then obtained using the Brassicaceae Database (BRAD), totaling 7492bp (as shown in SEQ ID NO:6), encoding 1200 amino acids.

[0074] (2) Construction of the BoEDR1 gene editing expression vector for broccoli: Target sites for the BoEDR1 gene in broccoli were designed using an online website (http: / / skl.scau.edu.cn). Based on sgRNA design principles, one target site was selected: BoEDR1-T1:5'. CCGCGAATCCTCAATCAGCC 3' (SEQ ID NO:1). Homologous sequences of the restriction enzyme are added to both ends of the target site, and complementary primer pairs for the target site are synthesized. The complementary primer pair corresponding to the target site BoEDR-T1 includes: BoEDR1-T1 F: 5' TGCACCGCGAATCCTCAATCAGCC 3' (SEQ ID NO:4), BoEDR1-T1 R: 5' AAAC GGCTGATTGAGGATTCGCGG 3' (SEQ ID NO:5); As shown in Table 1, the target site complementary primer pair was prepared into a reaction system with a total volume of 10 μL by adding ddH2O. The reaction was then subjected to PCR amplification at 37℃ for 30 min and denatured at 95℃ for 5 min. The temperature was then lowered to 25℃ at a rate of 0.2℃ / s and placed in a refrigerator at 4℃ for more than 1 h. The reaction product was diluted 200 times with ddH2O.

[0075] Table 1. Target site complementary primer reaction system

[0076] The double-stranded Oligo targeting the above-obtained sites was digested with enzymes and ligated into the expression vector pCas9-sgRNA (i.e., the basic vector pCAMBIA2301 containing the Cas9 protein expression cassette, which was donated by Academician Liu Yaoguang of South China Agricultural University). The ligation product was transformed into E. coli DH5α competent cells, plated on LB solid medium with 50 μg / mL kanamycin, and cultured at 37°C for 16 hours. Positive clones were screened to obtain the expression vector pCas9-sgBoEDR1 for BoEDR1 gene editing in broccoli. Figure 1 The amino acid sequence of the Cas9 protein is shown in SEQ ID NO:7.

[0077] The specific steps are as follows: The sgRNA expression cassette of the pCas9-sgRNA vector described above consists of the Arabidopsis U6 promoter, the type II restriction enzyme site (type II restriction enzyme recognition sequence), and the sgRNA arranged sequentially. As shown in Table 2, the pCas9-sgRNA plasmid was digested with BsaI. After agarose gel electrophoresis, the linearized plasmid was recovered. Then, as shown in Table 3, the target site double-stranded Oligo and the digested linearized pCas9-sgRNA plasmid were ligated for 2 hours using T4 ligase. The ligation product was transformed into E. coli DH5α competent cells, plated on LB solid medium containing 50 μg / mL kanamycin, and cultured overnight at 37°C. Positive clones were screened, and the plasmid extracted was the expression vector pCas9-sgBoEDR1 for editing the BoEDR1 gene in broccoli.

[0078] Table 2 Enzyme digestion reaction system

[0079] Table 3 Connection Reaction System

[0080] Example 2 This embodiment provides genetic transformation of an expression vector including the broccoli EDR1 gene editing system. The specific construction method is as follows: (1) The expression vector pCas9-sgBoEDR1 plasmid of broccoli BoEDR1 obtained in Example 1 was transformed into EHA105 Agrobacterium competent cells using the freeze-thaw method.

[0081] (2) Preparation of broccoli explants: Select plump and uniform broccoli seeds, disinfect them with 2% sodium hypochlorite for 2 hours, rinse once with sterile water, disinfect with 75% alcohol for 1 minute, rinse once with sterile water, disinfect with 10% sodium hypochlorite for 15 minutes, and then rinse with sterile water 5-6 times. During the process, shake the seeds continuously to ensure thorough disinfection. Sow the disinfected seeds evenly in 1 / 2 MS solid medium. Culture at 25℃ and under 16h light for 7 days. Cut the hypocotyls of the sterile seedlings into small segments about 1 cm long and pre-culture them on broccoli differentiation medium (MS + 30 g / L sucrose + 10 g / L agar powder + 3.0 mg / L zeatin + 0.1 mg / L NAA pH 5.8) for 2 days.

[0082] Glossary: ​​NAA stands for naphthaleneacetic acid.

[0083] (3) Agrobacterium infection of explants: Single colonies of Agrobacterium were picked and placed in 10 ml of liquid medium containing Kan (50 mg / L) and Rif (50 mg / L), and cultured at 28°C for 2 days on a shaker at 225 rpm. On the day of infection, 600-700 μL of bacterial suspension was added to 50 mL of antibiotic-free YEB liquid and cultured at 28°C and 225 rpm for 4 h with shaking until the OD600 value was approximately 0.6. The cells were centrifuged at 4°C and 4000 rpm for 10 min, the supernatant was discarded, and the cells were resuspended in 20 ml of ice-cold MS liquid medium (MS + 20 g / L sucrose, pH 5.8). Hypocotyls that had been pre-cultured for 2 days were added to the suspension for infection for 15 min. The hypocotyls were transferred to sterile filter paper to blot off excess bacterial suspension, and then transferred to a differentiation culture medium for dark culture for 2 days.

[0084] Glossary: ​​Kan stands for kanamycin; Rif stands for rifampin.

[0085] (4) Explant selection and culture: Hypocotyls cultured in the dark for 2 days were transferred to broccoli medium (MS + 3.0 mg / L zeatin + 0.1 mg / L NAA + 30 g / L sucrose + 10 g / L agar powder + 400 mg / L Cb) and cultured for 7 days. The hypocotyls were then transferred to selection medium (MS + 3.0 mg / L zeatin + 0.1 mg / L NAA + 30 g / L sucrose + 10 g / L agar powder + 400 mg / L Cb + 30 mg / L Kan) and cultured at 25°C under 16 h light conditions for 20 days. The selection medium was then changed every 14-20 days. Adventitious shoots that grew normally in the selection medium were cut off and inserted into medium (MS + 30 g / L sucrose + 7 g / L agar powder + 400 mg / L Cb + 30 mg / L Kan) and cultured for 14 days. The adventitious shoots were then cut off and transferred to rooting medium (MS + 1 mg / L NAA + 30 g / L sucrose + 7 g / L agar powder + 400 mg / L Cb + 30 mg / L Kan) and cultured until the roots grew to 1-2 cm. They were then transplanted into the soil.

[0086] Glossary: ​​Cb stands for carbenicillin.

[0087] Example 3 This embodiment demonstrates the detection of genetically modified broccoli and the screening of mutants.

[0088] Genomic DNA was extracted from 22 resistant plants using the SDS method. PCR amplification was performed using primers Cas9-F and Cas9-R (Cas9-F: 5'-CAAGTACGTGAACTTCCTCTACC-3', SEQ ID NO:8; Cas9-R: 5'-GCTGGGAAAGGTCGATACGAGTC-3', SEQ ID NO:9). Agarose gel electrophoresis results showed that all 22 resistant plants contained the pCas9-sgBoEDR1 vector fragment (…). Figure 2 ).

[0089] To detect whether the BoEDR1 gene in the obtained transgenic plants has been edited, primer pairs BoEDR1-F1+BoEDR1-R1 (BoEDR1-F1: 5'- GAAGCTACACAGAGGCGGCAAT-3', SEQ ID NO: 10) were designed and synthesized upstream and downstream of the target site. BoEDR1-R1:5'-AGCAGAGCACGATGCCTGGAGAGA-3' (SEQ ID NO:11) was amplified by PCR.

[0090] The PCR products of 22 transgenic plants were sequenced and compared with the corresponding wild-type plant sequences. Changes in the target site sequence or the appearance of duplicate peaks in the sequencing data were identified as gene mutations. Comparative analysis of the sequencing results revealed duplicate peaks at the BoBOEDR1 gene target site in 9 plants, with a mutation efficiency of approximately 41%. Figure 3 ).

[0091] Example 4 Identification of black spot disease resistance in broccoli plants with BoEDR1 gene mutation.

[0092] Plants with the BoEDR1 gene mutation were cultured in an artificial climate chamber to induce flowering. After approximately 3 months of treatment at 15-25℃ with 16 hours of light and 8 hours of darkness, the plants bolted and flowered. The mutant plants were then artificially pollinated by removing buds, and the seeds matured after 1.5 months of culture. The harvested T1 generation seeds were sown in plug trays for identification of black spot disease resistance.

[0093] Black spot disease mainly infects leaves, but in severe cases it can also damage stems, petioles, flower heads, and seed pods. The disease usually develops from older leaves to younger leaves. In the early stages, small chlorotic spots or black dots appear on the upper or lower surface of the leaves. Later, the center of the lesion turns brown and necroses. As the disease progresses, it gradually expands to form round or nearly round lesions, which are often surrounded by a yellow halo.

[0094] Seedlings of generation T1 seed were sprayed with 5 × 10⁶ seeds in plug trays. 4 A spore suspension of *Hypericum spp.* at 1 spore / mL (the strain of *Hypericum spp.* was donated by Professor Gu Honghui of the Zhejiang Academy of Agricultural Sciences).

[0095] By observing the disease incidence of seedlings after spraying with black spot disease, it was found that ( Figure 4 The number of diseased leaves, diseased lesions, and disease severity in the BoEDR1 mutant broccoli plants were significantly lower than those in the non-mutant plants, indicating a certain degree of resistance to black spot disease.

[0096] This shows that the BoEDR1 gene negatively regulates the resistance immunity of broccoli through the salicylic acid-dependent pathway. Knocking out the BoEDR1 gene using CRISPR / Cas9 and other technologies can promote the synthesis of salicylic acid, thereby improving the ability of broccoli to resist black spot disease.

[0097] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. The application of the BoEDR1 gene in improving the resistance of Brassica vegetables to fungal diseases or in cultivating Brassica vegetables resistant to fungal diseases, characterized in that, The nucleotide sequence of the BoEDR1 gene is shown in SEQ ID No:6; the Brassica vegetable is broccoli; the fungal disease is black spot disease; the application includes: genetically modifying the endogenous BoEDR1 gene of broccoli to prevent it from being expressed, or to partially or completely lose the function of expressing the BoEDR1 protein.

2. The application according to claim 1, characterized in that, The endogenous BoEDR1 gene in the genetically modified broccoli refers to the gene modified using gene editing technology.

3. The application according to claim 2, characterized in that, The gene editing technology mentioned is zinc finger endonuclease technology, transcription activator effector nuclease technology, or CRISPR / Cas9 technology.

4. A CRISPR / Cas9 gene editing system for Brassica vegetables, characterized in that, It includes: Cas9 protein and sgRNA, the nucleotide sequence of which is shown in SEQ ID NO:1; The Brassica vegetable in question is broccoli.

5. The Brassica vegetable CRISPR / Cas9 gene editing system according to claim 4, characterized in that, The amino acid sequence of the Cas9 protein is shown in SEQ ID NO:

7.

6. An expression vector for a CRISPR / Cas9 gene editing system in Brassica vegetables, characterized in that, The expression vector is a plasmid comprising the nucleotide sequence of sgRNA and the gene sequence encoding the Cas9 protein; the nucleotide sequence of the sgRNA is shown in SEQ ID NO:

1. The Brassica vegetable in question is broccoli.

7. The expression vector according to claim 6, characterized in that, The expression vector is obtained by ligating the nucleotide sequence of sgRNA to a base vector containing an expression cassette encoding the Cas9 protein.

8. The expression vector according to claim 7, characterized in that, The expression vector includes the following elements: The gene sequence encoding the Cas9 protein expression cassette, the promoter that initiates sgRNA expression, the nucleotide sequence of the sgRNA, and the terminator that terminates sgRNA expression.

9. The expression vector according to claim 8, characterized in that, The promoter for initiating sgRNA expression is selected from any one of AtU6-1, AtU6-26, AtU3b, and AtU6-29; The terminator for terminating sgRNA expression is Tsp.

10. A kit for gene editing, characterized in that, The kit comprises: the Brassica vegetable CRISPR / Cas9 gene editing system according to any one of claims 4-5 or the expression vector according to any one of claims 6-9, wherein the Brassica vegetable is broccoli.

11. A host cell for gene editing, characterized in that, The host cell includes the expression vector according to any one of claims 6-9; the Brassica vegetable is broccoli.

12. The host cell for gene editing according to claim 11, characterized in that, The host cell is a bacterium or a fungus.

13. The host cell for gene editing according to claim 12, characterized in that, The bacteria are Agrobacterium, Mycobacterium, Streptomyces, Escherichia coli, or Bacillus subtilis.

14. A method for improving the resistance of Brassica vegetables to fungal diseases or a method for cultivating Brassica vegetables resistant to fungal diseases, characterized in that, It includes: inhibiting the expression of the BoEDR1 gene in Brassica vegetables; the nucleotide sequence of the BoEDR1 gene is shown in SEQ ID No:6; the Brassica vegetable is broccoli; and the fungal disease is black spot disease.

15. The method according to claim 14, characterized in that, The method for inhibiting the expression of the BoEDR1 gene in Brassica vegetables is to knock out, silence, or directionally mutate the BoEDR1 gene in Brassica vegetables.

16. The method according to claim 15, characterized in that, The knockout, silencing, or targeted mutation of the BoEDR1 gene in Brassica vegetables includes gene editing using the broccoli CRISPR / Cas9 gene editing system as described in any one of claims 4-5 or the expression vector as described in any one of claims 6-9.

17. The method according to claim 14, characterized in that, Broccoli cells were transformed and their genes edited using the broccoli CRISPR / Cas9 gene editing system as described in any one of claims 4-5 or the expression vector as described in any one of claims 6-9.

Citation Information

Patent Citations

  • CRISPR / Cas9-based broccoli gene fixed-point editing method

    CN114317561A

  • Genes for regulating disease resistance in plants

    US6995253B1