Preparation method of Xinjiang saussurea material and health tea

Abstract

The application provides a preparation method of Xinjiang Saussurea material and health-care tea, which comprises the following steps: firstly, introducing SiERF71 and SiERF74 genes into Xinjiang Saussurea by means of genetic engineering to obtain Xinjiang Saussurea material; secondly, taking the Xinjiang Saussurea material as main material, safflower and rose as auxiliary materials to prepare Xinjiang Saussurea health-care tea dry material; and finally, packaging the Xinjiang Saussurea health-care tea dry material to obtain Xinjiang Saussurea health-care tea. The SiERF71 and SiERF74 are firstly introduced into Xinjiang Saussurea by means of genetic engineering, and the Xinjiang Saussurea material and health-care tea with high antioxidant activity are obtained.

Description

Technical Field

[0001] This invention belongs to the field of health food technology, and relates to Xinjiang snow lotus health tea, specifically to a method for preparing Xinjiang snow lotus material and health tea. Background Technology

[0002] Xinjiang snow lotus (Saussurea involucrata Kar. et Kir.) is a perennial herb belonging to the genus Saussurea in the tribe Trib.Cynareae Less. of the family Compositae. It is a valuable medicinal plant from the plateau. Modern pharmacological studies have shown that Xinjiang snow lotus can effectively remove free radicals, combat fatigue, reduce inflammation, slow aging, and inhibit cancer cell proliferation. The native environment of Xinjiang snow lotus is harsh and its growth cycle is long, resulting in very limited wild resources. Furthermore, the large-scale and uncontrolled harvesting of snow lotus in recent years has led to a sharp decline in this plant's resources. Researching methods to utilize artificially propagated Xinjiang snow lotus to replace wild resources for medical and health purposes is of great significance for protecting wild Xinjiang snow lotus resources and the plateau ecological environment.

[0003] Health teas are made from natural, unpolluted tea leaves, fortified with certain nutrients, or, based on traditional Chinese medicine theory, incorporating natural foods that are both food and medicine, or Chinese herbal medicines that have undergone safety evaluations and possess nourishing or therapeutic properties. As health teas, they not only quench thirst and replenish the body's fluids but also provide useful nutrients, thus playing a role in health maintenance.

[0004] In higher plants, ERF-VII transcription factors have been widely demonstrated to act as regulatory elements, activating hypoxia-responsive genes and enhancing plant hypoxia tolerance. ERF-VII gene overexpression is associated with sustained activation of ROS scavenging responses; conversely, mutations within the gene family lead to increased ROS levels under stress. Therefore, rapid and sustained ROS scavenging is considered a positive effect leading to ERF-VII overexpression under oxidative stress. SiERF71 and SiERF74 are ERF-VII members from Xinjiang snow lotus, possessing potential antioxidant functions, but these have not yet been confirmed in the literature. Summary of the Invention

[0005] In view of the defects and deficiencies of the existing technology, the purpose of this invention is to provide a method for preparing Xinjiang snow lotus material and health tea, and to solve the technical problem that the antioxidant function of Xinjiang snow lotus health tea needs to be further improved in the existing technology.

[0006] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0007] A method for preparing Xinjiang snow lotus health tea: First, the SiERF71 and SiERF74 genes are transferred into Xinjiang snow lotus using genetic engineering techniques to obtain Xinjiang snow lotus material; then, the Xinjiang snow lotus material is used as the main ingredient, and safflower and rose are used as supplementary ingredients to prepare dried Xinjiang snow lotus health tea material; finally, the dried Xinjiang snow lotus health tea material is packaged to obtain Xinjiang snow lotus health tea.

[0008] The nucleotide sequence of the SiERF71 gene is shown in SEQ ID NO.1; the nucleotide sequence of the SiERF74 gene is shown in SEQ ID NO.2.

[0009] The present invention also has the following technical features:

[0010] Specifically, the dried Xinjiang snow lotus health tea material, by mass fraction, consists of the following raw materials: 40-80 wt% Xinjiang snow lotus, 10-30 wt% safflower, and 10-30 wt% rose petals.

[0011] Specifically, the Xinjiang snow lotus mentioned is an artificially cultivated plant of the Xinjiang snow lotus (Saussurea involucrata Kar.et Kir.ex Maxim.), a plant belonging to the genus Saussurea in the family Asteraceae.

[0012] Specifically, the method includes the following steps:

[0013] Step 1: Obtain Xinjiang snow lotus material using genetic engineering techniques:

[0014] Step 1.1: After surface disinfection of Xinjiang snow lotus seeds, they are sown on MS solid medium. After germination, sterile seedlings are obtained. Then, the leaf disc transformation method is used to transfer the SiERF71 and SiERF74 genes into Xinjiang snow lotus leaf cells with the help of Agrobacterium. The Xinjiang snow lotus leaf cells are then cultured in MS medium containing 6-benzyladenine until transgenic adventitious buds are induced.

[0015] Step 1.2: Transgenic adventitious shoots are transferred into MS medium containing 6-benzyladenine and α-naphthaleneacetic acid for culture and proliferation. The adventitious shoot leaves obtained after proliferation are the Xinjiang snow lotus materials.

[0016] Step 2: Prepare Xinjiang Snow Lotus Health Tea:

[0017] Take the Xinjiang snow lotus material obtained in step one and dry it for the first time at a temperature of 80-100℃ for 5-15 minutes. Then, add rose petals and safflower to the dried Xinjiang snow lotus material and dry it for the second time in a drying oven at a temperature of 60-100℃ for 10-30 minutes to obtain dried Xinjiang snow lotus health tea material. Finally, package the dried Xinjiang snow lotus health tea material into small bags and then vacuum pack it into large bags to obtain Xinjiang snow lotus health tea.

[0018] Specifically, in step 1.1, the MS culture medium contains 3.0 mg / L of 6-benzyladenine.

[0019] Specifically, in step 1.2, the MS culture medium contains 2.5 mg / L of 6-benzyladenine and 0.5 mg / L of α-naphthaleneacetic acid.

[0020] This invention also protects the preparation method of Xinjiang snow lotus material as described above.

[0021] The beneficial technical effects of this invention compared to the prior art are as follows:

[0022] This invention marks the first time that SiERF71 and SiERF74 have been transferred into Xinjiang snow lotus using genetic engineering techniques, resulting in snow lotus plants with high antioxidant activity (total antioxidant capacity reaching up to 1.52). Using the leaves as the raw material, and combining them with the pharmacological effects of rose and safflower, a Xinjiang snow lotus health tea was obtained through rational formulation and preparation. This health tea exhibits significant antioxidant effects and is effective in promoting blood circulation, dispelling wind and dampness, and relieving menstrual pain, especially for rheumatic diseases, amenorrhea, and dysmenorrhea.

[0023] The technical solution of the present invention will be further described below with reference to the embodiments. Detailed Implementation

[0024] It should be noted that, unless otherwise specified, all culture media, kits, and testing methods used in this invention are those known in the art, such as:

[0025] MS solid culture medium uses known solid culture media in the prior art, with the following specific formulation: potassium nitrate 1900 mg / L, ammonium nitrate 1650 mg / L, potassium dihydrogen phosphate 170 mg / L, magnesium sulfate 370 mg / L, calcium chloride 440 mg / L, potassium iodide 0.83 mg / L, boric acid 6.2 mg / L, manganese sulfate 22.3 mg / L; zinc sulfate 8.6 mg / L, sodium molybdate 0.25 mg / L, copper sulfate 0.025 mg / L, cobalt chloride 0.025 mg / L, disodium EDTA 37.25 mg / L, ferrous sulfate 27.85 mg / L, inositol 100 mg / L, glycine 2 mg / L, thiamine hydrochloride 0.1 mg / L, pyridoxine hydrochloride 0.5 mg / L, nicotinic acid 0.5 mg / L, and sucrose 30 g / L.

[0026] The T-AOC kit uses a known total antioxidant capacity (T-AOC) assay kit from Shanghai Bebo Biotechnology Co., Ltd., catalog number BB-4706.

[0027] The method for determining the total flavonoid content of Xinjiang snow lotus health tea is as follows: First, preparation of sample solution: Take 0.3g of Xinjiang snow lotus health tea, extract it with 80mL of 80% ethanol by ultrasonic extraction for 2h, let it stand to room temperature, centrifuge at 1200g to collect the supernatant, and extract the residue with 20mL of 80% ethanol for 1h. After centrifugation, mix the two extracts and make up to 100mL. Second, construction of standard curve: Weigh the rutin standard and prepare a 0.2mg / mL stock solution with 80% ethanol. Pipette 0, 0.4, 0.8, 1.2, 1.6, 2.0, and 2.4mL of the stock solution into 10mL volumetric flasks respectively; add 1mL of ethanol and 0.15mL of 5% NaNO2 aqueous solution, shake well and let stand for 6min; add 0.15mL of 10% AlCl3 solution and shake well and let stand for 6min; add 2mL of 4% NaOH solution, make up to volume with ethanol, shake well and let stand for 10min. The absorbance was measured at 510 nm. A standard curve was plotted with rutin concentration on the x-axis and absorbance on the y-axis: y = 8.3393x - 0.0046 (R²). 2 =0.9993); Third, determination of total flavonoid content in Xinjiang snow lotus health tea: 1 mL of sample solution was reacted according to the second step to measure the absorbance value, and the total flavonoid content of the sample was calculated according to the standard curve.

[0028] The method for determining the antioxidant activity of Xinjiang Snow Lotus Health Tea is as follows: Take 1 mL of sample solution (prepared using the same method as described in "Determination of Total Flavonoid Content in Xinjiang Snow Lotus Health Tea"), add 2 mL of 0.2 M PBS (pH 6.6) and 5 mL of 1% K3[Fe(CN)6] aqueous solution, and incubate at 50℃ for 30 min; add 5 mL of 10% trichloroacetic acid aqueous solution and mix well; take 2.5 mL of the supernatant, add 2.5 mL of distilled water and mix well, then add 0.5 mL of 0.1% ferric chloride aqueous solution, let stand for 5 min, and measure the absorbance value at 700 nm. Use 1 mL of 2 mg / mL VC aqueous solution as a positive control and 1 mL of PBS solution as a blank control. This method is based on the determination of the antioxidant activity of Fe... 3+ The antioxidant capacity of Xinjiang snow lotus health tea was tested by measuring its reducing power; the stronger the reducing power, the stronger the antioxidant capacity.

[0029] The method for determining the total antioxidative capacity (T-AOC) of Xinjiang Snow Lotus Health Tea in subacute aging mice is as follows: First, the construction of the subacute aging mouse model and the preparation of the test serum: Healthy female mice were subcutaneously injected with D-galactose (0.25 mL / 10 g·BW) in the back of the neck daily for 6 consecutive weeks. After this, the mice became sluggish, had dull fur, and were thin, exhibiting obvious signs of aging, thus creating a subacute aging model. Mice were then treated by gavage with deionized water (soaking concentration 5 g / L) infused with Xinjiang Snow Lotus Health Tea for 4 weeks. The animals were then sacrificed, and blood was collected to prepare serum. Second, the determination of the total antioxidant capacity of the mice: Using the serum obtained in the first step, the total antioxidant capacity of mice treated with different types of Xinjiang Snow Lotus Health Tea was determined. The determination method was performed according to the kit instructions, using the redox method to detect the total antioxidant capacity, i.e., the antioxidant substances can reduce Fe... 3+ Reduced to Fe 2+ With an absorbance of 520 nm (i.e., A) 520nm ) represents T-AOC.

[0030] Following the above technical solutions, specific embodiments of the present invention are given below. It should be noted that the present invention is not limited to the following specific embodiments, and all equivalent modifications made based on the technical solutions of this application fall within the protection scope of the present invention.

[0031] Example 1:

[0032] This embodiment provides a method for preparing Xinjiang snow lotus health tea. The method first uses genetic engineering to transfer the SiERF71 and SiERF74 genes into Xinjiang snow lotus to obtain Xinjiang snow lotus material. Then, using Xinjiang snow lotus material as the main ingredient and safflower and rose as the auxiliary ingredients, dried Xinjiang snow lotus health tea material is prepared. Finally, the dried Xinjiang snow lotus health tea material is packaged to obtain Xinjiang snow lotus health tea.

[0033] The nucleotide sequence of the described SiERF71 gene is shown in SEQ ID NO.1 as follows: 5’-at gtgcggtggagctctcatccccgacgccgatccggtcttcaaccgtgaccagaagctgacttccggtgatctctggtctgaattggacatctttgatctctacggctgggatgtcaaaccacaaacactctgttccgccactcaagttgctactaagaacgaaacaacttcaaaccgcaaaaaaatcatcaccaaagagccgagagacgaaaggactcggaagctgagcgagaacaaggcaaaacccaggaagaacaagtacaaagggaccaggcagcggccatggggaaaatgggcagctgagatccgggacccacagaagggtgtccgagtgtggctcggaacattcaacacagctgaagaagcggctcgagcctatgatgaagccgccaagcgtatccgaggtgataaggcaaagctcaactttcccatgccacccgccaagaagctgtgtgtcgagacccccaccgagtcaactcagctggccgtgcatgaacagccaccgccacctgcattgctggattataatcagttccgaaaccaatcttaccacccaaacagtactgtggctgatgaattcgagctcaaagaacagatttcgaacttggagaccttcttaggtcttgatcatgagtcgactcactttggtgggctcagtggtgagccggattatctttggatgatggatgacttcctttga-3’。

[0034]

[0035] The method specifically includes the following steps:

[0036] Step 1: Obtain Xinjiang snow lotus material using genetic engineering techniques:

[0037] Step 1.1: First, the surface of Xinjiang snow lotus seeds was disinfected, and then sown on MS solid medium. After germination, sterile seedlings were obtained. Then, the leaf disc transformation method was used (for specific steps, refer to the literature "Establishment of Genetic Transformation System of Tianshan Snow Lotus", [J]. Northwest Agriculture Journal, 2010, 19(7):84-88. Guan Yanyan, Ren Guodong, Guo Xinyong). The SiERF71 and SiERF74 genes were transferred into the leaf cells of Xinjiang snow lotus using LBA4404 Agrobacterium. The Xinjiang snow lotus leaf cells were then cultured in MS medium containing 3.0 mg / L 6-benzyladenine until transgenic adventitious buds were induced. After qPCR detection, the gene expression levels of the transgenic SiERF71 and SiERF74 lines were 1.68 times and 1.61 times that of the control (without exogenous gene transfer), respectively, confirming that the SiERF71 and SiERF74 genes were successfully transferred.

[0038] Step 1.2: After the transgenic adventitious shoots grow to more than 3 cm, they are transferred into MS medium containing 2.5 mg / L 6-benzyladenine and 0.5 mg / L α-naphthaleneacetic acid for repeated culture. The adventitious shoot leaves obtained after the proliferation are the Xinjiang snow lotus materials.

[0039] It should be noted that the Xinjiang snow lotus in this embodiment is an artificially cultivated plant of the Xinjiang snow lotus (Saussurea involucrata Kar.et Kir.ex Maxim.), a plant belonging to the genus Saussurea in the family Asteraceae.

[0040] Step 2: Prepare Xinjiang Snow Lotus Health Tea:

[0041] Take the Xinjiang snow lotus material obtained in step one and dry it for the first time in a drying oven at 100℃ for 10 minutes. Then, add rose petals and safflower to the dried Xinjiang snow lotus material and dry it for the second time in a drying oven at 80℃ for 20 minutes to obtain dried Xinjiang snow lotus health tea material. The dried Xinjiang snow lotus health tea material is composed of the following raw materials by mass fraction: 60 wt% Xinjiang snow lotus material, 20 wt% safflower, and 20 wt% rose petals. Finally, the dried Xinjiang snow lotus health tea material is first packaged into small bags, and then vacuum-packed into large bags to obtain Xinjiang snow lotus health tea.

[0042] Example 2:

[0043] This embodiment provides a method for preparing Xinjiang snow lotus health tea, which is basically the same as that in embodiment 1, except that in step two, the temperature of the first drying is 80°C and the drying time is 5 minutes; the temperature of the second drying is 60°C and the drying time is 10 minutes.

[0044] Example 3:

[0045] This embodiment provides a method for preparing Xinjiang snow lotus health tea, which is basically the same as that in embodiment 1, except that in step two, the temperature of the first drying is 80°C and the drying time is 10 minutes; the temperature of the second drying is 80°C and the drying time is 20 minutes.

[0046] Example 4:

[0047] This embodiment provides a method for preparing Xinjiang snow lotus health tea, which is basically the same as that in embodiment 1, except that in step two, the temperature of the first drying is 80°C and the drying time is 15 minutes; the temperature of the second drying is 100°C and the drying time is 30 minutes.

[0048] Example 5:

[0049] This embodiment provides a method for preparing Xinjiang snow lotus health tea, which is basically the same as that in embodiment 1, except that in step two, the temperature of the first drying is 100℃ and the drying time is 5 minutes; the temperature of the second drying is 60℃ and the drying time is 10 minutes.

[0050] Example 6:

[0051] This embodiment provides a method for preparing Xinjiang snow lotus health tea, which is basically the same as that in embodiment 1, except that in step two, the temperature of the first drying is 100℃ and the drying time is 15 minutes; the temperature of the second drying is 100℃ and the drying time is 30 minutes.

[0052] Comparative Example 1:

[0053] This comparative example provides a method for preparing Xinjiang snow lotus health tea, which is basically the same as that in Example 1, except that in step two, the temperature of the first drying is 120°C and the drying time is 5 minutes; the temperature of the second drying is 60°C and the drying time is 10 minutes.

[0054] Comparative Example 2:

[0055] This comparative example provides a method for preparing Xinjiang snow lotus health tea, which is basically the same as that in Example 1, except that in step two, the temperature of the first drying is 120°C and the drying time is 10 minutes; the temperature of the second drying is 80°C and the drying time is 20 minutes.

[0056] Comparative Example 3:

[0057] This comparative example provides a method for preparing Xinjiang snow lotus health tea, which is basically the same as that in Example 1, except that in step two, the temperature of the first drying is 120°C and the drying time is 15 minutes; the temperature of the second drying is 100°C and the drying time is 30 minutes.

[0058] Verification of the effects of Examples 1 to 6 and Comparative Examples 1 to 3:

[0059] To verify the effects of different processes on the biological effects of Xinjiang snow lotus health tea, the total flavonoid content, antioxidant activity and T-AOC of the Xinjiang snow lotus health teas prepared in Examples 1 to 7 and Comparative Examples 1 to 3 were determined. The results are shown in Table 1.

[0060] Table 1. Comparison of biological effects of Xinjiang snow lotus health tea processed with different techniques

[0061]

[0062]

[0063] As shown in Table 1, under the premise of obtaining Xinjiang snow lotus materials through genetic engineering and maintaining the same proportions, when the first drying temperature is 80–100℃ and the first drying time is 5–15 minutes, and the second drying temperature is 60–100℃ and the second drying time is 10–30 minutes, the total flavonoid content of Xinjiang snow lotus health tea can reach 6.9–7.5%, the antioxidant activity can reach 82.3–94.6%, and the T-AOC value can reach 1.07–1.52. When the first drying temperature is 120℃, the total flavonoid content, antioxidant activity, and T-AOC value of Xinjiang snow lotus health tea decrease significantly. The data in Table 1 show that drying temperature and time significantly affect the biological effects of Xinjiang snow lotus health tea. The best embodiment of this invention is Example 1.

[0064] Example 7:

[0065] This embodiment provides a method for preparing Xinjiang snow lotus health tea, which is basically the same as that in embodiment 1, except that: in step two, the dry material of Xinjiang snow lotus health tea is composed of the following raw materials by mass fraction: 40 wt% Xinjiang snow lotus, 30 wt% safflower, and 30 wt% rose.

[0066] Example 8:

[0067] This embodiment provides a method for preparing Xinjiang snow lotus health tea, which is basically the same as that in embodiment 1, except that: in step two, the dry material of Xinjiang snow lotus health tea is composed of the following raw materials by mass fraction: 80 wt% Xinjiang snow lotus, 10 wt% safflower, and 10 wt% rose.

[0068] Comparative Example 4:

[0069] This comparative example provides a method for preparing Xinjiang snow lotus health tea, which is basically the same as that in Example 1, except that in step two, the content of Xinjiang snow lotus material in the dried Xinjiang snow lotus health tea is 100wt%, and it does not contain safflower or rose.

[0070] Comparative Example 5:

[0071] This comparative example presents a method for preparing Xinjiang snow lotus health tea, which specifically includes the following steps:

[0072] Step 1: Use wild Xinjiang snow lotus as the raw material:

[0073] Wild Xinjiang snow lotus is cleaned and dried before being used as Xinjiang snow lotus material.

[0074] Step 2: Prepare Xinjiang Snow Lotus Health Tea:

[0075] Step two of this embodiment is basically the same as step two of embodiment 1, except that: in this embodiment, the dried Xinjiang snow lotus health tea material is composed of the following raw materials by mass fraction: 40wt% Xinjiang snow lotus material, 30wt% safflower, and 30wt% rose.

[0076] Comparative Example 6:

[0077] This comparative example provides a method for preparing Xinjiang snow lotus health tea, which is basically the same as that of comparative example 5, except that in step two, the dry material of Xinjiang snow lotus health tea is composed of the following raw materials by mass fraction: 60 wt% Xinjiang snow lotus, 20 wt% safflower, and 20 wt% rose.

[0078] Comparative Example 7:

[0079] This comparative example provides a method for preparing Xinjiang snow lotus health tea, which is basically the same as that of comparative example 5, except that in step two, the dry material of Xinjiang snow lotus health tea is composed of the following raw materials by mass fraction: 80 wt% Xinjiang snow lotus, 10 wt% safflower, and 10 wt% rose.

[0080] Comparative Example 8:

[0081] This comparative example provides a method for preparing Xinjiang snow lotus health tea, which is basically the same as that of comparative example 5, except that in step two, the content of Xinjiang snow lotus material in the dried Xinjiang snow lotus health tea is 100wt%, and it does not contain safflower or rose.

[0082] Comparative Example 9:

[0083] This comparative example presents a method for preparing Xinjiang snow lotus health tea, which specifically includes the following steps:

[0084] Step 1: Obtain Xinjiang snow lotus material using plant tissue culture:

[0085] First, the surface of Xinjiang snow lotus seeds is disinfected, and then they are sown on MS solid medium. After germination, sterile seedlings are obtained. Then, the leaves of the sterile seedlings are cut into 0.3 cm leaflets and inoculated into MS medium containing 2.5 mg / L 6-benzyladenine and 0.5 mg / L α-naphthaleneacetic acid for culture until adventitious buds grow. Finally, the adventitious buds are separated and transferred to MS medium containing 0.5 mg / L α-naphthaleneacetic acid to induce rooting and seedling formation. The leaves of these seedlings are the Xinjiang snow lotus materials.

[0086] Step 2: Prepare Xinjiang Snow Lotus Health Tea:

[0087] Step two of this embodiment is basically the same as step two of embodiment 1, except that: in this embodiment, the dried Xinjiang snow lotus health tea material is composed of the following raw materials by mass fraction: 40wt% Xinjiang snow lotus material, 30wt% safflower, and 30wt% rose.

[0088] Comparative Example 10:

[0089] This comparative example provides a method for preparing Xinjiang snow lotus health tea, which is basically the same as that of comparative example 9, except that in step two, the dry Xinjiang snow lotus health tea material is composed of the following raw materials by mass fraction: 60 wt% Xinjiang snow lotus material, 20 wt% safflower, and 20 wt% rose.

[0090] Comparative Example 11:

[0091] This comparative example provides a method for preparing Xinjiang snow lotus health tea, which is basically the same as that of comparative example 9, except that in step two, the dry material of Xinjiang snow lotus health tea is composed of the following raw materials by mass fraction: 80 wt% Xinjiang snow lotus, 10 wt% safflower, and 10 wt% rose.

[0092] Comparative Example 12:

[0093] This comparative example provides a method for preparing Xinjiang snow lotus health tea, which is basically the same as that of comparative example 9, except that in step two, the content of Xinjiang snow lotus material in the dried Xinjiang snow lotus health tea is 100wt%, and it does not contain safflower or rose.

[0094] Verification of the effects of Examples 1, 7, 8 and Comparative Examples 4 to 12:

[0095] To verify the effects of different Xinjiang snow lotus materials and different ratios on the biological effects of Xinjiang snow lotus health tea, the present invention conducted total flavonoid content determination, antioxidant activity determination and T-AOC determination on the Xinjiang snow lotus health teas prepared in Examples 1, 7, 8 and Comparative Examples 4 to 12. The results are shown in Table 2.

[0096] Table 2. Comparison of the biological effects of different Xinjiang snow lotus materials and different proportions on Xinjiang snow lotus health tea

[0097]

[0098] Table 2 shows that, under the same process and ratio, the total flavonoid content, antioxidant activity, and T-AOC value of the Xinjiang Snow Lotus health tea obtained by plant tissue culture were lower than those of the wild Xinjiang Snow Lotus medicinal material. However, the total flavonoid content, antioxidant activity, and T-AOC value of the Xinjiang Snow Lotus health tea obtained by genetic engineering were higher than those of the wild Xinjiang Snow Lotus medicinal material. Under the same process and Xinjiang Snow Lotus material, the Xinjiang Snow Lotus health tea showed the best overall effect when the ratio of Xinjiang Snow Lotus material, safflower, and rose petals was 6:2:2. The data in Table 2 indicate that different Xinjiang Snow Lotus materials and different ratios significantly affect the biological effects of the Xinjiang Snow Lotus health tea. Example 1 is the optimal embodiment of this invention.

Claims

1. A method for preparing Xinjiang snow lotus health tea, characterized in that, This method first uses genetic engineering techniques to... SiERF71 and SiERF74 Genes were transferred into Xinjiang snow lotus to obtain Xinjiang snow lotus material; then, using Xinjiang snow lotus material as the main ingredient and safflower and rose as supplementary ingredients, dried Xinjiang snow lotus health tea material was prepared; finally, the dried Xinjiang snow lotus health tea material was packaged to obtain Xinjiang snow lotus health tea. Using genetic engineering techniques to SiERF71 and SiERF74 Gene transfer into Xinjiang snow lotus and obtaining Xinjiang snow lotus materials involved: surface sterilization of Xinjiang snow lotus seeds, sowing on MS solid medium, obtaining sterile seedlings after germination, and then using the leaf disc transformation method with the help of Agrobacterium tumefaciens to transfer the gene into Xinjiang snow lotus. SiERF71 and SiERF74 The gene was transferred into the leaf cells of Xinjiang snow lotus, and the Xinjiang snow lotus leaf cells were further cultured in MS medium containing 6-benzyladenine until transgenic adventitious shoots were induced; in step 1.2, the transgenic adventitious shoots were transferred into MS medium containing 6-benzyladenine and α-naphthaleneacetic acid for culture and proliferation. The adventitious shoot leaves obtained after proliferation are the Xinjiang snow lotus materials. The aforementioned SiERF71 The nucleotide sequence of the gene is shown in SEQ ID NO.1; SiERF74 The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

2. The preparation method of Xinjiang snow lotus health tea as described in claim 1, characterized in that, The dried Xinjiang snow lotus health tea material, by mass fraction, is composed of the following raw materials: 40-80 wt% Xinjiang snow lotus, 10-30 wt% safflower, and 10-30 wt% rose.

3. The preparation method of Xinjiang snow lotus health tea as described in claim 1, characterized in that, The Xinjiang snow lotus mentioned is the Xinjiang snow lotus plant (Saussurea involucrata genus of the Asteraceae family). Saussurea involucrata Artificially cultured plants of Kar. et Kir. ex Maxim.

4. The preparation method of Xinjiang snow lotus health tea as described in claim 1, characterized in that, The method also includes: taking the obtained Xinjiang snow lotus material and drying it for the first time in an environment with a temperature of 80-100℃ for 5-15 minutes; then adding rose and safflower to the dried Xinjiang snow lotus material and drying it for the second time in a drying oven with a temperature of 60-100℃ for 10-30 minutes to obtain dried Xinjiang snow lotus health tea material; finally, packaging the dried Xinjiang snow lotus health tea material into small bags and then vacuum packaging it into large bags to obtain Xinjiang snow lotus health tea.

5. The preparation method of Xinjiang snow lotus health tea as described in claim 4, characterized in that, In step 1.1, the MS culture medium contains 3.0 mg / L of 6-benzyladenine.

6. The preparation method of Xinjiang snow lotus health tea as described in claim 4, characterized in that, In step 1.2, the MS medium contains 2.5 mg / L of 6-benzyladenine and 0.5 mg / L of α-naphthaleneacetic acid.

7. A method for preparing Xinjiang snow lotus material, characterized in that, This method uses genetic engineering techniques to... SiERF71 and SiERF74 Gene transfer was performed into Xinjiang snow lotus to obtain Xinjiang snow lotus materials. The method specifically included: surface sterilizing Xinjiang snow lotus seeds, sowing them on MS solid medium, obtaining sterile seedlings after germination, and then using the leaf disc transformation method with the help of Agrobacterium to transfer the germinated seeds into the plant. SiERF71 and SiERF74 The gene was transferred into the leaf cells of Xinjiang snow lotus, and the Xinjiang snow lotus leaf cells were further cultured in MS medium containing 6-benzyladenine until transgenic adventitious shoots were induced. The transgenic adventitious shoots were then transferred into MS medium containing 6-benzyladenine and α-naphthaleneacetic acid for culture and proliferation. The adventitious shoot leaves obtained after proliferation are the Xinjiang snow lotus materials. The aforementioned SiERF71 The nucleotide sequence of the gene is shown in SEQ ID NO.1; SiERF74 The nucleotide sequence of the gene is shown in SEQ ID NO.2.

Images