A kind of root mold and its application in compound Xiaoqu

Abstract

The present invention relates to a root mold and an application thereof in a composite Xiaoqu. The American root mold (Rhizopus americanus) X2 strain provided by the present invention is preserved in the China Center for Type Culture Collection (CCTCC) with a preservation number of CCTCC NO:M 20231795. The strain has a rich and balanced saccharification enzyme system and a moderate saccharification speed, especially low fusel oil production and high alcohol resistance, and the composite Xiaoqu prepared by the American root mold X2 strain improves the wine yield of Xiaoqu liquor while ensuring the purity of the Xiaoqu liquor body, and the brewed Xiaoqu liquor can be used as a base liquor for blending liquor.

Description

Technical Field

[0001] The invention relates to the field of microorganisms, and in particular to a root mold and application thereof in compound Xiaoqu. Background Art

[0002] Rhizopus is a type of filamentous fungus that can be produced and reproduced in starch raw materials. It has been widely used in the brewing of Xiaoqu wine because of its good starch saccharification ability. At present, the mainstream Rhizopus strain on the market is Q303. Studies have found that this strain contains rich amylase, generally including liquefying and saccharifying amylases. Among them, Rhizopus' saccharifying amylase is particularly rich. This enzyme can break the α-1,4 bonds and α-1,6 bonds in the starch structure, and finally convert it into fermentable sugars more completely.

[0003] CN112011467A discloses Rhizopus oryzae, a bacterial agent, bran koji and a preparation method thereof, as well as their application, wine and a preparation method thereof. The characteristics of the invention are that the screened Rhizopus oryzae has high saccharification activity and can significantly improve and stabilize the saccharifying enzyme activity of bran koji. The bran koji prepared by the Rhizopus oryzae has the advantages of high saccharification power and honey aroma when used in liquor brewing.

[0004] CN117757640A discloses a Rhizopus fungus NX-2, which is characterized by its ability to produce high levels of saccharifying enzymes and to be prepared into a bacterial preparation through solid pure culture with brewer's yeast. The preparation is used in liquor fermentation to improve saccharifying and fermenting abilities, thereby increasing the yield of liquor and shortening the fermentation period.

[0005] CN116676147A discloses a Tibetan highland barley koji, which uses Rhizopus oryzae YC666 as the dominant strain for highland barley fermentation and adds the dominant strain Rhizopus oryzae to increase the abundance of microorganisms in the highland barley koji, thereby making the highland barley koji have higher stability and higher saccharifying power.

[0006] In the existing Rhizopus Xiaoqu brewing Xiaoqu liquor, due to its high saccharification ability, the Xiaoqu liquor generally has the problems of fast saccharification speed and fast fermentation temperature rise during the fermentation process, which leads to the massive reproduction of yeast in the mash, thereby causing a lack of exogenous available nitrogen sources, causing the yeast to start utilizing endogenous protein amino acid metabolism, thereby leading to the massive production of fusel oil, and producing aromatic flavor substances such as ethyl acetate, ethyl propionate, n-propanol, 3-methylbutanol, acetaldehyde, etc. during the fermentation process, which makes the Rhizopus Xiaoqu liquor bitter and unclean.

[0007] With the implementation of the new national standard for Chinese liquor GB / T 15109-2021 "Terms of the Liquor Industry", edible alcohol has been banned from being used in solid-state liquor. Liquor factories urgently need to produce Xiaoqu liquor with low flavor, low fusel oil and high yield by solid-state raw grain fermentation to replace edible alcohol and use it as a base liquor for liquor blending. However, the root mold koji of Xiaoqu liquor currently has problems such as high fusel oil content, bitter taste, and fast fermentation speed in the early and middle stages, which cannot meet the urgent needs of the industry that the new national standard for liquor prohibits the use of edible alcohol in solid liquor.

[0008] Therefore, screening out Rhizopus strains with rich and balanced saccharification enzymes, moderate saccharification rates, especially low fusel oil production and high alcohol resistance, is one of the main measures to meet the urgent needs of the liquor industry for the large-scale production of low-flavor, clean-bodied Xiaoqu liquor to replace edible alcohol. Summary of the invention

[0009] The existing Rhizopus Xiaoqu Liquor has a high content of fusel oil, which makes the Rhizopus Xiaoqu Liquor bitter and unclean, unable to meet the new national standard of liquor to replace edible alcohol, and the urgent industry demand for use as a base liquor for liquor blending, and the problem of low liquor yield.

[0010] The present invention provides an American Rhizopus X2 strain, which has a rich and balanced saccharification enzyme system, a moderate saccharification speed, especially low fusel oil production, high alcohol resistance, and a composite Xiaoqu prepared by the American Rhizopus X2 strain, wherein the bran pure Rhizopus and an appropriate amount of bran high temperature resistant brewing active dry yeast have a high degree of matching, and on the premise of ensuring that the Xiaoqu liquor body is clean, the liquor yield of the Xiaoqu liquor is improved, and the Xiaoqu liquor can be used as a base liquor for blending. The technical scheme of the present invention is as follows:

[0011] In a first aspect, the present invention provides a Rhizopus americanus X2 strain, characterized in that the strain is deposited in the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: M 20231795.

[0012] Preferably, the American Rhizopus X2 strain is characterized in that the gene sequence of 26S rDNA of the strain is shown in SEQ ID NO:1.

[0013] In a second aspect, the present invention provides a composite Xiaoqu, characterized in that the composite Xiaoqu contains the American Rhizopus X2 strain according to claim 1 or 2.

[0014] Preferably, the compound Xiaoqu is characterized in that, by weight, the compound Xiaoqu comprises 6-9.5 parts of pure Rhizopus from bran and 0.5-4 parts of high temperature resistant active dry yeast from bran;

[0015] The pure Rhizopus of the bran is prepared by the American Rhizopus X2 strain, and the high-temperature-resistant active dry yeast for brewing of the bran is prepared by the high-temperature-resistant active dry yeast for brewing of the bran.

[0016] Preferably, the compound Xiaoqu is characterized in that, by weight, the compound Xiaoqu comprises 8.0-9.0 parts of pure bran Rhizopus and 1.0-2.0 parts of bran high temperature resistant active dry yeast for brewing.

[0017] In a third aspect, the present invention provides a method for preparing the composite Xiaoqu, characterized in that the preparation method comprises the following steps:

[0018] S1, prepare the American Rhizopus X2 strain into pure bran Rhizopus;

[0019] S2, preparing the heat-resistant active dry yeast for brewing into the heat-resistant active dry yeast for brewing of bran;

[0020] S3, mixing the pure Rhizopus from bran and the heat-resistant active dry yeast from bran.

[0021] Preferably, the method for preparing the composite Xiaoqu is characterized in that step S1 comprises the following steps:

[0022] S11, the American Rhizopus X2 strain is gradually expanded and cultured into Rhizopus first-class species, Rhizopus bran second-class species and Rhizopus bran third-class species;

[0023] S12, inoculating the third-grade strain of Rhizopus oleraceus into a fermentation medium to ferment and obtain pure Rhizopus oleraceus.

[0024] Preferably, the method for preparing the composite Xiaoqu is characterized in that, in step S12, the fermentation medium comprises raw materials and nutrient solution, and the material-liquid ratio (g raw materials / L nutrient solution) is 1:(0.75-0.85);

[0025] Preferably, the raw materials include 70-90% bran, 5-15% rice bran and 5-15% rice flour according to the weight percentage of the raw materials;

[0026] Further preferably, according to the mass ratio of each component in the nutrient solution to the volume of the nutrient solution (g of each component in the nutrient solution / L of the nutrient solution), the nutrient solution includes 0.2-1% ammonium sulfate, 0.2-1% yeast autolyzed powder and 0.5-2% sucrose;

[0027] And / or, the pH value of the nutrient solution is 2.5-3.5.

[0028] Preferably, the method for preparing the composite Xiaoqu is characterized in that, in step S12, the fermentation temperature is 25-40°C;

[0029] Preferably, the fermentation air volume is controlled at 200-700m3 / hm 2 .

[0030] Preferably, the method for preparing the composite Xiaoqu is characterized in that, after step S12, a drying step is further included;

[0031] Preferably, the drying temperature is 37-42°C;

[0032] Further preferably, drying to a moisture content of pure Rhizopus in the bran of ≤10wt%;

[0033] More preferably, the powder is coarsely pulverized after drying.

[0034] Preferably, the method for preparing the composite Xiaoqu is characterized in that step S2 comprises inoculating the heat-resistant active dry yeast for brewing into the bran, and adding the yeast autolyzed powder and saccharifying enzyme for culturing;

[0035] Preferably, the inoculation amount of the thermostable active dry yeast for brewing is 0.5-1.5% based on the weight percentage of the bran;

[0036] and / or, the amount of yeast autolyzed powder added is 3-5%;

[0037] and / or, the amount of saccharifying enzyme added is 0.2-0.4%;

[0038] and / or, the enzymatic activity of the saccharifying enzyme is 110,000-130,000 u / g;

[0039] Further preferably, the inoculation amount of the thermostable active dry yeast for brewing is 1-1.2% based on the weight percentage of the bran;

[0040] and / or, the amount of yeast autolyzed powder added is 3.5-4.5%;

[0041] and / or, the amount of saccharifying enzyme added is 0.25-0.35%;

[0042] More preferably, the method further comprises a drying step after the culturing;

[0043] and / or, the drying temperature is 40-45°C;

[0044] and / or, drying until the moisture content of the bran heat-resistant active dry yeast is ≤10wt%;

[0045] and / or, coarsely shredded after drying.

[0046] In a fourth aspect, the present invention provides a compound Xiaoqu prepared by the method for preparing the compound Xiaoqu.

[0047] In a fifth aspect, the present invention provides a Xiaoqu liquor, characterized in that the Xiaoqu liquor is brewed by the composite Xiaoqu.

[0048] In a sixth aspect, the present invention provides a method for brewing Xiaoqu liquor, characterized in that the method comprises: inoculating the composite Xiaoqu into a starchy raw material for brewing liquor, wherein the starchy raw material is selected from one or more of sorghum, corn, rice, millet, barley, wheat or corn.

[0049] Preferably, the method is characterized in that the inoculation amount of the composite Xiaoqu is 3-10‰ based on the weight of the starchy raw material;

[0050] Preferably, the inoculation amount of the composite Xiaoqu is 5-8‰ based on the weight of the starchy raw material.

[0051] In a seventh aspect, the present invention provides the use of the American Rhizopus X2 strain in the preparation of composite Xiaoqu.

[0052] In an eighth aspect, the present invention provides the use of the composite Xiaoqu in the production of Xiaoqu liquor.

[0053] Beneficial effects of the present invention:

[0054] The American Rhizopus X2 strain of the present invention has the characteristics of rich and balanced saccharification enzyme system, moderate saccharification speed, especially low production of fusel oil and resistance to high alcohol content.

[0055] In addition, the composite Xiaoqu prepared by the American Rhizopus X2 strain has a high degree of compatibility between pure Rhizopus of bran and an appropriate amount of high-temperature-resistant active dry yeast of bran, which well realizes saccharification and fermentation at the same time. Under the premise of ensuring the clean body of Xiaoqu liquor, the yield of 50° rice Xiaoqu liquor reaches more than 74.0%, and the yield of 50° sorghum Xiaoqu liquor reaches more than 66.0%. Xiaoqu liquor can be used as a base liquor for blending liquor. The production of composite Xiaoqu only cultivates one kind of Rhizopus and one kind of yeast, and the process flow is relatively simple, with good economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 Shown is the appearance morphology of the American Rhizopus X2 strain on the PDA plate in Example 1.

[0057] Figure 2 Shown is a microscope image of the American Rhizopus X2 strain in Example 1 (microscope model: Olympus optical microscope CX23, magnification 100 times).

[0058] Strain deposit information

[0059] The American root mold (Rhizopus americanus) X2 strain provided by the present invention was deposited in the China Center for Type Culture Collection (CCTCC) on September 25, 2023, with a deposit number of CCTCC NO: M 20231795, and a deposit address: Wuhan University, Wuhan, China, Postal Code: 430072; Telephone: 027-68754052. DETAILED DESCRIPTION

[0060] The present invention is further described below in conjunction with specific embodiments, but the present invention is not limited to these specific embodiments.

[0061] The invention discloses a Rhizopus americanus X2 strain. The strain is deposited in China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: M20231795.

[0062] The invention expands and cultures a preserved strain of American Rhizopus X2 into a bran Rhizopus tertiary strain, inoculates the bran Rhizopus tertiary strain into a solid culture medium mainly containing bran, rice bran, rice flour and the like and a nutrient solution for culture, obtains pure bran Rhizopus through drying and crushing, adds a proper proportion of bran high-temperature-resistant brewer's yeast, and mixes them evenly to obtain a composite Xiaoqu.

[0063] The preparation method of the bran root mold third-grade species comprises: quickly placing an ampoule bottle cryopreservation tube of the American root mold X2 strain in a 40°C water bath, gently shaking until completely melted, transferring to a PDA plate in a sterile operating table, culturing at 30-35°C for 20-30h, cutting a single hyphae and transferring it to a 10-14BX malt juice agar slant (malt juice is added with water to adjust the sugar content to 10-14BX, and 2% agar is added), culturing at 30-35°C for 1-2 days, and obtaining the root mold A ring of the first-level seed is picked, transferred to a bran triangular bottle sterilized at 110-120° C. for 0.5-1h, and cultured at 30-35° C. for 2-3 days to obtain a second-level seed of bran Rhizopus, which is put into a sterile inoculator at 0.5-1wt% of the bran weight after being dried at 35-45%, and blown into a shallow bran dish in an automatic koji seeding machine, and aseptically cultured at 30-40° C. for 2-3 days and then automatically dried at 40-43° C. to obtain a third-level seed of bran Rhizopus.

[0064] The method for preparing pure bran Rhizopus comprises inoculating a third-grade species of bran Rhizopus into a fermentation medium for fermentation to obtain pure bran Rhizopus, wherein the fermentation medium comprises raw materials and a nutrient solution, and the material-liquid ratio (g raw materials / L nutrient solution) is 1:(0.75-0.85). According to the weight percentage of the raw materials, 70-90% of raw bran, 5-15% of rice bran and 5-15% of rice flour are mixed uniformly, and a nutrient solution with a pH of 2.5-3.5 is added. According to the volume ratio of each component mass in the nutrient solution (g nutrient solution of each component / L nutrient solution), the nutrient solution comprises 0.2-1% of ammonium sulfate, 0.2-1% of yeast autolyzed powder and 0.5-2% of sucrose. The nutrient solution and the raw materials are mixed well and then enter into a rotary steaming ball, sterilized at 110-120° C. for 0.5-1h, and the steam is exhausted and discharged. The material enters an air cooler and is cooled to 38±2° C., and three-level bran root mold species are accessed through an inoculator. According to the weight of the fermentation medium, the access amount of the three-level bran root mold species is 0.5-1wt%. After mixing well, the material is sent to an automatic disc koji making machine, and the material temperature is automatically controlled at 25-40° C., and the air volume is automatically controlled at 200-700m 3 / hm 2 If the material cake temperature is too high, it will automatically turn over, keep moist for the first 24 hours, gradually drain moisture in the later period, start drying at 37-42℃ after 2 days until the moisture content is ≤10wt%, and then coarsely crushed by a grinder.

[0065] The preparation method of the bran heat-resistant active dry yeast for brewing comprises the following steps: inoculating the sterilized bran with the heat-resistant active dry yeast at an inoculation amount of 0.5-1.5% according to the weight of the bran, adding 3-5% of yeast autolyzed powder and 0.2-0.4% of 110,000-130,000 u / g saccharifying enzyme, mixing well and feeding into an automatic disc koji making machine, culturing at 30-37°C for 1-2 days, drying at 43-45°C to a moisture content of less than 10wt%, and coarsely crushing with a pulverizer.

[0066] Pure root mold of bran and high temperature resistant active dry yeast of bran are mixed and homogenized according to weight parts to obtain composite Xiaoqu.

[0067] The obtained composite Xiaoqu is used to produce Xiaoqu liquor. The Rhizopus enzyme system in the composite Xiaoqu is rich and balanced, has high alcohol tolerance, and is reasonably matched with yeast. The obtained Xiaoqu liquor has a high yield, low ester content, low fusel oil content, and clean liquor body, and is suitable as a base liquor.

[0068] Fusel oil refers to a mixture of fatty alcohols with more than 2 carbon atoms. It is a monovalent alcohol with more than three carbon chains. It is the main by-product of ethanol production through fermentation of cereal crops, and it forms the aroma and flavor of Xiaoqu liquor.

[0069] Unless otherwise specified, the various reagents and instruments used in the examples and comparative examples of the present invention are conventional commercially available products. The source information of the instruments and reagents used in the examples and comparative examples of the present invention is shown in Table 1 below.

[0070] Table 1

[0071]

[0072]

[0073] The formula of the PDA medium used for strain separation in the present invention is as follows: 200g of potato is added with water and boiled for half an hour, filtered and then supplemented with water to obtain 1000ml of extract, 20g of glucose and 20g of agar are added, the pH value is adjusted to natural value, sterilized, and cooled to 45°C.

[0074] The formula (g / L) of the YPD culture medium of the present invention is as follows: 20 g / L of peptone, 20 g / L of glucose and 5 g / L of yeast extract powder, and pH 6.5±0.2.

[0075] Example 1 Isolation and identification of American Rhizopus X2 strain

[0076] 1. Selection of source samples for isolating bacterial species

[0077] 60 samples of koji powder from different batches of culture in different months of Angel's solid-state fermentation koji workshop were inoculated with glutinous rice at an inoculation rate of 0.4wt% of glutinous rice, cultured at 32°C for 24h, and the reducing sugar content was detected according to "6.3 sugar content in sweet wine koji in QB / T4577-2013", and then the glutinous rice weight was supplemented with water twice at 33°C for 7 days, and the fermentation alcohol content was detected according to "Q / AQJM 2286S-2021 Appendix A fermentation alcohol content of root mold wine koji". Samples with a fermentation alcohol content (%VOL) ≥12.5%VOL were selected as the source samples of the isolated strains, and a total of 12 samples were selected, of which 3 samples had a sugar content (g / 100g) greater than or equal to 30, and 9 samples had a sugar content between 23 and 30.

[0078] 2. Isolation and purification of bacterial strains

[0079] Take 1g of each of the 12 koji powder samples selected above, add 9ml of normal saline, shake evenly, and dilute step by step to 10 -2 g / ml, 10 -3 g / ml and 10 -4 g / ml, take 0.1ml10 -4g / ml dilution for plate coating, antibiotics were added to the PDA medium, and the concentrations were adjusted to 50u / ml penicillin and 100u / ml streptomycin to prepare PDA plates. After culturing for about 20 hours, the hyphae with typical characteristics of creeping growth of Rhizopus were picked for secondary transfer purification. The Rhizopus strains were initially judged based on the characteristics of cotton-like colonies of typical Rhizopus growth and the absence of septa and sporangia in microscopic examination. The Rhizopus strains with well-developed creeping hyphae, thick hyphae, moderate height of aerial hyphae, fast growth rate and few black spores were selected for further purification and separation, and 12 strains of Rhizopus were obtained.

[0080] 3. Target strain selection

[0081] 12 purified Rhizopus strains were selected and inoculated into sterile bran with a water content of about 50%, and cultured at 30°C for 3 days. When cakes were formed during the culture, they were shaken and broken up once a day, and then dried at 43°C to obtain 12 dried samples with a water content of less than 10wt%. The 12 dried samples were inoculated into glutinous rice at an inoculation rate of 0.4wt% of glutinous rice, and cultured at a temperature of 32°C for 46h. Glucose, fructose, maltose monohydrate, lactic acid, acetic acid, and ethanol in the glutinous rice were detected by high performance liquid chromatography, and the Rhizopus strains corresponding to the samples with high ethanol content, high polysaccharide content of sugar-producing species, high lactic acid production and low acetic acid production were selected to obtain the target strain.

[0082] High performance liquid chromatography: take the sample supernatant through a 0.22 μm aqueous phase filter membrane and detect it using the external standard method. Chromatographic column: BIO-RAD Aminex HPX-87H (300mm×7.8mm) (with a guard column); mobile phase: 0.005mol / L sulfuric acid solution; flow rate: 0.6ml / min; column temperature 65°C; detector temperature: 40°C; injection volume: 20μL. The standard series solutions are measured on the machine in turn, the peak area is recorded, and the standard curve is drawn with the concentration as the horizontal coordinate and the peak area as the vertical coordinate. Under the same chromatographic conditions, 12 samples that have passed through a 0.22 μm aqueous phase filter membrane are injected into the chromatograph respectively, and the retention time and peak area of ​​each chromatographic peak are recorded. The retention time of each standard sample chromatographic peak is used for qualitative analysis, and the peak area of ​​the chromatographic peak is used for quantitative analysis. According to the standard curve, the content of each component in the 12 samples is calculated respectively. The results are shown in Table 2, and the strain corresponding to sample 2 is obtained, the sugar-producing species has a high polysaccharide degree, the lactic acid is high and the acetic acid is low, that is, the target strain of the present invention.

[0083] Table 2 Liquid phase test data of 12 samples (unit: mg / 100g)

[0084]

[0085] 4. Target strain identification

[0086] Observe the target strain on a PDA plate. The colonies are round or oval. They gradually grow larger as the creeping hyphae spread. As the number of aerial hyphae increases, they become white cotton-like. Figure 1 Microscopic observation of the target strain showed that the hyphae had no septa, branches and rhizodiac, the sporangium stalks were clustered and upright, unbranched, and the top was swollen to form a round sporangium. The remaining spore receptacle and spore axis could be seen in the ruptured sporangium, as shown in Figure 1. Figure 2 As shown, it was judged to be a Rhizopus strain.

[0087] The Rhizopus strain was molecularly identified: DNA was extracted using a DNA extraction kit. Amplification was performed using universal primers for fungal ITS, primer ITS1: 5'-TCCGTAGGTGAACCTGCGG-3' (SEQ ID NO: 2), primer ITS4: 5'-TCCTCCGCTTATTGATATGC-3' (SEQ ID NO: 3), and the amplified product was analyzed by agarose gel electrophoresis. The PCR product band was consistent with the target band size, single, and without dragging. After the PCR product was tested, the target band was cut for purification and recovery, and the recovered product was subjected to Sanger sequencing. The sequencing results were compared in the NCBI database, thereby identifying it as a Rhizopus strain, which was named Rhizopus americanus X2 strain, and the 26S rDNA gene sequence was as follows (SEQ ID NO.1):

[0088] ATGCTTAAGTTCAGCGGGTAATCCCACCTGACTTCAGATCATAGTTTG

[0089] AAAGTTGCTGGATTATACTCTTGTACTTTACTTCCTGGGCGAACCAAA

[0090] GAAAAAGATCCTGAGACCAGCGTAATATTCCTGCCTAGCAAGCCAGA

[0091] CAGAAAATCACACACATTTTAGGTGCTCACTGTAATAAAACAGCGATG

[0092] CGACCCATTACCACATAAACAAATGTTATGTGTGGGTTTGTGATGATA

[0093] CTGAAGCAGGCGTACTCTATAGAAAAACCATAGAGTGCAAGCTGCGTT

[0094] CAAAGACTCGATGATTCACTGAATATGCAATTCACACTAGTTATCGCA

[0095] CTTTGCTACGTTTCTTCATCGATGCGAGAACCAAGAGATCCATTGTTAA

[0096] AAGTTGTTTTTTATTAAACTTTATAATACTGAATTTCTAGGTTTATTAT

[0097] GAAGGGTGCTCCTGAAACCAGGAGTGGCATCGATCAAACCCCAGATA

[0098] GGTCTACCCATGACCAGTCTGAGTCTCTCAGCCAAATTTTCACAGTGT

[0099] AGAAGCAATCACTTACCCCAGAGGAAACCCTAAGGTAAGGCGCTTTAACATAATTAATGATCCTTCCGCA.

[0100] Example 2 Alcohol resistance test of American Rhizopus X2 strain

[0101] The American root mold X2 strain and the control strain Q303 were used to make eggplant bottle seeds. Liquid culture medium (g / 100ml) was prepared: 8 sucrose, 0.5 ammonium sulfate, 1 yeast peptone, 0.1 magnesium sulfate, 0.1 potassium dihydrogen phosphate, sterilized and aseptically packaged, and alcohol with a volume concentration of 6%, 8%, 10%, and 12% was added respectively, and 1 ring of American root mold X2 strain and strain Q303 eggplant bottle spores were respectively inoculated, and cultured at 32°C and 150rpm for 3 days. After suction filtration and washing, the dry weight was measured for comparison. The results are shown in Table 3. From the dry weight of the American root mold X2 and Q303 in Table 3, it can be seen that the American root mold X2 strain can still grow in a volume concentration of 10% alcohol, and has a high alcohol tolerance.

[0102] Table 3 Dry weight of bacteria at different alcohol concentrations (g / L)

[0103]

[0104] Example 3 Determination of extracellular saccharifying enzyme activity of American Rhizopus X2 strain

[0105] The ampoules of the American Rhizopus X2 strain and the control strain Q303 were quickly placed in a 40°C water bath, gently shaken until completely melted, transferred to a PDA plate in a sterile operating table, cultured at 30°C for 24h, and a single mycelium was cut and transferred to a 12BX malt agar slant, cultured at 30°C for 2 days, transferred to a bran triangular bottle sterilized at 120°C for 1h, cultured at 30°C for 2-3 days, and then transferred to a sterile kraft paper bag in a clean bench, dried at 38°C in a blast drying oven for 12h, and then increased to 41°C for about 12h to achieve a moisture content of less than 7wt%. The saccharifying enzyme activity, α-amylase enzyme activity and debranching enzyme activity of the American Rhizopus X2 strain and the control strain Q303 were determined, and the results are shown in Table 4. The saccharifying enzyme activity was tested according to the industry standard QB / T4257-2011 "General Analysis Method for Brewing Daqu", the α-amylase activity was tested according to the national standard GB / T 24401-2009 "α-amylase preparation", and the debranching enzyme activity was tested according to the pullulanase determination method in the national standard GB / T35538-2017 "Technical Guidelines for the Determination of Industrial Enzyme Preparations", and pullulanase is a type of debranching enzyme. As can be seen from Table 4, the saccharifying enzyme activity of the American Rhizopus X2 strain is lower than that of the Q303 strain, so the American Rhizopus X2 strain will not cause premature yeast aging due to excessive initial glucose concentration during brewing, and the American Rhizopus X2 strain has a relatively high debranching enzyme, which can reduce the residual β-limit dextrin during brewing and improve starch utilization.

[0106] Table 4

[0107]

[0108]

[0109] Example 4 Preparation of composite Xiaoqu

[0110] Example 4-1

[0111] 1. Production of pure Rhizopus bran

[0112] (1) Preparation of the third-grade strain of Rhizopus bran

[0113] The ampoule cryopreservation tube of the American Rhizopus X2 strain was quickly placed in a 40°C water bath, gently shaken until completely melted, transferred to a PDA flat plate in a sterile operating table, cultured at 30°C for 24h, intercepted a single mycelium and transferred to a 12BX malt extract agar slant, and cultured at 30°C for 2 days to obtain a first-class species of Rhizopus. A ring of the first-class species of Rhizopus was picked and transferred to a bran triangular flask sterilized at 120°C for 1h, and cultured at 30°C for 2 days to obtain a second-class species of Rhizopus bran. After the second-class species of Rhizopus bran was dried at 40%, it was placed in a sterile inoculator according to 1wt% of the bran weight, blown into a shallow dish of bran in an automatic seeding machine, and after 35°C aseptic culture for 2 days, it was dried at 40°C to a moisture content of ≤wt 10%, to obtain a third-class species of Rhizopus bran.

[0114] (2) Preparation of pure Rhizopus from bran

[0115] 800kg of raw bran, 100kg of rice bran and 100kg of rice flour are mixed evenly, and 800L of PH3 nutrient solution is added. According to the mass ratio of each component in the nutrient solution to the volume of the nutrient solution (g of each component in the nutrient solution / L of the nutrient solution), the nutrient solution includes 0.5% of ammonium sulfate, 0.5% of yeast autolyzed powder and 1% sucrose to obtain a fermentation medium. After the fermentation medium is mixed well, it enters the rotary steaming ball and is sterilized at 120℃ for 0.5h. The steam is exhausted and the material is discharged. The material enters the air cooler and is cooled to 38℃. The bran Rhizopus tertiary species is connected through the inoculator. The inoculation amount is 0.5wt% of the fermentation medium. After mixing well, it is sent to the automatic disc koji making machine. The material temperature is automatically controlled at 30℃, and the air volume is automatically controlled at 500m 3 / hm 2 If the cake temperature of the material is too high, it will automatically turn over. Keep it moist for the first 24 hours, drain it gradually in the later period, and start drying at 40℃ after 2 days until the moisture content is ≤10wt%, and then crush it coarsely with a grinder.

[0116] 2. Preparation of heat-resistant active dry yeast from bran

[0117] According to the weight percentage of bran, high-temperature resistant brewing active dry yeast is added to 1000g of sterilized bran at an inoculation rate of 1%, and yeast autolytic powder accounting for 4% of the weight of the bran and 0.3% of 110,000-130,000 u / g saccharifying enzyme are added at the same time. After mixing well, it is sent to an automatic disc koji making machine, cultured at 35°C for 1 day, and then dried at 44°C to a moisture content of ≤10wt%, and coarsely crushed by a grinder.

[0118] 3. Mix pure bran Rhizopus and bran heat-resistant active dry yeast to obtain composite Xiaoqu

[0119] 850 kg of pure Rhizopus from bran is first put into a mixer, and then 150 kg of high temperature resistant active dry yeast from bran is put into the mixer, and the mixture is mixed for 15 minutes. The mixture is discharged, filled, weighed and sealed to obtain a composite Xiaoqu.

[0120] Example 4-2

[0121] 1. Production of pure Rhizopus bran

[0122] (1) Preparation of the third-grade strain of Rhizopus bran

[0123] The ampoule cryopreservation tube of the American Rhizopus X2 strain was quickly placed in a 40°C water bath, gently shaken until completely melted, transferred to a PDA flat plate in a sterile operating table, cultured at 30°C for 24h, intercepted a single mycelium and transferred to a 10BX malt extract agar slant, and cultured at 30°C for 2 days to obtain a first-class species of Rhizopus. A ring of the first-class species of Rhizopus was picked and transferred to a bran triangular flask sterilized at 120°C for 1h, and cultured at 30°C for 2 days to obtain a second-class species of Rhizopus bran. After the second-class species of Rhizopus bran was dried at 45%, it was placed in a sterile inoculator according to 0.5wt% of the bran weight, blown into a shallow dish bran in an automatic seeding machine, and after 30°C aseptic culture for 2 days, it was dried at 40°C to a moisture content of ≤wt 10%, to obtain a third-class species of Rhizopus bran.

[0124] (2) Preparation of pure Rhizopus from bran

[0125] Mix 700kg of bran, 150kg of rice bran and 150kg of rice flour evenly, add 750L of nutrient solution with pH 2.5, and obtain a fermentation medium according to the mass ratio of each component in the nutrient solution to the volume of the nutrient solution (g of each component in the nutrient solution / L of the nutrient solution). The nutrient solution includes 0.2% of ammonium sulfate, 0.2% of yeast autolyzed powder and 0.5% of sucrose. After the fermentation medium is mixed well, it enters the rotary steaming ball and is sterilized at 120℃ for 0.5h. The steam is exhausted and the material is discharged. The material enters the air cooler and is cooled to 38℃. The third-grade bran Rhizopus is inoculated through the inoculator. The inoculation amount is 1wt% of the raw material. After mixing well, it is sent to the automatic disc koji making machine. The material temperature is automatically controlled at 25℃, and the air volume is automatically controlled at 200m 3 / hm 2 If the cake temperature of the material is too high, it will automatically turn over. Keep it moist for the first 24 hours, drain it gradually in the later period, and start drying at 37°C after 2 days until the moisture content is ≤10wt%, and then crush it coarsely with a grinder.

[0126] 2. Preparation of heat-resistant active dry yeast from bran

[0127] According to the weight percentage of bran, high-temperature resistant brewing active dry yeast is added to 1000g of sterilized bran at an inoculation rate of 0.5%, and yeast autolytic powder accounting for 3% of the weight of the bran and 0.2% of 110,000-130,000 u / g saccharifying enzyme are added at the same time. After mixing well, it is sent to an automatic disc koji making machine, cultured at 30°C for 1 day, and then dried at 40°C to a moisture content of ≤10wt%, and coarsely crushed by a grinder.

[0128] 3. The composite Xiaoqu is obtained by mixing pure Rhizopus from bran with high temperature resistant active dry yeast from bran.

[0129] 900 kg of pure Rhizopus from bran is first put into a mixer, and then 100 kg of high temperature resistant active dry yeast from bran is put into the mixer, and the mixture is mixed for 15 minutes. The mixture is discharged, filled, weighed and sealed to obtain a composite Xiaoqu.

[0130] Example 4-3

[0131] 1. Production of pure Rhizopus bran

[0132] (1) Preparation of the third-grade strain of Rhizopus bran

[0133] The ampoule cryopreservation tube of the American Rhizopus X2 strain was quickly placed in a 40°C water bath, gently shaken until completely melted, transferred to a PDA flat plate in a sterile operating table, cultured at 30°C for 24h, intercepted a single mycelium and transferred to a 14BX malt extract agar slant, and cultured at 35°C for 2 days to obtain a first-class species of Rhizopus. A ring of the first-class species of Rhizopus was picked and transferred to a bran triangular flask sterilized at 120°C for 1h, and cultured at 35°C for 3 days to obtain a second-class species of Rhizopus bran. After the second-class species of Rhizopus bran was dried at 45%, it was placed in a sterile inoculator according to 1wt% of the bran weight, blown into a shallow dish of bran in an automatic seeding machine, and after 40°C aseptic culture for 3 days, it was dried at 40°C to a moisture content of ≤wt 10%, to obtain a third-class species of Rhizopus bran.

[0134] (2) Preparation of pure Rhizopus from bran

[0135] 900kg of raw bran, 50kg of rice bran and 50kg of rice flour are mixed evenly, and 850L of tap water nutrient solution with a pH of 3.5 is added. According to the mass ratio of each component in the nutrient solution to the volume of the nutrient solution (g of each component in the nutrient solution / L of the nutrient solution), the nutrient solution includes 1% of ammonium sulfate, 1% of yeast autolyzed powder and 2% of sucrose to obtain a fermentation medium. After all are mixed well, they enter the rotary steaming ball and are sterilized at 120°C for 0.5h. The steam is exhausted and the material is discharged. The material enters the air cooler and is cooled to 38°C. The third-level bran Rhizopus is inoculated through the inoculator. The inoculation amount is 1wt% of the raw material. After mixing well, it is sent to the automatic disc koji making machine. The material temperature is automatically controlled at 40°C, and the air volume is automatically controlled at 700m 3 / hm 2 If the cake temperature of the material is too high, it will automatically turn over. Keep it moist for the first 24 hours, drain it gradually in the later period, and start drying at 42°C after 2 days until the moisture content is ≤10wt%, and then crush it coarsely with a grinder.

[0136] 2. Preparation of heat-resistant active dry yeast from bran

[0137] According to the weight percentage of bran, high-temperature resistant brewing active dry yeast is added to 1000g of sterilized bran at an inoculation rate of 1.5%, and yeast autolytic powder accounting for 5% of the weight of the bran and 0.4% of 110,000-130,000 u / g saccharifying enzyme are added at the same time. After mixing well, it is sent to an automatic disc koji making machine, cultured at 37°C for 2 days, and then dried at 45°C to a moisture content of ≤10wt%, and coarsely crushed by a grinder.

[0138] 3. Mix pure bran Rhizopus and bran heat-resistant active dry yeast to obtain composite Xiaoqu

[0139] 800 kg of pure bran Rhizopus was first put into the mixer, and then 200 kg of high temperature resistant active dry yeast for brewing bran was put into the mixer, and the mixture was mixed for 15 minutes. The material was discharged, filled, weighed and sealed to obtain the composite Xiaoqu.

[0140] Example 4-4

[0141] 1. Production of pure Rhizopus bran

[0142] At the same time, Example 1

[0143] 2. Preparation of heat-resistant active dry yeast from bran

[0144] At the same time, Example 1

[0145] 3. Mix pure bran Rhizopus and bran heat-resistant active dry yeast to obtain composite Xiaoqu

[0146] 600 kg of pure bran Rhizopus was first put into the mixer, and then 400 kg of high temperature resistant active dry yeast for brewing bran was put into the mixer, and the mixture was mixed for 15 minutes. The material was discharged, filled, weighed and sealed to obtain the composite Xiaoqu.

[0147] Embodiment 4-5

[0148] 1. Production of pure Rhizopus bran

[0149] At the same time, Example 1

[0150] 2. Preparation of heat-resistant active dry yeast from bran

[0151] At the same time, Example 1

[0152] 3. Mix pure bran Rhizopus and bran heat-resistant active dry yeast to obtain composite Xiaoqu

[0153] 950 kg of pure Rhizopus from bran is first put into a mixer, and then 50 kg of high temperature resistant active dry yeast from bran is put into the mixer, and the mixture is mixed for 15 minutes. The mixture is discharged, filled, weighed and sealed to obtain a composite Xiaoqu.

[0154] Comparative Example 1

[0155] The thermostable active dry yeast for brewing in Example 4-1 was replaced with active dry yeast for brewing to prepare the composite Xiaoqu, and the remaining steps were the same as those in Example 4-1.

[0156] Comparative Example 2

[0157] The American Rhizopus X2 strain in Example 4-1 was replaced with strain Q303 to prepare the composite Xiaoqu, and the remaining steps were the same as in Example 4-1.

[0158] Application Example 1: Compound Xiaoqu is used in rice Xiaoqu liquor

[0159] 100 kg of rice was soaked, steamed, poured, steamed again, and cooled, and then 1 kg of the compound Xiaoqu in Examples 4-1 to 4-5 and Comparative Example 1-2 was added, and commercially available Angel Xiaoqu and Sichuan Xiaoqu were used as controls. After mixing well, the rice was put into a rice jar, and a hole was dug in the middle. The thickness of the rice was controlled to be about 15 cm, and it was appropriately thickened in winter. The bacteria were cultured for 24 hours, and 120 kg of warm water or cold water was added depending on the temperature. The fermented lees fermented for 8 days at about 20°C were used to steam the wine. The fermented alcohol content (%) and wine quality were tested, and the results are shown in Table 4. The sensory evaluation and 50° wine yield (%) were also measured, and the results are shown in Table 5.

[0160] Fermentation alcohol content (%) refers to the volume percentage of ethanol in 100 ml of fermented mash. The fermentation alcohol content is measured by using a measuring cylinder to measure 100 ml of the stirred mash for distillation, and the volume percentage of ethanol is detected using an Anton Paar portable density meter. The 50° wine yield (%) refers to the percentage of the total weight of 50° liquor that can be produced from 100 kg of rice to the weight of 100 kg of rice. The quality of the wine is evaluated by detecting the content of isopentanol, β-phenylethanol, ethyl acetate, ethyl lactate, total acid, and total ester. The detection method refers to GB / T10345-2022 "Analysis Method for Liquor". The sensory evaluation method of rice Xiaoqu liquor refers to the sensory requirements in GBT10781.3-2006 "Rice-flavored Liquor".

[0161] Fusel oil refers to a mixture of fatty alcohols with a carbon number greater than 2, a monovalent alcohol with more than three carbon chains, and is the main byproduct of ethanol produced by fermentation of cereal crops, forming the aroma and flavor of Xiaoqu liquor. As can be seen from Tables 5 and 6, the rice Xiaoqu liquor obtained by fermentation of compound Xiaoqu in Examples 4-1 to 4-5 and Comparative Example 1 has a lower content of fusel oil than the rice Xiaoqu liquor obtained by fermentation of compound Xiaoqu, Angel Xiaoqu and Sichuan Xiaoqu in Comparative Example 2. Among them, isopentanol decreased by up to 50%, ethyl acetate decreased by up to 30%, and ethyl lactate decreased by up to 25%, ensuring the purity of the wine body, which can better meet the new national standard of liquor to replace edible alcohol, and is used as the urgent demand of the industry for the base liquor of liquor blending. In addition, the wine yield of rice Xiaoqu liquor in Examples 4-1 to 4-5 and Comparative Example 1 is high, and the wine yield of 50° wine reaches more than 74.0%, which has good economic value.

[0162] Table 5 Quality and fermentation alcohol content of rice wine

[0163]

[0164] Table 6 Yield of rice wine and sensory evaluation of wine quality

[0165]

[0166] Application Example 2: Compound Xiaoqu is used in sorghum Xiaoqu liquor

[0167] 500 kg of sorghum was soaked, steamed, steamed, cooled, and then 1.5 kg of the compound Xiaoqu in Examples 4-1 to 4-5 and Comparative Example 1-2 was added, and commercially available Angel Xiaoqu and Sichuan Xiaoqu were used as controls. The thickness of the rice was controlled to be about 15 cm, and it was appropriately thickened in winter. The bacteria were cultured for 24 hours, the temperature in the pool was 25-26°C, the top temperature was controlled below 42°C, and fermented for 8 days. The wine was distilled and the wine quality was tested. The results are shown in Table 6. The sensory evaluation and 50° wine yield (%) of the distilled wine were carried out, and the results are shown in Table 7.

[0168] The 50° liquor yield (%) refers to the percentage of the total weight of 50° liquor that can be produced from 500kg of sorghum to the weight of 500kg of sorghum. The liquor quality is evaluated by testing the content of acetaldehyde, n-propanol, isobutanol, isopentanol, β-phenylethanol, ethyl acetate, ethyl lactate, total acid, and total ester. The testing method refers to GB / T 10345-2022 "Analysis Method for Liquor". The sensory evaluation method of sorghum Xiaoqu liquor refers to the sensory requirements in GBT 10781.3-2006 "Rice-flavored Liquor".

[0169] Fusel oil refers to a mixture of fatty alcohols with a carbon number greater than 2, a monovalent alcohol with more than three carbon chains, and is the main byproduct of ethanol produced by fermentation of cereal crops, forming the aroma and flavor of Xiaoqu liquor. As can be seen from Tables 6 and 7, the sorghum Xiaoqu liquor obtained by fermentation of compound Xiaoqu in Examples 4-1 to 4-5 and Comparative Example 1 is lower than the sorghum Xiaoqu liquor obtained by fermentation of compound Xiaoqu, Angel Xiaoqu and Sichuan Xiaoqu in Comparative Example 2. Among them, isopentanol decreases by an average of about 50%, ethyl acetate decreases by an average of 30%, and ethyl lactate decreases by an average of 25%, ensuring the purity of the wine body, which can better meet the urgent needs of the industry for replacing edible alcohol with the new national standard of liquor and using it as a base liquor for liquor blending. In addition, the sorghum Xiaoqu liquor in Examples 4-1 to 4-5 and Comparative Example 1 has a high wine yield, and the 50° wine yield reaches more than 66.0%, which has good economic value.

[0170] Table 7 Quality of Gaoliang Xiaoqu Liquor

[0171]

[0172] Table 8 Sorghum Xiaoqu liquor yield and sensory evaluation of liquor quality

[0173]

[0174]

[0175] The above description is only a preferred embodiment adopted by the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. A Rhizopus americanus X2 strain, characterized in that The strain is deposited in China Center for Type Culture Collection (CCTCC) with the deposit number being CCTCC NO:M20231795.

2. The American Rhizopus X2 strain according to claim 1, characterized in that The gene sequence of 26S rDNA of the strain is shown in SEQ ID NO:

1.

3. A composite ditty, characterized in that: The composite Xiaoqu contains the American Rhizopus X2 strain described in claim 1 or 2.

4. The composite ditty according to claim 3, characterized in that: The composite Xiaoqu comprises 6-9.5 parts of pure bran Rhizopus and 0.5-4 parts of bran high temperature resistant brewing active dry yeast by weight; The pure Rhizopus of the bran is prepared by the American Rhizopus X2 strain, and the high-temperature-resistant active dry yeast for brewing of the bran is prepared by the high-temperature-resistant active dry yeast for brewing of the bran.

5. The composite ditty according to claim 4, characterized in that: The composite Xiaoqu comprises 8.0-9.0 parts of pure bran root mold and 1.0-2.0 parts of bran high temperature resistant active dry yeast for brewing wine by weight.

6. A method for preparing the composite Xiaoqu according to any one of claims 3 to 5, characterized in that: The preparation method comprises the following steps: S1, prepare the American Rhizopus X2 strain into pure bran Rhizopus; S2, preparing the heat-resistant active dry yeast for brewing into bran heat-resistant active dry yeast for brewing; S3, mixing the pure Rhizopus from bran and the heat-resistant active dry yeast from bran.

7. The method for preparing the composite Xiaoqu according to claim 6, characterized in that: Step S1 includes the following steps: S11, the American Rhizopus X2 strain is gradually expanded and cultured into Rhizopus first-class species, Rhizopus bran second-class species and Rhizopus bran third-class species; S12, inoculating the third-grade strain of Rhizopus oleraceus into a fermentation medium to ferment and obtain pure Rhizopus oleraceus.

8. The method for preparing the composite Xiaoqu according to claim 7, characterized in that: In step S12, the fermentation medium includes raw materials and nutrient solution, and the material-liquid ratio (g raw materials / L nutrient solution) is 1: (0.75-0.85).

9. The method for preparing the composite Xiaoqu according to claim 8, characterized in that: In step S12, the raw materials include 70-90% bran, 5-15% rice bran and 5-15% rice flour according to the weight percentage of the raw materials.

10. The method for preparing the composite Xiaoqu according to claim 8, characterized in that: In step S12, according to the mass ratio of each component in the nutrient solution to the volume of the nutrient solution (g of each component in the nutrient solution / L of the nutrient solution), the nutrient solution includes 0.2-1% ammonium sulfate, 0.2-1% yeast autolyzed powder and 0.5-2% sucrose; And / or, the pH value of the nutrient solution is 2.5-3.

5.

11. The method for preparing the composite Xiaoqu according to claim 9, characterized in that: In step S12, according to the mass ratio of each component in the nutrient solution to the volume of the nutrient solution (g of each component in the nutrient solution / L of the nutrient solution), the nutrient solution includes 0.2-1% ammonium sulfate, 0.2-1% yeast autolyzed powder and 0.5-2% sucrose; And / or, the pH value of the nutrient solution is 2.5-3.

5.

12. The method for preparing the composite Xiaoqu according to claim 7, characterized in that: In step S12, the fermentation temperature is 25-40°C; And / or, fermentation air volume is controlled at 200-700m 3 / hm 2 .

13. The method for preparing the composite Xiaoqu according to claim 8, characterized in that: In step S12, the fermentation temperature is 25-40°C; And / or, fermentation air volume is controlled at 200-700m 3 / hm 2 .

14. The method for preparing the composite Xiaoqu according to claim 9, characterized in that: In step S12, the fermentation temperature is 25-40°C; And / or, fermentation air volume is controlled at 200-700m 3 / hm 2 .

15. The method for preparing the composite Xiaoqu according to claim 10, characterized in that: In step S12, the fermentation temperature is 25-40°C; And / or, fermentation air volume is controlled at 200-700m 3 / hm 2 .

16. The method for preparing the composite Xiaoqu according to claim 7, characterized in that: The step S12 further includes a drying step.

17. The method for preparing the composite Xiaoqu according to claim 16, characterized in that: The drying temperature is 37-42° C.; and / or, drying is performed until the moisture content of the pure Rhizopus bran is ≤10wt%.

18. The method for preparing the composite Xiaoqu according to claim 16, characterized in that: After drying, it is roughly chopped.

19. The method for preparing the composite Xiaoqu according to claim 17, characterized in that: After drying, it is roughly chopped.

20. The method for preparing the composite Xiaoqu according to any one of claims 6 to 19, characterized in that: Step S2 includes inoculating the heat-resistant active dry yeast into the bran, and adding yeast autolyzed powder and saccharifying enzyme for culturing.

21. The method for preparing the composite Xiaoqu according to claim 20, characterized in that: In step S2, the inoculation amount of the thermostable active dry yeast for brewing is 0.5-1.5% based on the weight percentage of the bran; and / or, the amount of yeast autolyzed powder added is 3-5%; And / or, the added amount of saccharifying enzyme is 0.2-0.4%.

22. The method for preparing the composite Xiaoqu according to claim 21, characterized in that: In step S2, the enzymatic activity of the saccharifying enzyme is 110,000-130,000 u / g.

23. The method for preparing the composite Xiaoqu according to claim 22, characterized in that: In step S2, the inoculation amount of the thermostable active dry yeast for brewing is 1-1.2% based on the weight percentage of the bran; and / or, the amount of yeast autolyzed powder added is 3.5-4.5%; And / or, the added amount of saccharifying enzyme is 0.25-0.35%.

24. The method for preparing the composite Xiaoqu according to claim 20, characterized in that: The step S2 also includes a drying step after the culturing.

25. The method for preparing the composite Xiaoqu according to claim 24, characterized in that: The drying temperature in step S2 is 40-45°C; And / or, drying the bran until the moisture content of the heat-resistant active dry yeast is ≤10wt%.

26. The method for preparing the composite Xiaoqu according to claim 24, characterized in that: After drying, it is roughly chopped.

27. The method for preparing the composite Xiaoqu according to claim 25, characterized in that: After drying, it is roughly chopped.

28. A composite Xiaoqu prepared by the method for preparing the composite Xiaoqu according to any one of claims 6 to 27.

29. A Xiaoqu liquor, characterized in that: The Xiaoqu liquor is brewed by the composite Xiaoqu described in any one of claims 3-5 or 28.

30. A method for brewing Xiaoqu liquor, characterized in that: The method comprises: inoculating the composite Xiaoqu described in any one of claims 3-5 or 28 into a starchy raw material for brewing wine, wherein the starchy raw material is selected from one or more of sorghum, corn, rice, millet, barley, wheat or corn.

31. The method according to claim 30, characterized in that The inoculation amount of the composite Xiaoqu is 3-10‰ based on the weight of the starchy raw material.

32. The method according to claim 30, characterized in that Based on the weight of the starchy raw material, the inoculation amount of the composite Xiaoqu is 5-8‰.

33. Use of the American Rhizopus X2 strain according to claim 1 or 2 in preparing composite Xiaoqu.

34. Use of the composite Xiaoqu according to any one of claims 3 to 5 or 28 in the production of Xiaoqu liquor.

Images