Application of G protein-coupled receptor ADGRA3 and hesperetin in the preparation of drugs promoting fat browning

Abstract

The present invention discloses the use of G protein-coupled receptor ADGRA3 and hesperetin in the preparation of drugs that promote the browning of white fat. Studies in the present invention demonstrate that hesperetin and overexpression of ADGRA3 have the effect of promoting the browning of white fat. Therefore, the present invention first provides the use of G protein-coupled receptor ADGRA3 as a drug target in the preparation of drugs that promote the browning of white fat. It further clarifies that hesperetin promotes the browning of white fat through the G protein-coupled receptor ADGRA3. Therefore, the present invention also provides the use of hesperetin in the preparation of drugs that promote the browning of white fat, providing more directions for the development of drugs to treat metabolic diseases such as obesity.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the use of G protein-coupled receptor ADGRA3 and hesperetin in the preparation of drugs for promoting the browning of white fat. Background Art

[0002] Metabolic syndrome, including obesity and hyperglycemia, is a group of clinical syndromes characterized by insulin resistance and abnormalities in multiple metabolic components. This syndrome is prone to increase the risk of developing metabolic diseases such as obesity and type 2 diabetes, and obesity is one of the most serious public health problems in the world. The main cause of obesity is the imbalance between energy intake and expenditure. In current clinical treatment, weight loss and improvement of metabolic homeostasis are mainly achieved through intervention in the patient's diet and lifestyle, as well as drug and surgical treatments. However, this treatment method is time-consuming and has limited effects. In addition, the use of drugs and surgery is also prone to cause other adverse reactions in the body. Therefore, the current existing technology for the treatment of obesity is still limited in its promotion and application.

[0003] Previous epidemiological studies have shown that excessive fat mass is closely associated with a higher incidence of metabolic diseases. Consequently, excessive fat accumulation and ectopic deposition were previously attributed to obesity and related metabolic diseases as the sole cause. However, significant inter-individual variability exists: some obese individuals maintain metabolic health, while others of normal weight exhibit significant metabolic disorders. Furthermore, individuals with malnutrition have lower fat content but suffer from many metabolic disorders similar to those with severe obesity. Recent advances in adipose tissue research have revealed that adipose tissue is a highly heterogeneous and plastic endocrine and immune organ. Adipose tissue exhibits distinct cellular composition and structure in different locations, leading to distinct metabolic regulatory functions in each region. Adipocytes primarily consist of white and brown adipocytes. White adipose tissue can transform into beige adipose tissue upon cold stimulation, exhibiting heat production and energy consumption similar to brown adipose tissue. This process is known as adipose browning. Uncoupling protein 1 (UCP1) is a recognized molecular marker of adipose browning, and its upregulation is considered a classic indicator of adipose browning. Exploring more markers that can induce or promote the browning of fat cells can provide new ideas for the treatment of metabolic diseases such as obesity. Summary of the Invention

[0004] The purpose of the present invention is to provide the use of G protein coupled receptor ADGRA3 and hesperetin in the preparation of a drug for promoting the browning of white fat.

[0005] The above-mentioned object of the present invention is achieved through the following technical solutions:

[0006] The present invention first provides the use of G protein coupled receptor ADGRA3 as a target in the preparation of a drug that promotes the browning of white fat.

[0007] In experiments at the cellular level, the present invention has studied the mechanism by which hesperetin induces beige adipocytes by activating the PKA signaling pathway: hesperetin activates the PKA signaling pathway and upregulates the expression level of UCP1 in adipocytes; PKA signaling pathway inhibitors (PKAi) or knockdown of ADGRA3 can block the effects of hesperetin activating the PKA signaling pathway and upregulating the expression level of UCP1 in adipocytes. In addition, in experiments at the animal and cellular levels, the present invention has studied the mechanism by which overexpression of ADGRA3 induces beige adipocytes by activating the PKA signaling pathway: overexpression of ADGRA3 activates the PKA signaling pathway and upregulates the expression level of UCP1 in adipocytes; PKA signaling pathway inhibitors (PKAi) can block the effects of overexpression of ADGRA3 activating the PKA signaling pathway and upregulating the expression level of UCP1 in adipocytes.

[0008] In summary, after a large number of experiments, the present invention has clarified that hesperetin and overexpression of ADGRA3 have the effect of promoting the browning of white fat, and that hesperetin promotes the browning of white fat through the G protein-coupled receptor ADGRA3.

[0009] Therefore, the present invention provides use of a preparation for promoting ADGRA3 expression in the preparation of a medicament for promoting the browning of white fat.

[0010] Preferably, the agent for promoting ADGRA3 expression comprises an Adgra3 gene expression promoter.

[0011] Preferably, the Adgra3 gene expression promoter includes an Adgra3 overexpression vector.

[0012] Preferably, the vector is a plasmid vector or a viral vector.

[0013] Preferably, the Adgra3 overexpression vector is a pLV3-CMV-Adgra3-3×FLAG-CopGFP-Puro overexpression plasmid.

[0014] Preferably, the preparation method of the pLV3-CMV-Adgra3-3×FLAG-CopGFP-Puro overexpression plasmid is to clone the CDS sequence of the Adgra3 gene into the pLV3-CMV-3×FLAG-CopGFP-Puro plasmid backbone to construct the pLV3-CMV-Adgra3-3×FLAG-CopGFP-Puro overexpression plasmid; the CDS sequence of the Adgra3 gene is shown in SEQ ID No. 1.

[0015] The present invention also provides the use of hesperetin in preparing a PKA signaling pathway agonist.

[0016] Preferably, the hesperetin can act as a PKA signaling pathway agonist to activate PKA-CREB signaling and promote the browning of white fat.

[0017] The present invention also provides the use of hesperetin in preparing a preparation for promoting UPC1 expression.

[0018] The present invention also provides the use of hesperetin in preparing a medicine for promoting the browning of white fat.

[0019] A drug for promoting the browning of white fat, comprising an effective amount of a preparation promoting ADGRA3 expression and / or hesperetin.

[0020] The drug can be a single drug, a pharmaceutical composition, or a kit containing an effective amount of an agent that promotes ADGRA3 expression and / or hesperetin, and a pharmaceutically acceptable carrier. "Effective amount" means "an amount of the drug disclosed herein that is effective at the dosage and time period required to achieve the desired outcome or therapeutic result." The effective amount can vary depending on factors known in the art, such as the disease state, age, sex, and weight of the human or animal being treated. Those skilled in the art will appreciate that the dosage regimen can be modified to provide the optimal therapeutic response. For example, several divided doses can be administered daily, or the dose can be proportionally reduced as dictated by the urgency of the therapeutic situation. Furthermore, the drug disclosed herein can be administered as frequently as desired to achieve an effective therapeutic amount. The drug can be used in patients or other animals receiving the drug of the present application to treat, prevent, alleviate, and / or alleviate the diseases or conditions described herein. In a preferred embodiment, the drug or health product is used in mammals, including but not limited to humans, cattle, horses, sheep, pigs, goats, rabbits, cats, dogs, mice, and any other mammal with a liver that can sustain damage.

[0021] In a preferred embodiment, the medicament is for use in humans.

[0022] The pharmaceutically acceptable carrier refers to a carrier for the administration of therapeutic agents, including various excipients and diluents. Including but not limited to lactose, glucose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginate, gel, calcium silicate, microcrystalline cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil etc., but are not limited thereto. In addition to the above-mentioned components, the medicine of the application may also include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents and preservatives etc.

[0023] The drug can be administered in a unit dosage form, and the administration route can be enteral or parenteral, such as oral, intramuscular, subcutaneous, nasal, oral mucosal, cutaneous, peritoneal, or rectal. Examples of dosage forms include tablets, capsules, dripping pills, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal preparations, buccal tablets, suppositories, and lyophilized powder injections. These can be conventional preparations, sustained-release preparations, controlled-release preparations, and various microparticle delivery systems.

[0024] Preferably, the agent for promoting ADGRA3 expression comprises an Adgra3 gene expression promoter.

[0025] Preferably, the Adgra3 gene expression promoter includes an Adgra3 overexpression vector.

[0026] The Adgra3 overexpression vector refers to cloning the Adgra3 gene coding region into a corresponding vector, and utilizing the regulatory elements constructed on the vector backbone to enable the gene to be transcribed and translated in large quantities under artificially controlled conditions, thereby achieving overexpression of the target gene; the vector includes but is not limited to plasmid vectors, viral vectors (mammalian), and siRNA expression vectors.

[0027] Preferably, the vector is a plasmid vector or a viral vector.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] The present invention demonstrates that hesperetin and overexpression of ADGRA3 promote the browning of white fat. Therefore, the present invention first provides the use of the G protein-coupled receptor ADGRA3 as a drug target in the preparation of a drug that promotes the browning of white fat. It further clarifies that hesperetin promotes the browning of white fat through the G protein-coupled receptor ADGRA3. Therefore, the present invention also provides the use of hesperetin in the preparation of a drug that promotes the browning of white fat, providing more direction for the development of drugs to treat metabolic diseases such as obesity. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1Hesperetin Hes induces browning of white fat through the ADGRA3-PKA signaling axis. (A) Intracellular cAMP levels in mature adipocytes induced by 3T3-L1 under different treatment conditions; (B) Ucp1 mRNA levels in mature adipocytes induced by 3T3-L1 under different treatment conditions; (C) UCP1, p-CREB, and CREB protein levels in mature adipocytes induced by 3T3-L1 under different treatment conditions; (D) Adgra3 and Ucp1 mRNA levels in mature adipocytes induced by 3T3-L1 under different treatment conditions; (E) ADGRA3, UCP1, p-CREB, and CREB protein levels in mature adipocytes induced by 3T3-L1 under different treatment conditions; (F) Ucp1 mRNA levels in mature adipocytes induced by 3T3-L1 under different treatment conditions; (G) UCP1, p-CREB, and CREB protein levels in mature adipocytes induced by 3T3-L1 under different treatment conditions.

[0031] Figure 2 ADGRA3 induces browning of white fat. (A) Changes in Adgra3 and Ucp1 mRNA levels after overexpression of Adgra3 in adipocytes; (B) ADGRA3-3×FLAG and UCP1 protein levels in mature adipocytes induced by 3T3-L1 cells under different treatment conditions; (C) Body temperature of ADGRA3-overexpressing mice; (D) Thermal imaging and brown adipose tissue temperature of ADGRA3-overexpressing mice; (E) ADGRA3-3×FLAG and UCP1 protein levels in inguinal subcutaneous white adipose tissue of ADGRA3-overexpressing mice; (F) ADGRA3-3×FLAG and UCP1 protein levels in brown adipose tissue of ADGRA3-overexpressing mice; (G) Hematoxylin and eosin (HE) staining of inguinal subcutaneous white adipose tissue and brown adipose tissue of ADGRA3-overexpressing mice; (H) UCP1 immunohistochemical staining of inguinal subcutaneous white adipose tissue and brown adipose tissue of ADGRA3-overexpressing mice.

[0032] Figure 3 Schematic diagram of the mechanism by which hesperetin Hes and ADGRA3 induce fat browning. DETAILED DESCRIPTION

[0033] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0034] Unless otherwise specified, all reagents and materials used in the following examples were commercially available, including hesperetin purchased from Shanghai MacLean Biochemical Technology Co., Ltd.

[0035] English name: Hesperetin

[0036] CAS No.: 520-33-2

[0037] Molecular formula: C 16 H 14 O6

[0038] Molecular structure: Example 1 Verification of Hesperetin Hes Induces White Fat Browning Through ADGRA3-PKA Signaling Axis

[0039] To verify whether hesperetin promotes the browning of white fat, we treated mature adipocytes induced from 3T3-L1 cells with 10 μM hesperetin for 24 hours and performed relevant tests. The specific experimental methods are as follows:

[0040] (1) ELISA detection of intracellular cAMP levels in mature adipocytes induced by 3T3-L1:

[0041] Sample collection: Dilute the cell suspension with PBS to a concentration of 1 million cells / mL. Further disrupt the cells by ultrasonication to release intracellular components. Centrifuge at 3000 rpm for 20 minutes at 4°C and carefully collect the supernatant.

[0042] Prepare solution: Prepare 0nM, 2nM, 4nM, 8nM, 16nM and 32nM cAMP standard solutions, and add 50μL of different concentrations of standard solutions and test samples to the bottom of the ELISA plate wells, and gently shake to mix;

[0043] Incubation: Seal the plate with a sealing film and incubate in a 37°C constant temperature incubator for 30 minutes;

[0044] Washing: Carefully tear open the sealing film, discard the liquid, shake dry, fill each well with PBS, let it stand for 30 seconds and then discard, repeat this 5 times, and pat dry;

[0045] Add enzyme: add 50 μL of enzyme-labeled reagent to each well;

[0046] Incubation: Seal the plate with a sealing film and incubate in a 37°C constant temperature incubator for 30 minutes;

[0047] Washing: Carefully tear open the sealing film, discard the liquid, shake dry, fill each well with PBS, let it stand for 30 seconds and then discard, repeat this 5 times, and pat dry;

[0048] Color development: Add 50 μL of color developer A to each well, then add 50 μL of color developer B, gently shake to mix, and develop color at 37°C in the dark for 10 minutes;

[0049] Stop: add 50 μL stop solution to each well;

[0050] Determination: Zero the wells with 0 nM standard solution, measure the absorbance of each well in sequence at 450 nm, and calculate the cAMP concentration of the sample based on the concentration of each standard solution.

[0051] (2) Detection of mRNA levels in mature adipocytes:

[0052] RNA extraction: RNA from treated mature adipocytes was extracted using total RNA extraction reagent (BS258A). The extraction method was described in the instructions of the extraction reagent.

[0053] Reverse transcription: The obtained RNA was reverse transcribed into cDNA using a one-tube reverse transcription kit (BL696A). The specific experimental method is shown in the kit instructions;

[0054] mRNA level detection: The cDNA obtained by reverse transcription was detected using a universal fluorescent quantitative PCR kit (BL697A). The specific experimental method is shown in the kit instructions. Finally, the mRNA levels of mature adipocytes under different treatment conditions were calculated.

[0055] (3) Detection of protein levels in mature adipocytes:

[0056] Place the treated 6-well plate on ice, wash three times with PBS, and then add an appropriate amount of 1×RIPA lysis buffer (CST). Let stand at room temperature for 2 minutes; use a cell scraper to gently scrape the wall of the dish and collect the lysis buffer in a 1.5ml centrifuge tube, boil at 95℃ for 10 minutes to fully denature the protein; use the Keygen BCA protein quantification kit to quantify the collected protein concentration; add 1μL protein buffer (β-mercaptoethanol, 0.4% bromophenol blue) to every 9μL denatured protein sample to prepare the protein sample, boil at 95℃ for 10 minutes; take the prepared SDS-PAGE gel (made of 10% separation gel and 5% stacking gel), add 20μg / well of the sample, and add the protein ladder marker; use 80V electrophoresis on the stacking gel, and change the voltage to 120V when the bromophenol blue runs to the separation gel; stop electrophoresis when the bromophenol blue runs to the appropriate position. Place a PVDF membrane on the surface of a PAGE gel and transfer the membrane at a constant current of 300 mA for 80 minutes to transfer the proteins from the PAGE gel to the PVDF membrane. After electrotransfer, block the membrane with 7% milk for 2 hours to reduce nonspecific background. Add the target protein antibody and shake overnight at 4°C. Add the corresponding secondary antibody and shake at 4°C for 4 hours. Wash the membrane three times with TBST (10 minutes each time). Visualize the PVDF membrane with ECL ultrasensitive chemiluminescence solution.

[0057] Result analysis:

[0058] The results are as follows Figure 1 As shown, Figure 1 (A) Intracellular cAMP levels in mature adipocytes induced by 3T3-L1 under different treatment conditions. It can be seen that hesperetin promotes the production of cAMP in adipocytes. Figure 1 (B) and (C) show the mRNA levels of Ucp1 and the protein levels of UCP1, p-CREB, and CREB, respectively, in mature adipocytes induced from 3T3-L1 cells under different treatment conditions. The results show that hesperetin can increase the expression levels of UCP1 and p-CREB. These results indicate that hesperetin can induce the browning of white fat.

[0059] Example 2 Verifies that hesperetin activates PKA-CREB signaling through ADGRA3 to promote the browning of white fat

[0060] To verify whether hesperetin promotes the browning of white fat by activating PKA-CREB signaling through ADGRA3, we treated mature adipocytes with ADGRA3 knockdown (shAdgra3) with 10 μM hesperetin for 24 hours. The specific experimental methods are as follows:

[0061] (1) Knockdown of ADGRA3 in mature adipocytes:

[0062] Construction of knockdown plasmids: Using the pLKO.1-U6-scramble-EF1a-copGFP-T2A-puro plasmid backbone, knockdown plasmids containing the shNC sequence and the sh Adgra3 sequence were constructed by PCR.

[0063] Transfect cells to knock down ADGRA3: Use Lipo8000 transfection reagent (purchased from Shanghai Beyotime Biotechnology Co., Ltd.) to transfect the above knockdown plasmid into mature adipocytes to achieve the purpose of knocking down ADGRA3. For specific transfection steps, please refer to the instructions of Lipo8000 transfection reagent.

[0064] The shNC sequence and sh Adgra3 sequence are as follows:

[0065] shNC sequence:

[0066] CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAG G;

[0067] sh Adgra3 sequence:

[0068] AGGAGTAGGAGAGCTTATTTACTCGAGTAAATAAGCTCTCCTACTCCT.

[0069] (2) Detection of mRNA levels in mature adipocytes:

[0070] RNA extraction: RNA from treated mature adipocytes was extracted using total RNA extraction reagent (BS258A). The extraction method was described in the instructions of the extraction reagent.

[0071] Reverse transcription: The obtained RNA was reverse transcribed into cDNA using a one-tube reverse transcription kit (BL696A). The specific experimental method is shown in the kit instructions;

[0072] mRNA level detection: The cDNA obtained by reverse transcription was detected using a universal fluorescent quantitative PCR kit (BL697A). The specific experimental method is shown in the kit instructions. Finally, the mRNA levels of mature adipocytes under different treatment conditions were calculated.

[0073] (3) Detection of protein levels in mature adipocytes:

[0074] Place the treated 6-well plate on ice, wash three times with PBS, and then add an appropriate amount of 1×RIPA lysis buffer (CST). Let stand at room temperature for 2 minutes; use a cell scraper to gently scrape the wall of the dish and collect the lysis buffer in a 1.5ml centrifuge tube, boil at 95℃ for 10 minutes to fully denature the protein; use the Keygen BCA protein quantification kit to quantify the collected protein concentration; add 1μL protein buffer (β-mercaptoethanol, 0.4% bromophenol blue) to every 9μL denatured protein sample to prepare the protein sample, boil at 95℃ for 10 minutes; take the prepared SDS-PAGE gel (made of 10% separation gel and 5% stacking gel), add 20μg / well of the sample, and add the protein ladder marker; use 80V electrophoresis on the stacking gel, and change the voltage to 120V when the bromophenol blue runs to the separation gel; stop electrophoresis when the bromophenol blue runs to the appropriate position. Place a PVDF membrane on the surface of a PAGE gel and transfer the membrane at a constant current of 300 mA for 80 minutes to transfer the proteins from the PAGE gel to the PVDF membrane. After electrotransfer, block the membrane with 7% milk for 2 hours to reduce nonspecific background. Add the target protein antibody and shake overnight at 4°C. Add the corresponding secondary antibody and shake at 4°C for 4 hours. Wash the membrane three times with TBST (10 minutes each time). Visualize the PVDF membrane with ECL ultrasensitive chemiluminescence solution.

[0075] Result analysis:

[0076] The mRNA levels of Adgra3 and Ucp1 and the protein levels of UCP1, p-CREB and CREB in mature adipocytes induced from 3T3-L1 cells under different treatment conditions were found ( Figure 1 DE), when Adgra3 was knocked down, the induction effect of hesperetin on UCP1 and p-CREB was abolished. These results indicate that hesperetin promotes the browning of white adipose tissue through ADGRA3.

[0077] Example 3 Verification that the browning effect of hesperetin on white fat depends on PKA-CREB signaling

[0078] We used PKAi (PKA signaling pathway inhibitor) to verify whether Hsperetin's effect on promoting the browning of white fat depends on PKA-CREB signaling. PKAi treatment conditions were 10 μM H-89 treatment for 24 hours in mature adipocytes, and Hsperetin treatment conditions were 10 μM Hsperetin treatment for 24 hours in mature adipocytes. The mRNA and protein levels of mature adipocytes were detected as follows:

[0079] (1) Detection of mRNA levels in mature adipocytes:

[0080] RNA extraction: RNA from treated mature adipocytes was extracted using total RNA extraction reagent (BS258A). The extraction method was described in the instructions of the extraction reagent.

[0081] Reverse transcription: The obtained RNA was reverse transcribed into cDNA using a one-tube reverse transcription kit (BL696A). The specific experimental method is shown in the kit instructions;

[0082] mRNA level detection: The cDNA obtained by reverse transcription was detected using a universal fluorescent quantitative PCR kit (BL697A). The specific experimental method is shown in the kit instructions. Finally, the mRNA levels of mature adipocytes under different treatment conditions were calculated.

[0083] (2) Detection of protein levels in mature adipocytes:

[0084] Place the treated 6-well plate on ice, wash three times with PBS, and then add an appropriate amount of 1×RIPA lysis buffer (CST). Let stand at room temperature for 2 minutes; use a cell scraper to gently scrape the wall of the dish and collect the lysis buffer in a 1.5ml centrifuge tube, boil at 95℃ for 10 minutes to fully denature the protein; use the Keygen BCA protein quantification kit to quantify the collected protein concentration; add 1μL protein buffer (β-mercaptoethanol, 0.4% bromophenol blue) to every 9μL denatured protein sample to prepare the protein sample, boil at 95℃ for 10 minutes; take the prepared SDS-PAGE gel (made of 10% separation gel and 5% stacking gel), add 20μg / well of the sample, and add the protein ladder marker; use 80V electrophoresis on the stacking gel, and change the voltage to 120V when the bromophenol blue runs to the separation gel; stop electrophoresis when the bromophenol blue runs to the appropriate position. Place a PVDF membrane on the surface of a PAGE gel and transfer the membrane at a constant current of 300 mA for 80 minutes to transfer the proteins from the PAGE gel to the PVDF membrane. After electrotransfer, block the membrane with 7% milk for 2 hours to reduce nonspecific background. Add the target protein antibody and shake overnight at 4°C. Add the corresponding secondary antibody and shake at 4°C for 4 hours. Wash the membrane three times with TBST (10 minutes each time). Visualize the PVDF membrane with ECL ultrasensitive chemiluminescence solution.

[0085] Result analysis:

[0086] From the results of Ucp1 mRNA level and UCP1, p-CREB and CREB protein level in mature adipocytes induced by 3T3-L1 under different treatment conditions ( Figure 1FG), hesperetin can upregulate the expression of UCP1 and p-CREB proteins. However, when treated with PKAi simultaneously, the upregulation of UCP1 and p-CREB protein expression by hesperetin was abolished, indicating that the effect of hesperetin in promoting the browning of white fat is dependent on PKA-CREB signaling.

[0087] Combined with Examples 1 to 3, the above results indicate that hesperetin Hes induces browning of white fat via the ADGRA3-PKA-CREB signaling axis.

[0088] Example 4 Verifies that ADGRA3 has the effect of inducing browning of white fat

[0089] To verify whether ADGRA3 plays a role in promoting the browning of white fat, we overexpressed ADGRA3 in mature adipocytes induced by 3T3-L1 cells (Adgra3 OE) and in mice (Adgra3 OE) and performed related tests. The specific experimental methods are as follows:

[0090] (1) Adgra3 overexpression (Adgra3 OE):

[0091] 1) Plasmid construction: Using codon optimization and PCR techniques, the CDS sequence of the mouse Adgra3 gene was cloned into the pLV3-CMV-3×FLAG-CopGFP-Puro plasmid backbone to construct the pLV3-CMV-Adgra3-3×FLAG-CopGFP-Puro overexpression plasmid;

[0092] 2) Overexpression by transfection: The above-mentioned overexpression plasmid was transfected into mice or mature adipocytes using Lipo8000 transfection reagent (purchased from Shanghai Biotech Co., Ltd.) to achieve the purpose of overexpression of ADGRA3. For specific transfection steps, please refer to the instructions of Lipo8000 transfection reagent.

[0093] 3) The optimized CDS sequence of the Adgra3 gene is shown in SEQ ID No. 1 (the optimized portion is shown in capital letters):

[0094]

[0095] (2) Detection of mRNA levels in adipose tissue / mature adipocytes:

[0096] RNA extraction: RNA from treated adipose tissue / mature adipocytes was extracted using total RNA extraction reagent (BS258A). The extraction method was described in the instructions of the extraction reagent.

[0097] Reverse transcription: The obtained RNA was reverse transcribed into cDNA using a one-tube reverse transcription kit (BL696A). The specific experimental method is shown in the kit instructions;

[0098] mRNA level detection: The cDNA obtained by reverse transcription was detected using a universal fluorescent quantitative PCR kit (BL697A). The specific experimental method is shown in the kit instructions. Finally, the mRNA levels of adipose tissue / mature adipocytes under different treatment conditions were calculated.

[0099] (3) Protein level detection in adipose tissue / mature adipocytes:

[0100] Cell samples: Place the treated 6-well plate on ice, wash three times with PBS, and then add an appropriate amount of 1× RIPA lysis buffer (CST). Incubate at room temperature for 2 minutes. Use a cell scraper to gently scrape the sides of the dish and collect the lysis buffer in a 1.5ml centrifuge tube. Boil at 95°C for 10 minutes to fully denature the protein. Quantify the collected protein concentration using the Keygen BCA protein quantification kit. Prepare the protein sample by adding 1μL of protein buffer (β-mercaptoethanol, 0.4% bromophenol blue) to every 9μL of denatured protein sample. Boil at 95°C for 10 minutes. Prepare the prepared SDS-PAGE gel (composed of 10% separating gel and 5% stacking gel), add 20μg of the sample / well, and add a protein ladder marker. Run the stacking gel at 80V, then increase the voltage to 120V when the bromophenol blue reaches the separating gel. Stop the electrophoresis when the bromophenol blue reaches the appropriate position. Place a PVDF membrane on the surface of a PAGE gel and transfer the membrane at a constant current of 300 mA for 80 minutes to transfer the proteins from the PAGE gel to the PVDF membrane. After electrotransfer, block the membrane with 7% milk for 2 hours to reduce nonspecific background. Add the target protein antibody and shake overnight at 4°C. Add the corresponding secondary antibody and shake at 4°C for 4 hours. Wash the membrane three times with TBST (10 minutes each time). Visualize the PVDF membrane with ECL ultrasensitive chemiluminescence solution.

[0101] Tissue samples: Take 50 mg of tissue sample and add 1 ml of RIPA lysis buffer. Mince the tissue with scissors, then homogenize and sonicate on ice. Centrifuge at 10,000 rpm for 10 minutes. Transfer the supernatant to a fresh EP tube. Subsequent steps are the same as for cell processing.

[0102] (4) Body temperature measurement: The body temperature of the animals was measured at room temperature at 9:00 a.m. using a non-contact infrared thermometer (DT-8806S, CEM). The average temperature of the abdomen of each animal was measured three times.

[0103] (5) Thermal imaging of small animals: Thermal imaging images were taken at room temperature at 9:00 am using a thermal imager (FLIR ONE PRO).

[0104] (6) HE staining:

[0105] 1) First, place the tissue sections in a 65°C incubator for 30 minutes;

[0106] 2) Xylene dewaxing (10 min / time; 3 times);

[0107] 3) Hydrate in the following order: 100%, 95%, 90%, 80%, and 70% alcohol, each for 5 minutes;

[0108] 4) Stain with hematoxylin for 3 minutes;

[0109] 5) Washing: Differentiation with 1% hydrochloric acid and ethanol, pay attention to controlling the differentiation time;

[0110] 6) Rinse with running water for 20 minutes;

[0111] 7) Stain with eosin for 1 minute, then rinse with running water for 20 minutes;

[0112] 8) Place in 70%, 80%, 90%, 95%, and 100% alcohol for 5 minutes in that order;

[0113] 9) Soak in xylene twice, 10 minutes each time;

[0114] 10) Allow to dry in a dedicated fume hood, seal with neutral resin, and photograph using a microscope.

[0115] (6) Immunohistochemical staining:

[0116] 1) Place the tissue sections in a 65°C incubator and incubate for 20 minutes;

[0117] 2) Dewaxing with xylene (20 min / time, 3 times);

[0118] 3) Hydration: place in 100%, 95%, 90%, 80%, or 70% alcohol for 5 minutes;

[0119] 4) Antigen retrieval: Place the sections in a pressure cooker and add 0.01 M citrate buffer to boil. After complete degassing, time for 2 minutes. Then, let the sections cool to room temperature and wash three times with PBST for 5 minutes each.

[0120] 5) Blocking: Incubate with 3% hydrogen peroxide solution in a 37°C incubator for 30 minutes, and rinse three times with PBST for 5 minutes each time;

[0121] 6) Blocking: Block with goat serum at room temperature for 1 hour, then wash with PBST three times for 5 minutes each time;

[0122] 7) Dry the sections with absorbent paper and add the primary antibody against UCP1 (1:200 dilution) at 4°C overnight. Wash with PBST three times for 5 minutes each.

[0123] 8) Add the secondary antibody A solution in the immunohistochemical staining kit, incubate at room temperature for 1 hour, and wash three times with PBST, each time for 5 minutes;

[0124] 9) DAB color development: Add DAB color development solution (Solution B:Solution C = 50:1) and rinse with running water for 20 minutes immediately after the UCP1 protein turns brown.

[0125] 10) Counterstaining: stain with hematoxylin for 2 minutes, then rinse with running water for 20 minutes;

[0126] 11) Dehydration: Place in 100%, 95%, 90%, 80%, and 70% alcohol for 5 minutes respectively;

[0127] 12) Place in xylene twice, 10 minutes each time;

[0128] 13) After the slices have dried, add neutral resin and seal with a coverslip. Finally, observe and photograph them under a microscope.

[0129] Result analysis:

[0130] The results are as follows Figure 2 As shown in Figure 2, the mRNA levels of Adgra3 and Ucp1 and the protein levels of ADGRA3 and UCP1 in mature adipocytes induced from 3T3-L1 cells under different treatment conditions showed that ADGRA3 upregulated the expression level of UCP1 in adipocytes ( Figure 2 AB). At the same time, ADGRA3 can increase the body temperature of mice and promote thermogenesis in brown fat ( Figure 2CD), combined with ADGRA3 overexpression in the inguinal subcutaneous white adipose tissue of mice ( Figure 2 E) and the protein levels of ADGRA3-3×FLAG and UCP1 in brown adipose tissue ( Figure 2 F) The results show that ADGRA3 can upregulate the UCP1 level in white adipose tissue and brown adipose tissue. Hematoxylin and eosin (HE) staining of inguinal subcutaneous white adipose tissue and brown adipose tissue of ADGRA3 overexpressing mice ( Figure 2 G) and UCP1 immunohistochemical staining ( Figure 2 H) It can be seen that ADGRA3 induces the multi-lumenization of white and brown fat. These results indicate that ADGRA3 can induce the browning of white fat.

[0131] The mechanism of hesperetin Hes and ADGRA3 inducing fat browning Figure 3 As shown, Figure 3 Drawn using Figdraw, authorized export ID is IWAIA0d9f9.

[0132] Although the embodiments of the present application have been described above, the present application is not limited to the above-mentioned specific embodiments and fields of application. The above-mentioned specific embodiments are merely illustrative and instructive, and not restrictive. A person of ordinary skill in the art, guided by this specification and without departing from the scope of protection of the claims of this application, may also devise various forms, all of which fall within the scope of protection of this application.

Claims

1. Use of a preparation for promoting the expression of G protein-coupled receptor ADGRA3 in the preparation of a drug for treating obesity; the preparation for promoting the expression of ADGRA3 is Adgra3 Gene expression promoter; Adgra3 Gene expression enhancers are Adgra3 Overexpression vector.

2. The application according to claim 1, characterized in that The vector is a plasmid vector or a viral vector.

Images