B cell neutralizing epitope on the surface of African swine fever virus outer envelope protein p12 and its screening and verification method and application

Abstract

The present invention discloses a neutralizing epitope in the B cell of the p12 protein surface of the outer envelope of African swine fever virus (ASFV), and a screening and verification method and application thereof, and specifically discloses two screened B cell epitopes GN08 and MA11 in the p12 protein of the outer envelope of ASFV, wherein the hybridoma cell (preservation number CCTCC NO: C2023192) produced by the monoclonal antibody against the epitope GN08, the cell supernatant secreted by the hybridoma cell and the mouse-derived ascites are verified to have the activity of neutralizing the ASFV virus by using the cell neutralization test of the primary lung macrophage (PAM) of the pig infected with the ASFV virus, while the cell supernatant secreted by the hybridoma cell against the MA11 epitope and the mouse-derived ascites do not have the activity of neutralizing the ASFV virus. Therefore, the GN08 epitope is a neutralizing epitope of the B cell on the surface of the p12 protein of the outer envelope of ASFV, and has the application potential of being developed into a neutralizing virus epitope target.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology and immune diagnosis and detection technology, and specifically relates to a B cell neutralizing epitope on the surface of the p12 outer protein of the African swine fever virus envelope, and a screening and verification method and application thereof. Background Art

[0002] African swine fever (ASF) is a highly pathogenic viral infectious disease caused by African swine fever virus (ASFV) that is highly pathogenic to domestic pigs of all breeds and ages. It has a short course of disease and high morbidity and mortality. It is listed as a Class A disease by the World Organization for Animal Health (WOAH) and is a Class I animal disease that needs to be prevented in my country.

[0003] ASFV is a double-stranded DNA enveloped virus with a large encoded genome structure. It is difficult to study virulence factors, neutralizing antigens, infection mechanisms, and escape mechanisms, which has delayed the development of vaccines. In the absence of safe and effective commercial vaccines, we also look forward to the successful development of specific anti-ASFV drugs. The p12 envelope protein encoded by O61R is an adhesion protein and is located in the outer envelope of ASFV particles. It mediates the adhesion and binding of infectious virus particles to specific receptors in host cells and plays a key role in initiating early viral infection. Recombinant p12 protein has been shown to block the specific binding of virus particles to susceptible cells and inhibit viral infection. If the neutralizing epitope of ASFV outer envelope p12 protein on the surface of B cells can be accurately screened, verified, and identified, and a neutralizing monoclonal antibody (mAb) targeting the known neutralizing epitope can be developed, on the one hand, it can provide passive immune protection for the pig herd and achieve the purpose of treatment or emergency prevention; on the other hand, given that the outer envelope protein p12 is the outermost structure of the exposed outer envelope protein of the ASFV particle, it can initiate the host body's innate and acquired immune responses in the early stages of infection. The antigen-antibody detection method established based on mAb of the outer envelope protein with known epitopes can achieve more accurate early detection, monitoring, and early warning.

[0004] The immune antigen of monoclonal antibody hybridoma technology is usually a protein antigen expressed by heterologous recombinant expression, which needs to be expressed by prokaryotic or eukaryotic expression system, involving a series of complex procedures and steps such as the construction of recombinant vector, the construction of recombinant vector strain expressing the target protein, protein induction, exploration and optimization of induction conditions, target protein expression concentration requirements and purification purity, and requires laboratories with molecular cloning experimental conditions and personnel who master relevant technologies to prepare specific technical solutions and effectively implement them. As a complete protein antigen of immunogen, most of them are redundant non-neutralizing epitopes, and the functional region of neutralizing epitopes that recognize neutralizing antibodies accounts for a small proportion of protein immunogens, which wastes and consumes a large amount of host immune response resources in the immune response process. The mAb prepared in this way is also easy to target multiple redundant regions and non-neutralizing epitopes, and the targeted antigen epitopes are unknown. The subsequent tedious antigen epitope analysis work is required, which has high requirements for the cost and technology of identification tests.

[0005] In terms of antigen epitope identification and analysis for mAb, protein antigens are used as animal immunogens and also for screening of hybridoma cells that secrete monoclonal antibodies. The monoclonal antibodies obtained by screening react with the complete protein antigen recognition. However, due to the presence of many redundant regions and unknown epitope determinants on the surface of protein antigens, the specific epitopes targeted by the monoclonal antibodies screened are unknown, and cumbersome and precise analysis of the epitopes is required. It is worth noting that it is very difficult to accurately screen and identify the neutralizing epitopes of the antigens targeted by neutralizing monoclonal antibodies. It is also worth considering that if the prepared monoclonal antibodies cannot accurately determine which epitope is targeted, there may be cross-reactions and background reactions based on monoclonal antibody-mediated diagnostic detection and monitoring, making diagnosis and analysis difficult. Summary of the invention

[0006] Purpose of the invention: The technical problem to be solved by the present invention is to provide a neutralizing epitope of African swine fever virus and a neutralizing monoclonal antibody thereof, to provide a screening and verification method for the neutralizing epitope on the surface B cell of the African swine fever virus envelope protein p12, and a hybridoma cell line of a monoclonal antibody against the neutralizing epitope and its potential application.

[0007] Technical solution: The present invention provides a B cell epitope or a neutralizing epitope on the surface of the p12 protein of the outer envelope of the African swine fever virus. The amino acid sequence of the B cell epitope MA11 or the neutralizing epitope GN08 is MPRQQKKCSKA or GSSGGGSN, respectively.

[0008] Among them, the B cell epitope is obtained by prediction and screening based on the surface of ASFV outer envelope protein p12.

[0009] The present invention also provides a nucleic acid molecule encoding the B cell epitope or neutralizing epitope. The gene sequence of the nucleic acid molecule of the B cell epitope MA11 or the neutralizing epitope GN08 is ATGCCCCGCCAGCAGAAAAAATGTAGCAAGGCT or GGTTCAAGTGGTGGAGGCTCTAAT, respectively.

[0010] The invention also provides an expression box, a recombinant vector and a recombinant strain, which contain the nucleic acid molecule.

[0011] The present invention also provides a recombinant strain or immune antigen. The immune antigen is obtained by inserting the nucleic acid molecule into the MisL passenger domain of the Salmonella V-type secretion system and then introducing the nucleic acid molecule into the host bacteria.

[0012] Specifically, the present invention provides two dominant epitope antigens, both of which express and display GN08 and MA11 epitopes on the bacterial surface, respectively, as dominant epitope antigens, thereby replacing complete protein antigens as immunogens; provides S9 bacteria + Peg pili display recombinant strains (S9-Peg-GN08 and S9-Peg-MA11) that express GN08 and MA11 epitopes, respectively, which can specifically recognize the supernatant of hybridoma cells secreting monoclonal antibodies, produce specific agglutination reactions directly mediated by epitopes and monoclonal antibodies, and accurately and conveniently screen out positive hybridoma cells that secrete monoclonal antibodies against the p12 epitope of ASFV outer envelope protein.

[0013] The present invention also provides a recombinant strain or a detection antigen. The detection antigen is obtained by inserting the nucleic acid molecule into the Salmonella PEG pili operon gene and introducing the nucleic acid molecule into an inert carrier S9 bacteria.

[0014] Specifically, the present invention also provides a method for preparing the detection antigen and a method for screening and detecting the neutralizing antigen, that is, a recombinant S9 inert bacteria that expresses and displays the GN08 and MPRQQKKCSKA (MA11) epitopes respectively, and the GN08 and MA11 epitopes are respectively inserted into the Salmonella PEG pili operon gene and introduced into the inert carrier S9 bacteria, and the GN08 and MA11 epitopes can be functionally expressed and displayed on the surface of the S9 bacteria, and specifically recognize the immune mouse serum antibodies against the GN08 and MA11 epitopes, and based on the GN08 and MA11 epitope-antibody direct mediated agglutination test, the immune mouse serum antibodies and antibody titers are tested; the GN08 and MA11 epitopes can be functionally expressed and displayed on the surface of the S9 bacteria, and can also specifically recognize the monoclonal antibodies against the GN08 and MA11 epitopes, based on the GN08 and MA11 epitope-antibody direct mediated agglutination test. Epitope-monoclonal antibody directly mediated indirect ELISA method, the coated detection antigens are recombinant inert S9 bacteria expressing and displaying GN08 and MA11 epitopes respectively. The GN08 and MA11 epitopes expressed on the surface of inert S9 bacteria can recognize the specific monoclonal antibodies against GN08 and MA11 epitopes in the supernatant of hybridoma cells and can produce specific binding reactions. Inert S9 bacteria lacking only GN08 and MA11 epitopes are used as controls, which cannot recognize the specific antibodies against GN08 and MA11 epitopes in the supernatant of hybridoma cells, thereby accurately screening out specific monoclonal antibodies against GN08 and MA11 epitopes. This screening method is specific and convenient, and can also qualitatively and quantitatively detect and monitor the cell supernatant or mouse ascites monoclonal antibodies and antibody titers of hybridoma cell lines against GN08 and MA11 epitopes.

[0015] The present invention also provides a hybridoma cell line, which secretes a neutralizing monoclonal antibody targeting the GN08 epitope of the p12 protein of the outer envelope of African swine fever virus. The GN08 epitope is a neutralizing epitope with an amino acid sequence of GSSGGGSN. It is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: C2023192. The deposit date is July 3, 2023, and the classification name is Hybridoma cell line 1C10E4. The hybridoma cell line 1C10E4 is a hybridoma cell line of a neutralizing monoclonal antibody targeting the ASFV outer envelope p12 protein epitope GSSGGGSN. The deposit address is Wuhan University, Wuhan, China.

[0016] The cell supernatant and mouse ascites secreted by the hybridoma cell line have the activity of neutralizing ASFV virus.

[0017] The present invention also provides a monoclonal antibody targeting the epitope of the p12 envelope protein of the African swine fever virus. The neutralizing monoclonal antibody is obtained by immunizing an animal with the immune antigen; or is obtained by secretion of the hybridoma cell line.

[0018] The present invention also provides a method for screening and verifying the neutralizing epitope of the B cell on the surface of the outer envelope protein p12 of the African swine fever virus, which is obtained by neutralizing the African swine fever virus with the monoclonal antibody targeting the p12 envelope protein epitope of the African swine fever virus through a cell neutralization test to verify whether it has activity.

[0019] The present invention also provides a specific screening and verification method for the neutralizing epitope on the surface of the African swine fever virus outer envelope protein p12 in B cells, comprising the following steps:

[0020] (1) Using bioinformatics techniques, we predicted and analyzed the antigenicity of potential epitopes in the p12 protein of the outer envelope of African swine fever virus, and obtained the two epitopes with the highest scores, GN08 and MA11;

[0021] (2) Dominant immunogenic epitopes: GN08 and MA11 epitopes were respectively inserted into the MisL passenger domain of the Salmonella V-type secretion system, and GN08 and MA11 epitopes were expressed on the bacterial surface as dominant immunogenic epitopes, which were used to immunize mice and obtain immune mouse B cells for preparing hybridoma cells;

[0022] (3) Immunization of animals: BALB / c mice were subcutaneously injected with the immune antigen recombinant strain suspension at the back of the neck. The immunization dose was 1×10 8 CFU / 0.1mL / animal, immunization was performed 3 times with an interval of 12 days between each immunization;

[0023] (4) Recombinant S9 inert bacteria expressing and presenting GN08 and MA11 epitopes (as agglutination antigens for agglutination test): The GN08 and MA11 epitopes are respectively inserted into the Salmonella Peg pili operon gene and introduced into the inert vector S9 bacteria. The GN08 and MA11 epitopes can be functionally expressed and presented on the surface of S9 bacteria. Recombinant S9 bacteria expressing GN08 and MA11 epitopes are used as detection antigens (S9-Peg-GN08 and S9-Peg-MA11). The GN08 and MA11 epitopes on the surface of the detection antigen bacteria recognize specific antibodies against the GN08 and MA11 epitopes in the anti-mouse serum and can produce agglutination reactions, thereby qualitatively and quantitatively monitoring the GN08 and MA11 epitope-specific antibodies and antibody titers in the serum of immunized mice;

[0024] (5) Fusion of spleen cells from immunized mice and myeloma cells: spleen cells from the third immunized mice were fused with myeloma cells Sp2 / 0 in vitro and cultured and screened in culture media containing HAT and HT, respectively;

[0025] (6) GN08 and MA11 epitope-monoclonal antibody direct enzyme-linked immunosorbent assay (ELISA): If the recombinant S9 bacteria expressing the GN08 or MA11 epitope detect the antigen OD 450 The reading value is compared with the OD of the control system (recombinant S9 bacteria lacking only the GN08 or MA11 epitope) 450 If the reading is equal to or greater than 0.2, it is judged as a presumptive positive hybridoma cell well;

[0026] (7) Subcloning of hybridoma cell lines: The presumed positive hybridoma cells selected in step (7) that secrete specific antibodies against the GN08 or MA11 epitope were subcloned three times by the limiting dilution method until all the hybridoma cell wells in the subcloning culture plate were tested positive. Finally, the hybridoma cell line 1C10E4 that can stably secrete a monoclonal antibody against the ASFV outer envelope p12 protein epitope GSSGGGSN (GN08) and the hybridoma cell line 5B2E3 that can stably secrete a monoclonal antibody against the ASFV outer envelope p12 protein epitope MPRQQKKCSKA (MA11) were screened;

[0027] (8) Neutralization determination and verification of specific monoclonal antibodies: A certain number of hybridoma cell lines 1C10E4 and 5B2E3 were cultured and injected with 1×10 6 Sensitized mice were injected intraperitoneally with 100 cells / mouse, and ascites antibodies were collected. The ascites antibodies were purified using the saturated ammonium sulfate method, and the specificity of monoclonal antibodies against GN08 and MA11 epitopes was verified by indirect immunofluorescence method using ASFV virus and porcine primary lung macrophages (PAM). The neutralization of monoclonal antibodies against GN08 and MA11 epitopes was verified by cell neutralization test. The test results showed that the cell supernatant of hybridoma cell line 1C10E4 or mouse ascites monoclonal antibodies against GN08 epitope had the activity of neutralizing ASFV virus, while the cell supernatant of hybridoma cell line 5B2E3 or mouse ascites monoclonal antibodies against MA11 epitope did not have neutralization.

[0028] The present invention also provides the use of the B cell epitope or neutralizing epitope, the nucleic acid molecule, the expression cassette, the recombinant vector or the recombinant strain, the immune antigen, the detection antigen, the hybridoma cell line or the monoclonal antibody in the preparation of a reagent or kit for detecting African swine fever virus or its antibody.

[0029] The present invention also provides a kit for detecting African swine fever virus or its antibody, which comprises the B cell epitope or neutralizing epitope, the nucleic acid molecule, the expression cassette, the recombinant vector or recombinant strain, the immune antigen, the detection antigen, the hybridoma cell line or the monoclonal antibody.

[0030] Beneficial effects: The present invention provides a method for screening and verifying the neutralizing epitope on the surface of the African swine fever virus outer envelope protein p12 in B cells and its potential application, which has the following advantages compared with the prior art:

[0031] (1) The immune antigen epitopes GN08 and MA11 used in the present invention are expressed and presented on the surface of bacteria respectively. As dominant epitope antigens, there is no need to extract, express and purify a large amount of protein antigens. No adjuvant is needed during animal immunization injection. It is only necessary to immunize mice three times before obtaining immune mouse B cells for preparing hybridoma cells.

[0032] (2) In the process of screening hybridoma cells secreting monoclonal antibodies, the present invention adopts an indirect ELISA method directly mediated by GN08 and MA11 epitopes-monoclonal antibodies. The coated detection antigens are recombinant inert S9 bacteria expressing and displaying GN08 and MA11 epitopes respectively. The GN08 and MA11 epitopes on the surface of the detection antigen inert S9 bacteria can recognize the specific monoclonal antibodies against the GN08 and MA11 epitopes in the supernatant of hybridoma cells and can produce specific binding reactions. The inert S9 bacteria lacking only the GN08 and MA11 epitopes are used as a control, which cannot recognize the specific antibodies against the GN08 and MA11 epitopes in the supernatant of hybridoma cells, thereby accurately screening out specific monoclonal antibodies against the GN08 and MA11 epitopes. The screening method is specific and convenient, and can also qualitatively and quantitatively detect and monitor the cell supernatant or mouse-derived ascites monoclonal antibodies and antibody titers of hybridoma cell lines against the GN08 and MA11 epitopes.

[0033] (3) The neutralization of monoclonal antibodies against GN08 and MA11 epitopes was verified by using ASFV virus and porcine primary pulmonary macrophages (PAM) cell neutralization test. The test results showed that the cell supernatant of hybridoma cell line 1C10E4 or mouse ascites monoclonal antibodies against GN08 epitope had the activity of neutralizing ASFV virus, while the cell supernatant of hybridoma cell line 5B2E3 or mouse ascites monoclonal antibodies against MA11 epitope did not have neutralizing activity, which confirmed that the B cell GN08 epitope on the surface of African swine fever virus outer envelope protein p12 was a neutralizing epitope. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1: Comparison and analysis results of the p12 protein sequence of the outer envelope of African swine fever virus. The rectangular wireframe shows the screened epitope sequences such as GN08 and MA11;

[0035] Figure 2 :The prediction and analysis results of B cell epitopes of the p12 protein of the outer envelope of African swine fever virus. Results No.1 and No.2 show the optimized and screened GN08 and MA11 epitope sequences;

[0036] Figure 3 :Schematic diagram of the preparation process of monoclonal antibodies against known epitopes of African swine fever virus (ASFV) envelope protein;

[0037] Figure 4 :Detection and monitoring of serum antibodies in immune mice, quantitative monitoring results of antibodies against GN08 and MA11 epitopes and antibody titers;

[0038] Figure 5 : Indirect immunofluorescence test results of cell culture supernatants of 1C10E4 and 5B2E3 hybridoma cell lines, 1C10E4 is the 1C10E4 cell supernatant test group (monoclonal antibody against GN08 epitope); 5B2E3 is the 5B2E3 cell supernatant test group (monoclonal antibody against MA11 epitope), NC represents the negative control group; FITC is used for secondary antibody staining; DAPI is used for PAM cell nucleus staining; MERGE is the superimposed mixed channel of FITC and DAPI. DETAILED DESCRIPTION

[0039] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below. It should also be understood that the terms used in the examples of the present invention are intended to describe specific embodiments rather than to limit the scope of protection of the present invention. The test methods in the following examples without specifying specific conditions are generally carried out under conventional conditions or under conditions recommended by the manufacturers.

[0040] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0041] Example 1 Screening and verification of B cell neutralizing epitopes on the surface of African swine fever virus outer envelope protein p12 Method 1. Prediction and analysis of B cell epitopes on the outer envelope protein p12 of African swine fever virus

[0042] The amino acid sequence of the outer envelope p12 protein of African swine fever virus was searched through the European protein database (https: / / www.uniprot.org / ), and a total of 16 search information were obtained. The protein sequence accession numbers were: H9EJX1, A0A1L2YXS7, P0C9Y3, P0C9Y4, H9EJW9, A9JL64, A9JLZ6, D4I5T5, Q65286, A0A894ZVT9, A0A0C5B281, Q65283, A0A0C5B2N3, P0C9Y2, P0C9Y1 and Q65284. The above protein sequences were compared and analyzed using MEGA 7.0 software. The results are as follows Figure 1 As shown, the p12 protein is highly conserved in African swine fever virus, with a homology of 87.10%-100.00%.

[0043] To further clarify whether the region with the same amino acid sequence as the above p12 protein contains B cell epitopes: the B cell epitope prediction tool (Bepipred Linear Epitope Prediction 2.0, http: / / tools.iedb.org / bcell / ) of the Immunology and Epitope Database was used to predict the B cell epitopes contained in the p12 protein (taking the amino acid sequence of the p12 protein with accession number P32510 as an example). The database scores each amino acid residue, and residues with a score of >0.5 are considered to have antigenicity, and consecutive amino acid residues with a score of >0.5 are identified as B cell epitopes. The prediction results are as follows: Figure 2 As shown, among the predicted B cell epitopes, GSSGGGSN and MPRQQKKCSKA had the highest comprehensive scores (average amino acid residue scores of 0.564 and 0.557), and GSSGGGSN and MPRQQKKCSKA were selected as target epitopes for the development of monoclonal antibodies, referred to as GN08 and MA11.

[0044] 2. Preparation of mouse immune antigens

[0045] The construction of the recombinant vector bacteria DH-5α+pBR-MisL-GN08 and DH-5α+pBR-MisL-MA11 was carried out by Nanjing Qingke Biotechnology Co., Ltd. The chimeric genes misl-GN08 (GN08 gene sequence is GGTTCAAGTGGTGGAGGCTCTAAT) and misl-MA11 (MA11 gene sequence is ATGCCCCGCCAGCAGAAAAAATGTAGCAAGGCT) were synthesized, and the replacement sites (gene sequence is AACGATGATTCCGAAACGGACAGGCTGCAG) in the msiL gene sequence (the sequence is from the whole genome of Salmonella enterica serovar Gallinarum 287 / 91 strain, GenBank accession numbers AM933173.1, 3860919-3863786) were replaced by the two epitope genes GN08 and MA11, respectively. The above two chimeric genes were used as templates (1 μL contained 1 ng of chimeric genes), the genome of the standard strain of Salmonella enterica serovar Gallinarum NCTC 13346 was used as a positive control, the genome of the avian pathogenic Escherichia coli isolate APEC-XM and the genome of the engineered Escherichia coli DH5α were used as negative controls, and the primers SP misL Up (5'-GAC GCTAGC ATGCCAACTCCCCAAAATTACT-3', the underline represents the restriction site NheI, the primer was synthesized by Nanjing Qingke Biotechnology Co., Ltd.) and SP misL Down (5'-CGC GTCGACTCAGAAACTGTATTTCATCCCCAA-3' The underline represents the restriction site SalI, and the primer was synthesized by Nanjing Qingke Biotechnology Co., Ltd.) for PCR amplification. The amplification system is: Phanta Max Super-Fidelity DNA Polymerase (Nanjing Novozyme Biotechnology Co., Ltd.) 1μL, 2×Phanta Max Buffer 25μL, dNTPs 1μL, upstream and downstream primers (10mM) 2μL each, the genome of Salmonella typhi NCTC 13346 (250ng / μL) 1μL, ultrapure water 18μL. After the above system is mixed evenly, PCR amplification is performed using a thermal cycler (Bio-Red), and the program is as follows: pre-denaturation at 95℃ for 3min, amplification stage for a total of 35 cycles, including denaturation at 95℃ for 30s, annealing at 58℃ for 30s and extension at 72℃ for 3min, further amplification at 72℃ for 5min, and the temperature is reduced to 12℃ after the amplification is completed. 1% agarose gel was prepared, electrophoresed at 110V for 45 minutes, stained with ethidium bromide and imaged under a UV imager. The amplified size of the positive control was 2886 bp; the PCR products of misl-GN08 and misl-MA11 were 2880 bp and 2889 bp, respectively. The PCR amplified products of misl-GN08 and misl-MA11 were extracted using a universal DNA purification kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0046] Extract the pBR322 plasmid, use NheI and SalI restriction endonucleases (NEB) to double-digest the PCR amplification products of misl-GN08 and misl-MA11 and the pBR322 plasmid, then use T4 DNA ligase (NEB) to connect the above linear DNA fragments in a 16°C metal bath overnight, and transform the ligation products into DH-5α competent cells the next day, and select resistance by coating solid culture medium containing 100 μg / mL ampicillin. Pick a single colony on the plate and inoculate it into LB liquid culture medium containing 100 μg / mL ampicillin to grow to the stationary phase. After extracting the plasmid, it is single-digested with NheI and SalI and double-digested with two restriction endonucleases. Prepare 1% agarose gel, electrophoresis at 110V for 45min, stain with ethidium bromide and identify by imaging under UV imaging. The single digestion products of NheI and SalI of recombinant plasmids pBR-MisL-GN08 and pBR-MisL-MA11 are 6801bp and 6810bp respectively; the double digestion products of the two vectors contain 3939bp of linear vector, 2862bp of misl-GN08 linear DNA fragment, or 2871bp of misl-MA11 linear DNA fragment. DH-5α strains containing the correct recombinant plasmids pBR-MisL-GN08 or pBR-MisL-MA11 are DH-5α+pBR-MisL-GN08 or DH-5α+pBR-MisL-MA11 recombinant bacteria. The constructed immune antigen strains DH-5α+pBR-MisL-GN08 and DH-5α+pBR-MisL-MA11 were verified and stored in a -70°C refrigerator in the laboratory.

[0047] The immune antigen strains constructed, verified and preserved by our laboratory, namely the recombinant vector bacteria DH-5α+pBR-MisL-GN08 and DH-5α+pBR-MisL-MA11, were revived and cultured in a shaking incubator at 37°C for 16 h. Centrifuge at 4000 r / min for 5 min, discard the supernatant, wash with an equal amount of sterile PBS for 3 times, and measure the OD 600 , adjust the bacterial concentration to 1×10 9 CFU / mL, for future use.

[0048] 3. Preparation of detection antigens (recombinant S9 bacteria expressing GN08 and MA11 epitopes on the bacterial surface, S9-Peg-GN08 and S9-Peg-MA11, respectively)

[0049] Construction of S9-Peg-GN08 and S9-Peg-MA11 strains: peg-GN08 and peg-MA11 chimeric genes were synthesized by Nanjing Qingke Biotechnology Co., Ltd., and the replacement site AATTACACTCTGAATTCAAGTAAGTTTGAA of the peg operon gene sequence (reference sequence is Salmonella enterica SP strain, GenBank accession number CP077668.1, 1831920-1827125) was replaced by GN08 (gene sequence is TCTAACAATCTTGATTCTAAGGTTGGTGGT) and MA11 (gene sequence is ATGCCCCGCCAGCAGAAAAAATGTAGCAAGGCT). The above two chimeric genes were used as templates (1 μL, containing 1 ng of chimeric genes), the genome of the standard strain of Salmonella pullorum CVCC 526 was used as a positive control, and the genome of the avian pathogenic Escherichia coli isolate APEC-XM and the genome of the engineered Escherichia coli DH5α were used as negative controls. The primers SP Peg Up (5'-GCC GCTAGC ATG AAACGTTCACTTATTGCTGCT-3', the underlined sequence represents the NheI restriction enzyme site, the primers were synthesized by Nanjing Qingke Biotechnology Co., Ltd.) and SP Peg Down (5'-GCA GGATCCTTAATCAGTTAATACCGTCATCGTCAG-3 The underlined sequences represent BamHI restriction enzyme sites, and the primers were synthesized by Nanjing Qingke Biotechnology Co., Ltd.) for PCR amplification. The amplification system is: pfu high-fidelity DNA Polymerase (Beijing Quanshijin Biotechnology Co., Ltd.) 2μL, 5×pfu DNA polymerase buffer 10μL, dNTPs 5μL, upstream and downstream primers (10mM) 2μL each, CVCC 526 genome (250ng / μL) 2μL, ultrapure water 27μL. After the above system is mixed evenly, PCR amplification is performed using a thermal cycler (Bio-Red). The program is as follows: pre-denaturation at 94℃ for 5min, amplification stage for a total of 30 cycles, including denaturation at 94℃ for 30s, annealing at 52℃ for 30s and extension at 72℃ for 5min, further amplification at 72℃ for 10min, and the temperature is reduced to 12℃ after the amplification is completed. 1% agarose gel was prepared, electrophoresed at 110V for 45 minutes, and then stained with ethidium bromide and imaged under a UV imager. The PCR product of peg-GN08 was 4844bp; the PCR product of peg-MA11 was 4853bp; the amplified size of the positive control was 4850bp; and there was no amplified band in the negative control. The PCR amplified products of peg-GN08 and peg-MA11 were recovered using a universal DNA purification kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0050] The pBR322 plasmid was recovered, and the PCR amplification products of peg-GN08 and peg-MA11 were double-digested with the pBR322 plasmid using NheI and BamHI restriction endonucleases (NEB), and then the linear DNA fragments were connected in a 16°C metal bath overnight using T4 DNA ligase (NEB). The next day, the ligation product was transformed into the competent cells of the S9 strain, and resistance screening was performed by coating a solid medium containing 100 μg / mL of ampicillin. The S9 strain was preserved by this laboratory (reference: An inert carrier Salmonella and its potential application, Chinese invention patent, patent number ZL201910424369.8) A single colony on the plate was picked and inoculated into an LB liquid medium containing 100 μg / mL of ampicillin to grow to a stationary phase, and the plasmid was recovered and then single-digested with NheI and BamHI and double-digested with two restriction endonucleases. Prepare 1% agarose gel, electrophoresis at 110V for 45min, stain with ethidium bromide and identify by imaging under UV imaging. The single digestion products of NheI and BamHI of recombinant plasmids pBR-Peg-GN08 and pBR-Peg-MA11 are 9061bp and 9068bp respectively; the double digestion products of the vector contain a 4215bp linear vector, a 4844bp peg-GN08 linear DNA fragment, or a 4853bp peg-MA11 linear DNA fragment. The S9 strain containing the correct recombinant plasmid pBR-Peg-GN08 or pBR-Peg-MA11 is the S9-Peg-GN08 or S9-Peg-MA11 recombinant strain. The constructed strains S9-Peg-GN08 and S9-Peg-MA11 were verified and stored in a -70℃ refrigerator in the laboratory. The construction method of the pBR-Peg recombinant plasmid is exactly the same as the Chinese invention patent with the invention name "Target antigen of B cell epitope of the receptor binding domain of the new coronavirus and its expression and application in Peg pili display", patent number ZL202211488632.8. The pBR-Peg recombinant plasmid was transformed into S9 bacteria to obtain the recombinant bacteria S9-Peg, which was stored in a -70℃ refrigerator in the laboratory after verification. The S9-Peg recombinant bacteria only lacked the single factor GN08 epitope or MA11 epitope, which served as a negative control for the detection of antigens.

[0051] Resuscitate the strains S9-Peg-GN08 and S9-Peg-MA11 constructed, verified and preserved by our laboratory and the recombinant strain S9-Peg of the detection control system, and adjust the concentrations of the three recombinant strains S9-Peg, S9-Peg-GN08 and S9-Peg-MA11 to 5×10 9 CFU / mL, 4000r / min, centrifuge for 5min, discard the supernatant, let stand at room temperature for 2h, wash 3 times with an equal amount of sterile PBS, and then dispense into finger tubes and store at 4℃ for later use.

[0052] 4. Animal Immunization and GN08 and MA11 Epitope-Specific Antibody Detection and Antibody Titer Monitoring

[0053] Using the immune antigen strain prepared in the above method, eight 6-week-old female BALB / c mice were selected and numbered as 1#, 2#, 3#, 4#, 5#, 6#, 7# and 8#, respectively. The mice were fed at 1×10 8 The dose of CFU / mouse was 0.1 mL, and two points of subcutaneous injection were performed on the back of the neck. Mice 1#-4# were inoculated with the GN08 epitope immune antigen, and mice 5#-8# were inoculated with the MA11 epitope immune antigen. The immunization was performed 3 times, with an interval of 12 days between each immunization. Blood was collected from the orbital vein of the mice 7 days after each immunization, and the serum was separated to detect the antibody titer of the immune serum. Starting from the second immunization, the antibody titer of each mouse was recorded. The same dose of bacterial solution was injected intraperitoneally on the day before fusion to stimulate the mouse with the highest immune antibody titer. The immunization process lasted a total of 33 days, and the process was as follows Figure 3 shown.

[0054] Detect the specific antibodies and antibody titers in mouse serum. The detection method is quantitative detection by glass plate agglutination test. The operation method is as follows: add 20 μL of physiological saline to each well of the 96-well plate. Add the above 20 μL of immune mouse serum to be tested to the first well of the 96-well plate, repeatedly blow 4 to 5 times, mix well, and then aspirate 20 μL to the second well. Repeat 2 times. n After the dilution, 6 μL of the supernatant to be tested was aspirated twice from the first well and dropped onto the glass slide, and then mixed with 6 μL of S9-Peg-GN08 and S9-Peg-MA11 detection antigens carrying epitopes GN08 or MA11 and the control system strain S9-Peg that only lacks a single factor epitope on the glass plate, and the glass slide was shaken steadily. Within 2 minutes, whether the mixture was formed with visible white agglutinated particles (GN08 or MA11 epitope-antibody directly mediated antigen-antibody complex aggregates) was observed. If the control system had no agglutinated particles and the detection antigen had agglutinated particles, it was positive; if both the control system and the detection antigen had no agglutinated particles, it was negative; if the reaction in the first well was positive and the reaction in the second well was negative, the antibody titer was 1:2. 1 , and so on. The antibody titer results of immunized mice are as follows Figure 4 As shown, the results showed that all immunized mice could produce specific antibodies against the target antigen. After two rounds of immunization, the antibody level in 3# mouse was the highest, with an antibody titer of 1:256. After three immunizations, the quantitative test of antibody titer of 3# mouse (GN08 epitope immunized mouse) and 8# mouse (MA11 epitope immunized mouse) reached a maximum of 1:1024, so 3# and 8# were selected for subsequent cell fusion experiments.

[0055] 5. Cell fusion and positive well screening

[0056] (1) Preparation of SP2 / 0 cells

[0057] About 2 weeks before fusion, resuscitate SP2 / 0 cells preserved in this laboratory and verify whether they are HGPRT-deficient cells with HAT culture medium. If the cells die, it proves that they are HGPRT-deficient cells, otherwise, they are not. Observe under an inverted microscope. The cells are plump, with neat edges and a survival rate greater than 95%, which means that the fusion conditions are met; 48h before fusion, expand the culture of SP2 / 0 cells; on the day of fusion, gently blow the cells off the wall of the cell culture bottle, collect and centrifuge at 1000r / min for 8min, and discard the supernatant; add 30mL DMEM culture medium, centrifuge and wash 3 times in the same way; then resuspend the cells in 10mL DMEM culture medium and mix thoroughly; take the cell suspension, dilute it 100 times, count it and set it aside.

[0058] (2) Preparation of feeder layer cells

[0059] Peritoneal macrophages of mice of the same strain were used as feeder cells. The detailed operation was as follows: 1 to 2 days before cell fusion, mice were euthanized by CO2 method, soaked in 75% alcohol for 5 minutes, mice were taken out, fully disinfected, and 7 mL of DMEM culture medium was injected into the peritoneal cavity, taking care to avoid puncturing the intestine or peritoneum; the abdomen was massaged to aspirate the injected culture medium; centrifuged and washed once, and the cell concentration was adjusted to 2×10 5 / mL, set aside; add the above cell suspension to a 96-well plate, 0.1mL per well, and culture in a 37°C 6% CO2 incubator until subsequent operations.

[0060] (3) Preparation of spleen lymphocytes from immunized mice

[0061] After euthanizing 3# mice, disinfecting and fixing their body surfaces using the CO2 method, the spleen was aseptically removed from the left abdomen subcutaneously, placed in a cell culture dish for washing, and the surrounding connective tissue was stripped off; it was then transferred to another cell culture dish, and the spleen was gently squeezed with curved forceps and a 1mL syringe needle to release spleen cells into the incomplete culture medium. After removing tissue clumps, the suspension containing spleen cells was aspirated into a 15mL centrifuge tube, centrifuged at 1000r / min for 8min, washed twice, and resuspended, and the cells were counted for later use.

[0062] (4) Cell fusion and selective culture of hybridoma cells

[0063] Splenic lymphocytes and Sp2 / 0 cells were fully mixed in 30mL DMEM at a ratio of 8:1, centrifuged at 1000r / min for 8min, the supernatant was removed, and the bottom of the fusion tube was gently tapped with the palm of the hand to make the cell pellet loose and uniform; PEG 1500 preheated at 37℃ was used as a fusion agent, 1mL was added dropwise within 1min, and gently shaken during the addition process, and acted at 37℃ for 1min, and then 1mL of DMEM preheated to 37℃ was added dropwise within 90s to terminate the fusion, and then 5mL of DMEM medium was added dropwise to slowly dilute, and the medium was added to 30mL, sealed, and allowed to stand in a 37℃ water bath for 30min, 1000r / min, centrifuged for 8min, the supernatant was discarded, and a small amount of HAT medium was used to resuspend, and HAT medium was added to 40mL, and the wells were dispensed into the 96-well culture plate prepared in 2.4.2, 100μL per well, and placed in a 37℃, 6% CO2 incubator for culture. After 5 days, add 100 μL HAT medium; after the 10th day of fusion, aspirate all the HAT medium in the well and add pre-warmed HT medium; during this period, keep the water tank sufficient to provide a stable growth environment, track and monitor the growth of hybridoma cells after full medium replacement, aspirate the supernatant for antibody detection on days 12 and 14, and add HT complete medium pre-warmed at 37°C.

[0064] (5) Positive well screening (GN08 and MA11 epitope-monoclonal antibody-mediated indirect ELISA method)

[0065] On the 12th day after fusion, multiple cell clusters can be clearly seen in each well under the microscope. The hybridoma cell clusters are grape-shaped and are expanding. When the cell supernatant turns slightly yellow, the cell supernatant is collected. In order to improve the screening efficiency, the indirect ELISA method is used to quickly screen the cell culture wells that can secrete specific antibodies against GN08 and MA11 epitopes. The bacterial suspension of S9-Peg-GN08 and S9-Peg-MA11 (5×10 9 CFU / mL) was used as the detection antigen, and the bacterial suspension of the strain S9-Peg that only lacked the epitope (5×10 9 CFU / mL) was used as the control antigen.

[0066] The following implementation scheme takes S9-Peg-GN08 detection antigen and S9-Peg control antigen as examples to demonstrate the screening method of positive cell culture wells for specific antibodies against the GN08 epitope (the screening method of positive cell culture wells for specific antibodies against the MA11 epitope is consistent with the actual method), and the operation is as follows:

[0067] ① Antigen coating: fully mix the test antigen (S9-Peg-GN08), control antigen (S9-Peg) bacterial suspension and carbonate buffer at a volume of 1:10, then add the test antigen (S9-Peg-GN08) and control antigen (S9-Peg) to two ELISA plates (96-well polystyrene plates), add 50 μL of the mixture to each well, and dry at 40°C;

[0068] ② After drying, add 100 μL of anhydrous methanol (analytical grade) precooled at -20°C to each well, fix at room temperature for 15 min, wash with ultrapure water 3 times, 5 min each time, and pat dry;

[0069] ③ Add 150 μL of 10% skim milk powder to each well and incubate at 37°C for 2 h, then wash three times with PBST (pH=7.2, containing 0.5% Tween-20), 5 min each time, and pat dry;

[0070] ④ Test antigen and control The wells of the two 96-well plates correspond to each other. Add 100 μL of the hybridoma cell culture supernatant to each well. Set up positive serum and negative serum controls. The positive serum is the serum collected from 3# immune mice, and the negative serum is the SPF mouse serum. Dilute PBS1:200, add 100 μL to each well, incubate at 37℃ for 2h, wash 3 times with PBST, 5min each time, and pat dry;

[0071] ⑤ Add HRP-labeled goat anti-mouse IgG secondary antibody (purchased from Beijing Bioson Biotechnology Co., Ltd.), 100 μL per well, incubate at 37°C for 1 h, wash 3 times with PBST, 5 min each time, and pat dry;

[0072] ⑥ Add TMB colorimetric solution (purchased from Beijing Solebow Technology Co., Ltd.), 100 μL per well, react at 37°C for 20 min;

[0073] ⑦ Add 50 μL 2 mol / L H2SO4 to each well to terminate the reaction and read the OD value at 450 nm on a microplate reader;

[0074] ⑧Result determination: The establishment conditions of this ELISA detection system: positive serum detection antigen OD 450 / Negative serum test antigen OD 450 ≥2.1; The positive judgment condition of the cell supernatant of the cell culture well to be tested is: the detection antigen OD of the supernatant 450 Reading value - control antigen OD 450 Reading value>0.2.

[0075] The results are shown in the following table. Table 1 shows the OD of the coated detection antigen (S9-Peg-GN08). 450 Table 2 shows the OD of the coated control antigen (S9-Peg) 450Table 3 shows the OD of the detection antigen (S9-Peg-GN08) 450 and control antigen (S9-Peg) OD 450 A total of 3 target ODs were screened. 450 -Control OD 450 The positive cell clones with OD > 0.2 were 1C10, 4E10 and 4G12 (underlined and bold in Table 3), among which the OD of the 1C10 cell culture well was 450 The difference was the highest (0.342), and this culture well was selected for further study.

[0076] Table 1 S9-Peg-GN08 detection antigen OD 450 Reading value

[0077] 1 2 3 4 5 6 7 8 9 10 11 12 A 0.715 1.245 0.317 0.432 0.261 0.417 0.669 0.833 0.629 0.109 0.192 2.47 B 0.482 0.207 0.564 0.304 0.099 0.22 0.109 0.309 0.122 0.244 0.277 0.297 C 0.584 0.509 0.326 0.246 0.153 0.992 0.324 0.441 0.487 0.689 0.171 0.157 D 0.581 0.336 0.525 0.182 0.094 0.533 0.326 0.287 0.227 0.231 0.121 0.389 E 0.574 0.652 0.442 0.115 0.079 1.085 0.105 0.16 0.325 0.462 0.351 0.153 F 0.839 0.406 0.571 0.465 0.134 0.443 0.173 0.301 0.126 0.106 0.239 1.843 G 0.342 0.288 0.42 0.313 0.184 0.36 0.14 0.287 0.121 0.43 0.167 0.978 H 0.301 0.26 0.301 0.248 0.155 0.388 0.204 0.479 0.24 0.18 0.162 0.595

[0078] Table 2 OD of S9-Peg control antigen 450 Reading value

[0079] 1 2 3 4 5 6 7 8 9 10 11 12 A 0.677 1.144 0.311 0.457 0.28 0.53 0.674 0.772 0.605 0.148 0.19 2.29 B 0.432 0.224 0.515 0.288 0.126 0.249 0.13 0.288 0.138 0.25 0.289 0.317 C 0.599 0.52 0.347 0.259 0.176 1.128 0.307 0.411 0.479 0.347 0.188 0.195 D 0.561 0.373 0.522 0.204 0.093 0.475 0.301 0.258 0.229 0.222 0.124 0.372 E 0.511 0.647 0.451 0.126 0.093 0.931 0.101 0.147 0.31 0.233 0.341 0.183 F 0.751 0.456 0.583 0.417 0.141 0.423 0.145 0.251 0.126 0.115 0.256 1.651 G 0.356 0.286 0.411 0.325 0.177 0.321 0.155 0.314 0.145 0.406 0.222 0.74 H 0.269 0.278 0.327 0.315 0.187 0.368 0.208 0.485 0.261 0.225 0.227 0.517

[0080] Table 3 OD of S9-Peg-GN08 detection antigen and S9-Peg control antigen 450 Reading difference

[0081]

[0082]

[0083] (6) Cell subcloning

[0084] The cell culture well 1C10 positive for the specific antibody against the GN08 epitope and the cell culture well 5B2 positive for the specific antibody against the MA11 epitope were selected, and subcloning was performed three times by limiting dilution method: the hybridoma cells to be cloned were fully mixed, diluted with HT complete medium, and the cell concentration was adjusted to a dilution containing 10 cells per milliliter; the hybridoma cells were dispensed into a 96-well plate, and the amount added to each well was 0.1 mL, and the number of hybridoma cells in each well was 1; 37°C, 6% CO2 humidified culture for 7 days, and after the appearance of visible cell clusters, indirect ELISA was used for identification until all single cell clone wells in the culture plate were detected as ELISA positive, thereby obtaining hybridoma cell lines 1C10E4 (cell culture well positive for the specific antibody against the GN08 epitope) and 5B2E3 (cell culture well positive for the specific antibody against the MA11 epitope).

[0085] 6. Preparation of monoclonal antibodies from ascites of hybridoma cell lines 1C10E4 and 5B2E3

[0086] Eight-week-old BALB / c female mice were intraperitoneally injected with liquid paraffin (0.3 mL / mouse). Seven days later, hybridoma cell lines were intraperitoneally injected into the mice. The number of cells injected into the mice was 1×10 6 / mouse, injection volume 0.1mL, and continuous monitoring began every day after 6 days. When the mouse's abdomen bulged and felt tight when touched, ascites was collected with a syringe, and centrifuged at 4000r / min for 10min to separate the supernatant.

[0087] 7. Specificity test and neutralization test of monoclonal antibodies against GN08 epitope and MA11 epitope (1) Cell neutralization test

[0088] Neutralization activity analysis is to dilute the antibody to be tested in multiples, and the highest dilution that protects 50% of porcine alveolar macrophage (PAM) cells (provided by Jiangsu Academy of Agricultural Sciences) from producing cytopathic effects is the neutralizing antibody titer. Neutralization activity was verified by live virus neutralization experiment, and neutralizing antibody titers were determined. Monoclonal antibodies against the GN08 epitope (cell culture supernatant and ascites monoclonal antibodies secreted by 1C10E4 hybridoma cell line) and monoclonal antibodies against the MA11 epitope (cell culture supernatant and ascites monoclonal antibodies secreted by 5B2E3 hybridoma cell line) were sent to the Veterinary Research Institute of Jiangsu Academy of Agricultural Sciences and the Military Veterinary Research Institute of the Academy of Military Medical Sciences for neutralization activity analysis of ASFV, and the neutralizing antibody titers of each hybridoma cell line supernatant and ascites were determined by live virus neutralization experiment. The experimental results are shown in Table 4. The antibodies secreted by the 1C10E4 hybridoma cell line targeting the GN08 epitope have high neutralizing activity against ASFV, and the neutralizing antibody titers of the 1C10E4 cell culture supernatant and ascites are 1:32 and 1:160, respectively; while the antibodies secreted by the 5B2E3 hybridoma cell line targeting the MA11 epitope have no neutralizing activity against ASFV.

[0089] Table 4 Neutralization activity determination of monoclonal antibodies against GN08 epitope and MA11 epitope

[0090]

[0091] (2) Immunofluorescence test

[0092] The ability of monoclonal antibodies against the GN08 epitope and MA11 epitope of the p12 protein of African swine fever virus to inhibit the infection of PAM cells by African swine fever virus was detected by immunofluorescence test. The African swine fever virus and PAM cells involved in the present invention were provided by the Military Veterinary Research Institute of the Academy of Military Medical Sciences and the Veterinary Research Institute of Jiangsu Academy of Agricultural Sciences, respectively. Figure 5As shown, the supernatants of 1C10E4 cell lines and 5B2E3 cell lines (cell culture monoclonal antibodies against the GN08 epitope and MA11 epitope of the p12 protein) can specifically bind to the African swine fever virus in the PAM of infected pigs, showing green fluorescence, and the highest dilution factor of the monoclonal antibody positive reaction of the GN08 cell culture supernatant is 1:400.

[0093] In summary, the screening and verification method of the neutralizing epitope in B cells on the surface of the outer envelope protein p12 of the African swine fever virus of the present invention obtains the B cell epitopes GSSGGGSN (GN08) and MPRQQKKCSKA (MA11) of the two p12 proteins by prediction, and obtains the hybridoma cell strain of monoclonal antibodies against the two epitopes by screening the immune antigen and the detection antigen carrying the above epitopes, and proves that the GN08 epitope is a neutralizing epitope by cell neutralization test, and the 1C10E4 monoclonal antibody against the epitope is a neutralizing monoclonal antibody that clearly targets the GN08 epitope of the p12 protein of the African swine fever virus; and although MA11 is predicted to be a B cell epitope, and it is proved to have binding activity by immunofluorescence, it is further verified that MA11 is not a neutralizing epitope of ASFV. In short, the present invention provides a screening and verification method for neutralizing epitopes in B cells on the surface of the outer envelope protein p12 of the African swine fever virus, which has potential application as a neutralizing target of ASFV.

Claims

1. A B cell neutralizing epitope peptide on the surface of the p12 protein of the outer envelope of African swine fever virus, characterized in that: The amino acid sequence of the B cell neutralizing epitope peptide GN08 is GSSGGGSN.

2. The nucleic acid molecule encoding the B cell neutralizing epitope peptide according to claim 1, characterized in that: The gene sequence of the nucleic acid molecule of the B cell neutralizing epitope peptide GN08 is GGTTCAAGTGGTGGAGGCTCTAAT.

3. An expression cassette, a recombinant vector, or a recombinant strain containing the nucleic acid molecule according to claim 2.

4. A recombinant strain or immune antigen, characterized in that: The recombinant strain or immune antigen is obtained by inserting the nucleic acid molecule described in claim 2 into the MisL passenger domain of the Salmonella V-type secretion system and introducing it into the host bacteria.

5. A recombinant strain or a detection antigen, characterized in that: The recombinant strain or the detection antigen is obtained by inserting the nucleic acid molecule of claim 2 into the Salmonella PEG pili operon gene and introducing the gene into the inert carrier S9 bacteria.

6. A hybridoma cell line, characterized in that: The hybridoma cell line secretes a neutralizing monoclonal antibody targeting the GN08 epitope peptide of the p12 protein of the outer envelope of the African swine fever virus. The GN08 epitope peptide is a neutralizing epitope peptide with an amino acid sequence of GSSGGGSN. It is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: C2023192.

7. A monoclonal antibody targeting the p12 envelope protein epitope peptide of African swine fever virus, characterized in that: The monoclonal antibody is obtained by secretion from the hybridoma cell line according to claim 6.

8. The method for screening and verifying the B cell neutralizing epitope peptide on the surface of the outer envelope protein p12 of the African swine fever virus according to claim 1, characterized in that: The monoclonal antibody targeting the p12 envelope protein epitope peptide of the African swine fever virus as described in claim 7 is obtained by neutralizing the African swine fever virus through a cell neutralization test to verify whether it has activity.

9. Use of the B cell neutralizing epitope peptide according to claim 1, the nucleic acid molecule according to claim 2, the expression cassette, recombinant vector or recombinant strain according to claim 3, the immune antigen according to claim 4, and the detection antigen according to claim 5 in preparing a reagent or kit for detecting antibodies, characterized in that: The antibody is the monoclonal antibody according to claim 7.

10. Use of the hybridoma cell line according to claim 6 or the monoclonal antibody according to claim 7 in the preparation of a reagent or a kit for detecting African swine fever virus.

11. A kit for detecting African swine fever virus, characterized in that: The kit comprises the hybridoma cell line according to claim 6 or the monoclonal antibody according to claim 7.

12. A kit for detecting African swine fever virus antibodies, characterized in that: The kit comprises the B cell neutralizing epitope peptide according to claim 1, the nucleic acid molecule according to claim 2, the expression cassette, recombinant vector or recombinant strain according to claim 3, the immune antigen according to claim 4 or the detection antigen according to claim 5, and the antibody is the monoclonal antibody according to claim 7.

Images