A D-amino acid oxidase mutant and its application in the preparation of L-phosphinothricin

Abstract

The invention discloses a D-amino acid oxidase mutant and application thereof in preparing L-glufosinate ammonium. In the mutant, at least one amino acid at positions 50, 52 and 331 of the amino acid sequence shown in SEQ ID No. 1 is replaced; asparagine Asn at position 50 is mutated to histidine His or arginine Arg, leucine Leu at position 52 is mutated to asparagine Asn, and alanine Ala at position 331 is mutated to serine Ser; and by mutating the active site of the D-amino acid oxidase, the mutant finally obtained has improved catalytic efficiency in a production process for oxidizing D-glufosinate ammonium to 2-carbonyl-4-[hydroxy(methyl)phosphono]butyric acid.

Description

Technical Field

[0001] The present invention relates to the technical field of enzyme engineering and genetic engineering, and in particular to a D-amino acid oxidase mutant and application thereof in the preparation of L-glufosinate ammonium. Background Art

[0002] Glufosinate (2-amino-4-hydroxymethylphosphinobutyric acid, abbreviated as PPT) is a highly effective non-selective herbicide and the second most widely used genetically modified crop-tolerant herbicide worldwide, second only to glyphosate. Glufosinate boasts high herbicidal activity, rapid herbicidal effects, broad weed control, easy degradation, and minimal environmental pollution. With the rapid development of genetically modified crops, market demand for glufosinate is increasing.

[0003] The main active ingredient in commercially used glufosinate herbicides is a racemic mixture of D,L-glufosinate (D,L-PPT). Only L-glufosinate has herbicidal activity, while the remaining 50% D-glufosinate is not only inactive but also difficult to degrade naturally, posing a significant environmental burden. The ability to convert D-glufosinate into L-glufosinate, thereby reducing herbicide usage and improving weed control efficiency, is of great practical significance.

[0004] The current mainstream methods for preparing L-glufosinate include chemical and biocatalytic methods. The chemical method not only has disadvantages such as high production costs, low production safety, and significant environmental pollution, but also faces a technical barrier: low optical purity. Biocatalytic production of glufosinate, in addition to the key advantage of high optical purity, also offers advantages such as mild reaction conditions and high conversion rates, making it the mainstream strategy for industrial production of L-glufosinate. This multi-enzyme cascade biosynthesis method uses racemic D,L-glufosinate as a substrate and undergoes a two-step enzymatic selective conversion. First, D-amino acid oxidase (DAAO) oxidizes D-glufosinate to 2-carbonyl-4-[hydroxy(methyl)phosphono]butyric acid (PPO). Furthermore, L-amino acid dehydrogenase reduces PPO to L-glufosinate, while the remaining 50% of the L-glufosinate does not participate in the reaction. Given the current industry overcapacity for D,L-glufosinate, this strategy offers advantages such as high product optical purity, low production costs, and environmental friendliness, making it highly valuable for industrial applications. Natural D-amino acid oxidases are unable to recognize non-natural substrates such as D-glufosinate, resulting in low catalytic efficiency and limited industrial applications. There is an urgent need to utilize genetic engineering and enzyme engineering techniques to optimize D-amino acid oxidase's substrate recognition ability for D-glufosinate and improve its catalytic efficiency to meet the demands of industrial applications. Summary of the Invention

[0005] Purpose of the invention: The first purpose of the present invention is to solve the problems of poor substrate recognition ability and low catalytic efficiency in the reaction of D-amino acid oxidase oxidizing D-phosphinothricin to 2-carbonyl-4-[hydroxy(methyl)phosphono]butyric acid. By directing the evolution of amino acids in the substrate binding pocket of D-amino acid oxidase, a class of D-amino acid oxidase mutants with improved catalytic efficiency in the production process of oxidizing D-phosphinothricin to 2-carbonyl-4-[hydroxy(methyl)phosphono]butyric acid is obtained; the second purpose of the present invention is to provide the use of the D-amino acid oxidase mutant in the oxidation of D,L-phosphinothricin to 2-carbonyl-4-[hydroxy(methyl)phosphono]butyric acid.

[0006] Technical solution: The D-amino acid oxidase mutant of the present invention is a mutant in which at least one amino acid at positions 50, 52, and 331 of the amino acid sequence shown in SEQ ID No. 1 is mutated; asparagine Asn at position 50 is mutated to histidine His or arginine Arg, leucine Leu at position 52 is mutated to asparagine Asn, and alanine Ala at position 331 is mutated to serine Ser.

[0007] The D-amino acid oxidase is an enzyme corresponding to NCBI Gene ID: Q99042, derived from Trigonopsis variabilis, with an amino acid sequence of SEQ ID NO.1 and a gene sequence of SEQ ID NO.2.

[0008] Preferably, the mutants include N50H, N50R, L52N, A331S, N50H+L52N, N50R+L52N, N50H+A331S, N50R+A331S, L52N+A331S, N50H+L52N+A331S or N50R+L52N+A331S.

[0009] The mutant N50H is a mutant in which the 50th asparagine Asn is mutated to histidine His.

[0010] The mutant N50R is a mutant in which the 50th asparagine Asn is mutated to arginine Arg.

[0011] The mutant L52N, that is, the 52nd leucine Leu is mutated to asparagine Asn.

[0012] The mutant A331S, that is, the 331st alanine Ala is mutated to serine Ser.

[0013] The mutant N50H+L52N, that is, the asparagine Asn at position 50 is mutated to histidine His and the leucine Leu at position 52 is mutated to asparagine Asn.

[0014] The mutant N50R+L52N, that is, the asparagine Asn at position 50 is mutated to arginine Arg and the leucine Leu at position 52 is mutated to asparagine Asn.

[0015] The mutant N50H+A331S, that is, the asparagine Asn at position 50 is mutated to histidine His and the alanine Ala at position 331 is mutated to serine Ser.

[0016] The mutant N50R+A331S, that is, the asparagine Asn at position 50 is mutated to arginine Arg and the alanine Ala at position 331 is mutated to serine Ser.

[0017] The mutant L52N+A331S, that is, the leucine Leu at position 52 is mutated to asparagine Asn and the alanine Ala at position 331 is mutated to serine Ser.

[0018] In the mutant N50H+L52N+A331S, the asparagine Asn at position 50 is mutated to arginine Arg, the leucine Leu at position 52 is mutated to asparagine Asn, and the alanine Ala at position 331 is mutated to serine Ser.

[0019] In the mutant N50R+L52N+A331S, the asparagine Asn at position 50 is mutated to arginine Arg, the leucine Leu at position 52 is mutated to asparagine Asn, and the alanine Ala at position 331 is mutated to serine Ser.

[0020] The gene of the present invention is a gene encoding the D-amino acid oxidase mutant protein.

[0021] The recombinant plasmid of the present invention is a recombinant plasmid containing the gene.

[0022] Preferably, the expression vector of the recombinant plasmid is a PET series expression vector.

[0023] The recombinant bacteria of the present invention carry the gene of the mutant or the recombinant plasmid.

[0024] The method for constructing the recombinant bacteria comprises the following steps:

[0025] (1) Construction of recombinant plasmid pET22b-TvDAAO: Ligating the ribitol dehydrogenase gene TvDAAO with the enzyme-digested plasmid pET22b to obtain the recombinant expression vector pET22b-TvDAAO;

[0026] (2) Construction of recombinant E. coli BL21 (DE3) / pET22b-TvDAAO: The constructed recombinant expression vector pET22b-TvDAAO was heat-transformed into competent E. coli BL21 (DE3), and the recombinant E. coli BL21 (DE3) / pET22b-vDAAO was obtained by culture and screening.

[0027] Preferably, the hosts are all Escherichia coli.

[0028] The D-amino acid oxidase mutant, the recombinant plasmid or the recombinant bacteria of the present invention are used in oxidizing D,L-phosphinothricin to convert it into 2-carbonyl-4-[hydroxy(methyl)phosphono]butyric acid.

[0029] The application includes the following steps: using a D-amino acid oxidase mutant as a catalyst and D,L-phosphinothricin as a substrate, catalyzing the conversion of D-phosphinothricin in D,L-phosphinothricin into 2-carbonyl-4-[hydroxy(methyl)phosphono]butyric acid. The catalytic process is as follows:

[0030]

[0031] Preferably, the catalytic reaction temperature is 25-45° C., and the pH is 6.5-10.

[0032] Invention Mechanism: After extensive and in-depth research, the present invention provides a D-amino acid oxidase, its preparation method, and application. Specifically, by amplifying the D-amino acid oxidase gene from Trigonopsis variabilis and using rational design to perform directed evolution, a D-amino acid oxidase with significantly improved substrate recognition and catalytic efficiency was obtained, thereby achieving efficient conversion of D-phosphinothricin to 2-carbonyl-4-[hydroxy(methyl)phosphono]butyric acid.

[0033] In the present invention, the sequence and structural information of publicly reported D-amino acid oxidases were used to screen out potential enzyme genes by performing non-redundant searches in databases such as NCBI, based on principles such as protein structure similarity, conserved site analysis, and host-source diversity. These genes were functionally expressed in an E. coli expression system and subsequently purified to obtain a pure enzyme. The preferred D-amino acid oxidase is derived from Trigonopsis variabilis and has certain catalytic activity, capable of catalyzing the conversion of D-phosphinothricin to 2-carbonyl-4-[hydroxy(methyl)phosphono]butyric acid.

[0034] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: (1) by mutating the active site of D-amino acid oxidase, the mutant finally obtained improves the catalytic efficiency in the production process of oxidizing D-phosphinothricin to 2-carbonyl-4-[hydroxy(methyl)phosphono]butyric acid; (2) the catalytic efficiency of the mutant N50H+L52N+A331S is 49.9%, which is 54.4 times the catalytic efficiency of the wild-type D-amino acid oxidase. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is a graph showing the conversion rate of D,L-PPT catalyzed by the D-amino acid oxidase mutants of Examples 1 to 11;

[0036] Figure 2 The graph shows the conversion rate of D,L-PPT catalyzed by the D-amino acid oxidase mutant (N50H+L52N+A331S) at different temperatures;

[0037] Figure 3 This is the conversion rate diagram of D,L-PPT catalytic oxidation by D-amino acid oxidase mutant (N50H+L52N+A331S) at different pH. DETAILED DESCRIPTION

[0038] The technical solution of the present invention will be further described below in conjunction with embodiments.

[0039] Example 1

[0040] 1. Construction of D-amino acid oxidase mutant plasmid

[0041] (1) Obtaining pET22b-TvDAAO

[0042] The wild-type gene for D-amino acid oxidase from Trigonopsis variabilis was synthesized by Jinweizhi (Suzhou) and constructed on the pET22b vector (the pET22b vector was provided by Jinweizhi). The vector was then transformed into the E. coli DH5α strain (purchased from Sangon Biotech (Shanghai) Co., Ltd.). The recombinant E. coli DH5α / pET22b-TvDAAO was inoculated into a 5 mL test tube filled with culture medium and cultured at 37°C, 220 rpm, and shaken for 12 hours. After the culture, the cells were centrifuged at 12,000 rpm for 1 minute and collected. The plasmid was extracted from the E. coli DH5α / pET22b-TvDAAO using a high-purity plasmid miniprep kit and used as a template for iterative mutagenesis to construct the plasmid pET22b-TvDAAO mutant.

[0043] (2) Construction of recombinant E. coli BL21(DE3) / pET22b-TvDAAO mutant

[0044] The target mutant gene was obtained by whole-plasmid PCR. The required primers were specifically designed using A331S as an example. Other mutants were designed using this principle and single-point iterative mutagenesis was performed.

[0045] A331S upstream primer: gcggcgggc agc ggctatcagag

[0046] A331S downstream primer: ctctgatagcc gct gcccgccgc

[0047] The PCR system is shown in Table 1.

[0048] Table 1 PCR reaction system

[0049]

[0050]

[0051] PCR reaction conditions are shown in Table 2.

[0052] Table 2 PCR reaction conditions

[0053]

[0054] After the PCR amplification was completed, the amplified product was detected by 0.9% agarose gel electrophoresis, and the results showed that the amplified product was a single band with a size of about 6000 bp. The amplified product was purified and recovered using a DNA recovery and purification kit.

[0055] The purified gene fragments were digested with DpnI to remove the template and then recombined using a recombinase. The recombinant product was transformed into E. coli DH5α competent cells and plated on the surface of LB solid medium containing 100 μg / mL ampicillin. The cells were incubated at 37°C for 12 hours, and single colonies were picked and transferred to LB liquid culture. Successful transformants were identified by PCR, and the correctness of the mutation site was verified by sequencing. After verification, a portion of the cells was added with sterile glycerol to a final concentration of 25%, numbered, and stored at -80°C until further use. A portion of the cells was used to extract the plasmid using a plasmid extraction kit, and the recombinant plasmids were stored at -20°C.

[0056] The recombinant expression plasmid pET22b that was successfully sequenced was transformed into E. coli BL21 (DE3) (E. coli, purchased from Sangon Biotech (Shanghai) Co., Ltd.) as the expression host to construct the recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-TvDAAO.

[0057] 2. Cultivation of D-amino acid oxidase mutants and preparation of crude enzyme solution

[0058] The recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-TvDAAO was successfully constructed and spread onto a plate containing ampicillin at a final concentration of 100 μg / mL. A single colony was picked and inoculated into 5 mL of LB medium containing resistance and cultured overnight at 37°C at 200 rpm / min. 1% of the inoculum was transferred to 500 mL of LB medium containing resistance and cultured at an OD of 4. 600 When the concentration reaches about 0.6, add IPTG with a final concentration of 0.5 mM and induce at 18°C ​​for about 14 hours.

[0059] After centrifugation, resuspend the cells in buffer and disrupt them by ultrasonication in an ice bath (2-second on-time, 5-second interval, 30-minute on-time). Centrifuge at 12,000 rpm for 20 minutes at 4°C. Collect the supernatant and filter through a 0.22 μm aqueous filter to obtain the crude enzyme solution.

[0060] Example 2

[0061] The N50H mutant was prepared based on Example 1. In step (2), the primers were changed, and the other conditions remained unchanged. The primers were as follows:

[0062] N50H upstream primer: gcgggcgcg cac tggctgacc

[0063] N50H downstream primer: ggtcagcca gtg cgcgcccgc.

[0064] Example 3

[0065] The N50R mutant was prepared based on Example 1. In step (2), the primers were changed, and the other conditions remained unchanged. The primers were as follows:

[0066] N50R upstream primer: gggcgggcgcg cgc tggctgacc

[0067] N50R downstream primer: ggtcagcca gcg cgcgcccgccc.

[0068] Example 4

[0069] The L52N mutant was prepared based on Example 1. In step (2), the primers were changed, and the other conditions remained unchanged. The primers were as follows:

[0070] L52N upstream primer: gcgaactgg aac accttttatgatg

[0071] L52N downstream primer: catcataaaaggt gtt ccagttcgcg.

[0072] Example 5

[0073] The N50H+L52N mutant was prepared based on Example 1. In step (2), the primers were changed, and the other conditions remained unchanged. The primers were as follows:

[0074] N50H+L52N upstream primer: gcgggcgcgcactggaacaccttttatgatgg

[0075] N50H+L52N downstream primer: ccatcataaaaggtgttccagtgcgcgcccgc.

[0076] Example 6

[0077] The N50R+L52N mutant was prepared based on Example 1. In step (2), the primers were changed, and the other conditions remained unchanged. The primers were as follows:

[0078] N50R+L52N upstream primer: gcgggcgcgcgctggaacaccttttatgatgg

[0079] N50R+L52N downstream primer: gccatcataaaaggtgttccagcgcgcgcccgcc.

[0080] Example 7

[0081] The N50H+A331S mutant was prepared based on Example 1. In step (2), the primers were changed, and the other conditions remained unchanged. The primers were as follows:

[0082] N50H+A331S upstream primer: gcgggcgcg cac tggctgacc

[0083] N50H+A331S downstream primer: ctctgatagcc gct gcccgccgc.

[0084] Example 8

[0085] The N50R+A331S mutant was prepared based on Example 1. In step (2), the primers were changed, and the other conditions remained unchanged. The primers were as follows:

[0086] N50R+A331S upstream primer: gggcgggcgcg cgc tggctgacc

[0087] N50R+A331S downstream primer: ctctgatagcc gct gcccgccgc.

[0088] Example 9

[0089] The L52N+A331S mutant was prepared based on Example 1. In step (2), the primers were changed, and the other conditions remained unchanged. The primers were as follows:

[0090] L52N+A331S upstream primer: gcgaactgg aac accttttatgatg

[0091] L52N+A331S downstream primer: ctctgatagcc gct gcccgccgc.

[0092] Example 10

[0093] The N50H+L52N+A331S mutant was prepared based on Example 1. In step (2), the primers were changed, and the other conditions remained unchanged. The primers were as follows:

[0094] N50H+L52N+A331S upstream primer: gcgggcgcgcactggaacaccttttatgatgg

[0095] N50H+L52N+A331S downstream primer: ctctgatagcc gct gcccgccgc.

[0096] Example 11

[0097] The N50R+L52N+A331S mutant was prepared based on Example 1. In step (2), the primers were changed, and the other conditions remained unchanged. The primers were as follows:

[0098] N50R+L52N+A331S upstream primer: gcgggcgcgcgctggaacaccttttatgatgg

[0099] N50R+L52N+A331S downstream primer: ctctgatagcc gct gcccgccgc.

[0100] Performance Testing

[0101] 1. D-amino acid oxidase and its mutants oxidize D-phosphinothricin to produce PPO

[0102] The corresponding engineered bacteria expressing D-amino acid oxidase and their mutants were cultured according to the construction of Examples 1 to 11 and the obtained crude enzyme solution was used as a catalyst.

[0103] The reaction system is: OD 600 = 80 crude enzyme solution, 400 mM D, L-PPT, commercial catalase at a concentration of 500 U / mL, and 100 mM potassium phosphate buffer at pH 6.5 were used as the reaction buffer. The reaction temperature was controlled at 30°C in a water bath with magnetic stirring and the reaction was carried out for 12 hours.

[0104] After the reaction is complete, add an equal volume of methanol to the reaction mixture and shake thoroughly at 400 rpm for 10 minutes. Centrifuge at 4000 rpm for 10 minutes. Discard the precipitate and use the treated reaction mixture for later use. Substrate conversion is determined using Marfey derivatization reagent and high-performance liquid chromatography (HPLC).

[0105] Derivatization method: 100 μL of the above-treated reaction solution was mixed with 200 μL of 100 mM Marfey derivatization reagent (1-fluoro-2-4-dinitrophenyl-5-L-alanine amide), 100 μL of 1 M sodium bicarbonate solution, and 100 μL of DMSO. The reaction temperature was controlled at 65°C in a water bath with magnetic stirring for 30 minutes. After completion of the reaction, 200 μL of 4 M HCl was added to terminate the reaction. The supernatant was collected by centrifugation and analyzed by HPLC.

[0106] The HPLC analysis method was as follows: chromatographic column Agilent TC-C18 (4.6×250 mm); column temperature 30°C; flow rate 1 mL / min; detection wavelength 340 nm; mobile phase: methanol and ultrapure water with 0.1% trifluoroacetic acid, and the operating program was to increase the acetonitrile concentration from 40% to 90% within 9 minutes.

[0107] The test results are shown in Table 3 and Figure 1 .

[0108] Table 3 D-amino acid oxidase and its mutants catalyze the oxidation of D, L-PPT

[0109] strain Cell concentration Substrate conversion rate WT <![CDATA[OD 600 =80]]> 0.9％ A331S <![CDATA[OD 600 =80]]> 3.5％ N50H <![CDATA[OD 600 =80]]> 22.7％ N50R <![CDATA[OD 600 =80]]> 18.4％ L52N <![CDATA[OD 600 =80]]> 5.2％ N50H+L52N <![CDATA[OD 600 =80]]> 39.1％ N50R+L52N <![CDATA[OD 600 =80]]> 35.7％ N50H+A331S <![CDATA[OD 600 =80]]> 32.6％ N50R+A331S <![CDATA[OD 600 =80]]> 28.9％ L52N+A331S <![CDATA[OD 600 =80]]> 17.8％ N50H+L52N+A331S <![CDATA[OD 600 =80]]> 49.9％ N50R+L52N+A331S <![CDATA[OD 600 =80]]> 42.1％

[0110] Depend on Figure 1The results showed that the catalytic conversion rates of all mutants were higher than that of wild-type D-amino acid oxidase. In particular, the catalytic efficiency of the mutant N50H+L52N+A331S was 49.9%, which was 54.4 times that of the wild-type D-amino acid oxidase.

[0111] 2. Optimal temperature for the D-amino acid oxidase mutant (N50H+L52N+A331S) to catalyze the oxidation of D,L-PPT to PPO

[0112] The corresponding engineered bacteria expressing D-amino acid oxidase and its mutants were cultured according to the construction of Example 10 and the obtained crude enzyme solution was used as a catalyst.

[0113] The reaction system is: OD 600 = 80 crude enzyme solution, 400mM D, L-PPT, commercial catalase (Catalase) concentration of 500U / mL, reaction buffer is 100mM potassium phosphate buffer pH = 6.5. The reaction temperature is controlled at 25℃, 30℃, 35℃, 40℃, and 45℃ in a water bath, with magnetic stirring, and the reaction is carried out for 12h. The substrate conversion rate is detected by Marfey derivatization reagent and high performance liquid chromatography (HPLC). The test results are shown in Figure 2 .

[0114] Depend on Figure 2 It can be seen that the best catalytic effect was observed at 30°C, and the enzyme activity was good in the range of 25-40°C.

[0115] 3. Optimal pH for the oxidation of D-PPT to PPO catalyzed by the D-amino acid oxidase mutant (N50H+L52N+A331S)

[0116] The corresponding engineered bacteria expressing D-amino acid oxidase and its mutants were cultured according to the construction of Example 10 and the obtained crude enzyme solution was used as a catalyst.

[0117] The reaction system is: OD 600 = 80 crude enzyme solution, 400mM D, L-PPT, commercial catalase (Catalase) at a concentration of 500U / mL, reaction buffers consisting of 100mM potassium phosphate buffer at pH = 6.5, 200mM potassium phosphate buffer at pH = 7.5, 50mM Tris-HCl buffer at pH = 8, 50mM Tris-HCl buffer at pH = 9, and 50mM boric acid buffer at pH = 10. The reaction temperature was controlled at 30°C in a water bath with magnetic stirring, and the reaction was carried out for 12 hours. The substrate conversion rate was detected by Marfey derivatization reagent and high performance liquid chromatography (HPLC). The test results are shown in Figure 3 .

[0118] Depend on Figure 3It can be seen that different pH has a significant effect on the catalytic effect of TvDAAO. The best catalytic effect was observed at pH 6.5. As the pH increases, the enzyme catalytic activity decreases significantly.

Claims

1. A D-amino acid oxidase mutant, characterized in that The mutant is a mutant in which at least one amino acid is replaced at positions 50, 52, and 331 of the amino acid sequence shown in SEQ ID No. 1; the asparagine Asn at position 50 is mutated to histidine His, the leucine Leu at position 52 is mutated to asparagine Asn, and the alanine Ala at position 331 is mutated to serine Ser; the mutant is selected from N50H, N50H+L52N, N50H+A331S, or N50H+L52N+A331S.

2. A gene encoding the D-amino acid oxidase mutant protein according to claim 1.

3. A recombinant plasmid containing the gene according to claim 2.

4. The recombinant plasmid according to claim 3, characterized in that The expression vector of the recombinant plasmid is a PET series expression vector.

5. A recombinant bacterium carrying the gene of the mutant according to claim 2 or the recombinant plasmid according to claim 3.

6. The recombinant bacterium according to claim 5, characterized in that The host of the mutant gene or recombinant plasmid is Escherichia coli.

7. Use of the D-amino acid oxidase mutant according to claim 1, the recombinant plasmid according to claim 3, or the recombinant bacterium according to claim 5 in oxidizing D,L-phosphinothricin to 2-carbonyl-4-[hydroxy(methyl)phosphono]butyric acid.

8. The use according to claim 7, characterized in that The application comprises the following steps: using a D-amino acid oxidase mutant as a catalyst and D,L-phosphinothricin as a substrate to catalyze the conversion of D-phosphinothricin in D,L-phosphinothricin into 2-carbonyl-4-[hydroxy(methyl)phosphono]butyric acid.

9. The use according to claim 8, characterized in that The catalytic reaction temperature is 25-45° C., and the pH is 6.5-10.

Images