Bacillus subtilis strain, fermentation method and application thereof

Abstract

The present application belongs to the field of microbial technology, and particularly relates to a bacillus subtilis strain, a fermentation method thereof and application. The present application isolates a bacillus subtilis strain with high cellulase yield from medicinal plants Dendrobium, which has been preserved in China General Microbiological Culture Collection Center (CGMCC) on September 19, 2016, and the address is No. 1, Yihuangyuan 3rd, Beichen West Road, Chaoyang District, Beijing, and the preservation number is CGMCC No. 13010. The strain can produce cellulase with high activity, can decompose cellulose in the cell wall of Dendrobium, and promote the dissolution of effective components such as Dendrobium alkaloids. The Dendrobium fermented by the strain can improve the growth performance and immune function of South American white prawn, large yellow croaker and other aquatic animals.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of microbial technology, and particularly relates to a bacillus subtilis strain and a fermentation method and application thereof. BACKGROUND

[0002] Dendrobium plants mainly have prominent effects on stomach and kidney channels, and are recorded in ancient medical classics such as Shennong's Herbal Classic and Chinese Pharmacopoeia, and are regarded as treasures by medical experts in history, and even called as one of the 'Nine Big Magic Herbs' in folk. A large number of modern medical studies show that the active ingredients such as polysaccharides, alkaloids, phenols, phenanthrenes and bibenzyls in Dendrobium have good medicinal effects such as anti-tumor, anti-aging, anti-oxidation, hypoglycemic and immune enhancement. Among them, Dendrobine (C 16 H 25 O2N) is a sesquiterpene alkaloid unique to Dendrobium plants, and is considered as an effective component of Chinese medicine Dendrobium for enhancing immunity.

[0003] Chinese herbal medicine as a feed additive has been recorded in history in China, and its multiple effects in livestock and aquaculture, dual functions of nutrition and medicine are recorded in the famous agricultural technology book 'Qimin Yaoshu'. However, due to the complex active ingredients of Chinese herbal medicine and the characteristics of short intestinal tract and fast excretion of aquatic animals, direct addition of Chinese herbal medicine in aquatic feed will lead to insufficient release of effective components, short absorption time, poor absorption, poor treatment effect and poor palatability, which is easy to cause waste of Chinese herbal medicine resources and pollution of water quality. Fermentation of Chinese herbal medicine by specific microorganisms can promote the release of medicinal ingredients and improve the utilization value of Chinese herbal medicine.

[0004] Plant endophyte is a group of endophytic microorganisms such as bacteria, fungi and actinomycetes existing in the internal organs or tissues of healthy plants, which plays an irreplaceable role in the growth and development cycle of host plants through long-term symbiotic and mutualistic relationship with the host plants. A large number of studies have shown that the secondary metabolites produced by plant endophytes during in vitro culture have the same or similar efficacy activity as the functional substances produced by the host, and the unique secondary active metabolites of medicinal plants are most likely related to the high specificity of the related microbial community. Compared with heterologous microbial fermentation, fermentation of medicinal plants by endophytic microbes can have a synergistic effect. SUMMARY

[0005] The present application provides a Bacillus subtilis capable of producing cellulase in high yield, which has been preserved in the China General Microbiological Culture Collection Center on September 19, 2016, and the address is No. 1, Huayuancun, Beijing, China, and the preservation number is CGMCC No. 13010.

[0006] Further, the 16S rDNA sequence of the Bacillus subtilis is shown in the sequence table SEQ ID No. 1.

[0007] The present application also provides a microecological preparation containing the Bacillus subtilis.

[0008] The present application also provides a feed containing the Bacillus subtilis.

[0009] The present application also provides a fermentation method of the Bacillus subtilis, specifically comprising the following steps:

[0010] The fermentation medium is as follows: 1-4 parts of carbon source, 1-4 parts of nitrogen source, and the rest is trace elements; the fermentation conditions are as follows: pH 5.5-7.5, culture temperature 33-41 DEG C, and culture time 18-24 h.

[0011] Preferably, in the fermentation method, the carbon source is glucose, the nitrogen source is yeast powder, the carbon-nitrogen ratio is 1:2, the fermentation conditions are as follows: pH 7.0, culture temperature 37 DEG C, and culture time 20 h.

[0012] The present application also provides an application of the Bacillus subtilis in fermenting dendrobium candidum, specifically preparing dendrobium alkaline by fermenting dendrobium candidum.

[0013] The present application also provides a fermented dendrobium candidum, which is obtained by fermenting dendrobium candidum stem powder by the Bacillus subtilis.

[0014] The present application also provides an application of the fermented dendrobium candidum in preparing a medicine or feed for promoting the growth and / or immune performance of aquatic animals.

[0015] The present application also provides an application of the Bacillus subtilis in preparing cellulase.

[0016] Compared with the prior art, the present application has the following beneficial effects:

[0017] The application provides a new Dendrobium nobile endophytic Bacillus subtilis strain, which can produce cellulase at a high yield, and after optimization of fermentation medium and fermentation conditions, the cellulase activity can reach 55.73 U / mL. The cellulase produced by the strain can degrade cellulose in the cell wall of Dendrobium nobile, and promote the release of effective components in the cells. The aquatic functional biological feed containing the fermentation product of Dendrobium nobile by the strain can significantly improve the immunity, survival rate and growth performance of Penaeus vannamei and other aquatic animals. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 For endophytic bacteria isolation and purification of Dendrobium nobile, wherein a. fresh stem sample of Dendrobium nobile; b. Dendrobium nobile sample placed on isolation medium (no endophytic colony grown); c. Dendrobium nobile sample placed on isolation medium (endophytic colony grown).

[0019] Figure 2 For primary screening results of cellulase produced by Bacillus subtilis CGMCC No.13010.

[0020] Figure 3 For phylogenetic evolution tree of Bacillus subtilis CGMCC No.13010 based on 16S rDNA sequence.

[0021] Figure 4 For effects of different carbon sources and nitrogen sources on cellulase production of Bacillus subtilis CGMCC No.13010.

[0022] Figure 5 For effects of different carbon-nitrogen ratios on cellulase production of Bacillus subtilis CGMCC No.13010.

[0023] Figure 6 For effects of different initial pH values on cellulase production of Bacillus subtilis CGMCC No.13010.

[0024] Figure 7 For effects of different initial pH values on cellulase production of Bacillus subtilis CGMCC No.13010.

[0025] Figure 8 For effects of different initial pH values on cellulase production of Bacillus subtilis CGMCC No.13010. DETAILED DESCRIPTION

[0026] The present application is further described in connection with the following examples, which are provided by way of illustration only and should not be construed to limit the scope of the present application. The examples provided below serve as a reference for further optimization and improvement by those skilled in the art, and should not be construed to limit the scope of the present application. The content of the present application is not limited to the following examples.

[0027] The test methods in the following examples are all conventional or standard methods, unless otherwise specified, which can be carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained commercially.

[0028] Example 1: Isolation and purification of Dendrobium endophyte

[0029] Dendrobium candidum endophyte single strains were isolated by dilution coating method and sample plate placement method. The specific steps of dilution coating method are as follows: the sample was placed in a mortar, and an appropriate amount of sterile water was added, crushed, and allowed to stand for 10 min. The original solution was aspirated and sequentially diluted to 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , and 100 μL of the liquid was uniformly coated on the LB solid medium, and cultured at 33°C under aerobic conditions until single colonies appeared on the medium. The specific steps of sample plate placement method are as follows: the sample was cut into 0.5-1.0 cm small pieces with sterile surgical scissors after surface sterilization, and placed on the LB solid medium, and cultured at 33°C under aerobic conditions until single colonies appeared inside the sample. Single colonies were picked and streaked for isolation, and after 2-3 times of point inoculation purification, single strains were obtained. As shown in FIG. 1: Figure 1 a. Fresh stem sample of Dendrobium candidum; b. Dendrobium candidum sample placed on isolation medium (no endophyte colonies grew); c. Dendrobium candidum sample placed on isolation medium (endophyte colonies grew).

[0030] Results: After preliminary screening of strain morphology, a total of 64 different morphological characteristics of Dendrobium candidum endophyte strains were obtained, including 54 strains of spore-forming bacteria, 2 strains of actinomycetes, and 8 strains of lactic acid bacteria.

[0031] Example 2: Screening and identification of cellulase-producing strains

[0032] Cellulase-producing strain primary screening: First, cellulase test medium was configured, and its components were as follows: sodium carboxymethyl cellulose 1 g, proteose peptone 1 g, yeast extract 0.5 g, agar 2 g, sea salt 3 g, water 100 mL, pH 8.0, sterilized at 121°C for 15 min. Single colonies were spotted onto enzyme production verification plates, and 37°C inverted culture was observed for 24-48 h. A certain amount of 0.1-0.3% Congo red solution was poured to cover the surface of the plate by about 1 mm, and after 10-60 min of static observation, if the strain produces cellulase, a clear transparent circle appears, and the size of the transparent circle is observed. The colony diameter (d) and the transparent circle diameter (D) were measured, and the D / d value was calculated.

[0033] Cellulase-producing strain secondary screening:

[0034] Preparation of crude enzyme solution. The strains obtained by primary screening were inoculated into LB liquid fermentation medium, and cultured at 37°C and 180 r / min for 24 h. After centrifugation at 6000 r / min for 10 min, the culture medium and bacterial residues were removed, and the supernatant was collected as the crude enzyme solution for cellulase activity determination.

[0035] Preparation of standard curve. 5.0 mL of acetic acid-sodium acetate buffer was mixed with 5.0 mL of 3,5-dinitrosalicylic acid (DNS reagent), and boiled in water for 5 min. The mixture was cooled to room temperature with tap water, and diluted with water to 25 mL to prepare a standard blank solution. 100, 200, 300, 400, 500, 600, and 700 μL of glucose standard solution were taken respectively, and diluted with acetic acid-sodium acetate buffer solution to 10 mL. 2.0 mL of each of the above concentrations of glucose standard solution was taken and placed in a calibrated test tube, 3.0 mL of acetic acid-sodium acetate buffer solution and 5.0 mL of DNS reagent were added respectively, and shaken for 3 s. After heating in a boiling water bath for 5 min, the mixture was cooled to room temperature with tap water, and diluted with water to 25 mL, and shaken well. The standard blank solution was adjusted to zero, and the absorbance was measured at 540 nm. The glucose concentration was taken as the X-axis, and the absorbance value was taken as the Y-axis, and a standard curve was drawn.

[0036] Preparation of sample blank. 2.0 mL of appropriately diluted crude enzyme solution was taken and added to a calibrated test tube, 5.0 mL of DNS reagent was added and shaken for 3 s, then 2.0 mL of sodium carboxymethyl cellulose solution was added, and incubated at 37°C for 30 min. 1.0 mL of 0.3 mg / mL glucose solution was added, mixed well, and heated in a boiling water bath for 5 min. The mixture was cooled to room temperature with tap water, diluted with water to 25 mL, and vortexed for 3 s as a sample blank.

[0037] Preparation of sample. 2.0 mL of the enzyme solution was taken into a calibrated test tube, 2.0 mL of carboxymethyl cellulose sodium was added, and then vortexed for 3 s, and incubated at 37°C for 30 min. 5.0 mL of DNS reagent was added, and vortexed for 3 s to terminate the enzymatic reaction. 1.0 mL of 0.3 mg / mL glucose solution was added, and mixed well, and then heated in a boiling water bath for 5 min. The sample was cooled to room temperature with tap water, and then diluted to 25 mL with water, and then vortexed for 3 s.

[0038] Enzyme activity determination. The absorbance was determined at 540 nm with the standard blank as the control. The enzyme activity calculation formula was: X = ((CE-CB) x V) / (M x t x m), wherein: X - cellulase activity of the sample U / mL, the enzyme activity unit was the amount of enzyme required for 1 μmol of glucose generated by catalytic hydrolysis of cellulose per minute per mL of enzyme solution, which was an enzyme activity unit U, i.e. 1 U / mL; CE - glucose concentration of the enzyme reaction solution regressed from the standard curve, mg / mL; CB - glucose concentration of the enzyme blank sample regressed from the standard curve, mg / mL; V - total dilution factor of the sample; M - molar mass of glucose M(CHO) = 180.2 g / mol; t - enzymatic reaction time, min; m - sample amount, mL.

[0039] Results: The primary screening results of the cellulase-producing strains showed that a total of 45 strains produced transparent circles, and the strain SH63 had the largest transparent circle diameter (see Table 1 below). Figure 2 The D / d value was as high as 2.33, indicating that the strain had the best cellulase production effect. The strains with larger transparent circle diameters were subjected to secondary screening. The standard curve formula was y = 0.3449x + 0.0506, R 2 = 0.9984, and the fitting degree was good. The determination results showed that the enzyme activity of the strain SH63 was the highest, which was 50.31 U / mL, and therefore the strain was further studied.

[0040] Example 3: Identification of Bacillus subtilis CGMCC No. 13010

[0041] The strain SH63 was subjected to molecular biological identification using 16S rDNA universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-TACGGCTACCTTGTTACGACTT-3'). The template DNA was extracted according to the operating instructions of the bacterial DNA extraction kit. The PCR reaction system was 50 μL: 2 μL of DNA template, 25 μL of 1x EasyTap PCR SuperMix enzyme, 1.5 μL of 27F and 1492R primers, and 20 μL of sterile water. The reaction conditions were as follows: 95°C pre-denaturation for 5 min, 95°C denaturation for 1 min, 55°C annealing for 1 min, 72°C extension for 2 min, 27 cycles, and 72°C extension for 10 min. The measured gene sequence was subjected to Blast comparison analysis using the NCBI database. The Neighbor-joining method in MEGA7.0 was used to set the bootstrap value to 1000 to construct the phylogenetic tree of the strain. Figure 3

[0042] The results showed that the strain had the highest homology (99.17%) with Bacillus subtilis strain S12 (OQ504760.1) published in GenBank, and the strain SH63 was identified as Bacillus subtilis, named Bacillus subtilis 10#.

[0043] The obtained Bacillus subtilis 10# was preserved in the China General Microbiological Culture Collection Center (CGMCC) on September 19, 2016, located at No. 1, Yikhina Xilu, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, classified and named as Bacillus subtilis, and the preservation number was CGMCC No. 13010.

[0044] Example 4: Bacillus subtilis CGMCC No. 13010 fermentation condition optimization

[0045] The enzyme production condition optimization of the strain CGMCC No. 13010 mainly included fermentation medium optimization (carbon source, nitrogen source, carbon-nitrogen ratio) and fermentation condition optimization (pH value, temperature, time). The LB medium was used as the basic medium: 10 g / L of tryptone, 5 g / L of yeast powder, and 10 g / L of sodium chloride. The carbon source was mainly selected from glucose and sucrose; the nitrogen source was selected from protein peptone, yeast powder, beef powder, tryptone, soybean peptone, and casein peptone. The carbon-nitrogen ratio was set to 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, and 1:4, respectively.

[0046] ​Single factor optimization test was carried out on initial pH, fermentation temperature and fermentation time of the strain CGMCC No. 13010 respectively. Different initial pHs were set, which were 5.5, 6.0, 6.5, 7.0, 7.5 respectively; different culture temperatures were set, which were 28℃, 33℃, 37℃, 40℃, 45℃ respectively; OD600 nm absorbance and cellulase activity of the strain were determined every 2h. There were 3 parallel experiments in each experimental group.

[0047] Results: From Figure 4 It can be seen that first, when the carbon source is glucose and the nitrogen source is yeast powder, the cellulase activity of Bacillus subtilis CGMCC No. 13010 is the highest, which is 53.89 U / mL. Then, from Figure 5 It can be seen that when the carbon-nitrogen ratio is 1:2, the cellulase activity of Bacillus subtilis CGMCC No. 13010 is the highest, which is 54.68 U / mL. That is, the optimized medium is: glucose 5 g / L, yeast powder 10 g / L, sodium chloride 10 g / L. From Figure 6 、 7 , 8 it can be seen that when the initial pH of the culture medium is 7.0, the culture temperature is 37℃, and the culture time is 20h, the cellulase activity of Bacillus subtilis CGMCC No. 13010 is the highest, which is 55.73 U / mL.

[0048] Example 5: Application of Bacillus subtilis CGMCC No. 13010 in fermentation of Dendrobium

[0049] First, fresh Dendrobium candidum stems were freeze-dried, crushed, and sieved through a 60-mesh sieve for use.

[0050] Fermented Dendrobium group treatment: 1g of Dendrobium stem powder was dissolved in 10mL of Bacillus subtilis CGMCC No. 13010 fermentation broth prepared according to the method of Example 4, and shaken to mix evenly, and cultured in a 37℃ constant temperature incubator for 24h.

[0051] Control group treatment: 1g of Dendrobium stem powder was dissolved in 10mL of physiological saline, shaken to mix evenly, and cultured in a 37℃ constant temperature incubator for 24h.

[0052] Determination of the content of the shihuchuan alkaloid: the fermentation broth of the fermented Dendrobium candidum group and the control group was centrifuged at 6000 r / min for 10 min, and the supernatant was taken. The supernatant was concentrated by a rotary evaporator, and the solid after concentration was redissolved with 1 mL of methanol. The mixture was centrifuged at 10000 r / min for 2 min, and the supernatant was taken for use. The mixture was filtered through a 0.45 μm filter membrane, and the content of the shihuchuan alkaloid in the shihuchuan powder extract was quantitatively determined by high performance liquid chromatography according to the method in the first part of the Pharmacopoeia of the People's Republic of China (2020 edition) and the literature.

[0053] Results: The content of the shihuchuan alkaloid in the control group of Dendrobium candidum was 4 mg / g, and the content of the shihuchuan alkaloid in the Dendrobium candidum fermented by Bacillus subtilis CGMCC No. 13010 was 7 mg / g. It is proved that the strain in the present application can utilize the cellulase produced by itself to effectively degrade the cellulose in the cell wall of Dendrobium candidum, promote the release of the effective components in the cells, and greatly improve the extraction rate of the shihuchuan alkaloid and other effective components in Dendrobium candidum.

[0054] Example 6: Application of Bacillus subtilis CGMCC No. 13010 fermented Dendrobium candidum in the culture of Penaeus vannamei

[0055] The test site was in a culture base in Zhao'an. Penaeus vannamei used in the test was purchased from the base, and individuals with normal feeding, consistent size, robust body, active feeding, no injury and no disease were selected as test materials, with an initial average weight of (1.35±0.08) g. They were randomly divided into 3 groups with 3 replicates each, and were fed with the basic feed 3 times a day (08:00, 14:00 and 19:00). The control group was fed with the basic feed, the test group 1 was fed with the feed added with 5% Bacillus subtilis CGMCC No. 13010 fermented Dendrobium candidum, and the test group 2 was fed with the feed added with 5% Dendrobium candidum powder, and a 6-week culture experiment was conducted. The formula of the basic feed for Penaeus vannamei was as follows: soybean meal 30.00%, fish meal 30.00%, alpha starch 5.00%, squid paste 5.00%, gluten 4.00%, soybean oil 1.00%, fish oil 1.00%, lecithin 2.00%, vitamin C phosphate 0.10%, choline chloride 0.50%, sodium alginate 1.00%, multi-vitamin 0.40%, multi-mineral 0.40%, calcium phosphate 1.00%, and flour 18.60%. During the culture, the water was changed once a day, with a change amount of 1 / 4 of the culture water, and the feeding and death of the Penaeus vannamei in each experimental barrel were recorded. The water temperature was 22-28℃, the salinity was 28‰, the pH value was 8.4-8.6, the nitrite content was 0-3 mg / L, and the dissolved oxygen content was more than 5 mg / L. After the experiment, the relevant indexes were measured and calculated, and the death was observed and recorded throughout the whole process.

[0056] The test indexes were as follows:

[0057] Weight gain rate WGR (%) = (final average weight - initial average weight) x 100 / initial average weight

[0058] Survival rate SR (%) = final number of shrimp tail x 100 / initial number of shrimp tail

[0059] Feed conversion ratio FCR = feed amount / (final shrimp weight - initial shrimp weight)

[0060] The enzyme activities of superoxide dismutase (SOD), catalase (CAT) in hepatopancreas and lysozyme (LZM) in serum were determined by ELISA kit.

[0061] Results: As shown in Table 1, compared with the control group fed with the basic feed, the weight gain rate and survival rate of the Penaeus vannamei fed in the test group 1 and the test group 2 were improved, and the feed conversion ratio was lower than that of the control group. Among them, the weight gain rate and survival rate of the Penaeus vannamei fed in the test group 1 were significantly higher than those of the control group, and the feed conversion ratio was significantly lower than that of the control group; from the enzyme activities of superoxide dismutase, catalase in hepatopancreas and lysozyme in serum, the test group 1 and the test group 2 were also superior to the control group, and the test group 1 was significantly superior to the control group. The above results show that the Dendrobium nobile fermented by Bacillus subtilis CGMCC No. 13010 can significantly promote the growth performance of Penaeus vannamei and improve its immune function, and the addition of Dendrobium nobile powder in feed can also improve the growth and immunity to a certain extent, but the effect is not as good as that of adding Dendrobium nobile fermented by Bacillus subtilis CGMCC No. 13010, which also verifies that the Dendrobium nobile fermented by Bacillus subtilis CGMCC No. 13010 in the present patent can promote the full release of effective components in Dendrobium nobile and improve its medicinal value.

[0062] Table 1 Effect of Dendrobium nobile fermented by Bacillus subtilis CGMCC No. 13010 on growth and immune indexes of Penaeus vannamei (average value ± standard error)

[0063]

[0064]

[0065] Example 7: Application of Dendrobium nobile fermented by Bacillus subtilis CGMCC No. 13010 in the culture of Pseudosciaena crocea

[0066] The test site was in Zha'an aquaculture base. The test P. major was purchased from the base, and healthy individuals with the same size, robust body, active feeding and no disease were selected as test materials. The initial body weight of P. major was 14.63±0.18 g. Before the test, the P. major was acclimated with the basic feed for 1 week. The basic feed formula for P. major was as follows: 40.00% of domestic fish meal, 10.95% of soybean meal, 12.05% of wheat protein powder, 20.00% of wheat starch, 1.88% of fish oil, 1.88% of soybean oil, 1.49% of lecithin, 1.50% of calcium dihydrogen phosphate, 0.30% of choline chloride, 3.00% of vitamin premix, 2.00% of mineral premix, and 4.94% of cellulose. The fermented D. candidum CGMCC No. 13010 was mixed with the basic feed raw materials at an addition amount of 5% to prepare the feed for P. major. After the acclimation with the basic feed for 1 week, the P. major was fasted for 24 h. The test was divided into 3 groups (control group: fed with basic feed; test group 1: fed with feed containing 5% fermented D. candidum CGMCC No. 13010; and test group 2: fed with feed containing 5% D. candidum powder), and 3 replicates were set in each group, with 50 P. major in each replicate. The P. major was cultured in small-scale floating net cages (1.5 m x 1.5 m x 2.0 m) with the same size for 6 weeks. The P. major was fed twice a day (05:00 and 17:00) during the test, with the feeding amount being 4%-6% of the body weight of the P. major. The water temperature was 27-30°C, the dissolved oxygen was ≥7 mg / L, and the salinity was 27-30‰ during the test.

[0067] The test indexes were as follows:

[0068] Weight gain rate WGR (%) = (final average weight-initial average weight) x 100 / initial average weight

[0069] Survival rate SR (%) = final number of remaining fish x 100 / initial number of fish

[0070] Feed conversion ratio FCR = feed amount / (final fish weight-initial fish weight)

[0071] The enzyme activities of superoxide dismutase (SOD), catalase (CAT) in the liver and lysozyme (LZM) in the serum were determined by ELISA kit.

[0072] Results: As shown in Table 2, compared with the control group fed with the basic feed, the weight gain rate and survival rate of the large yellow croaker fed in the test group 1 and the test group 2 were improved, and the feed coefficient was lower than that of the control group, and the growth index parameters of the large yellow croaker fed in the test group 1 were significantly better than those of the control group; from the enzyme activities of superoxide dismutase, catalase in the liver and lysozyme in the serum, the test group 1 and the test group 2 were also better than the control group, and the test group 1 was significantly better than the control group. The above results show that the addition of dendrobium powder and bacillus subtilis CGMCC No. 13010 fermented dendrobium in the feed can promote the growth performance, survival rate and immune function of large yellow croaker, and the feed added with fermented dendrobium can significantly improve the growth and immune parameters of large yellow croaker, which again verifies that the bacillus subtilis CGMCC No. 13010 fermented dendrobium in the patent can promote the full release of effective components in dendrobium and improve its medicinal value.

[0073] Table 2 Effect of bacillus subtilis CGMCC No. 13010 fermented dendrobium on growth and immune index of large yellow croaker (mean ± standard error)

[0074]

[0075]

[0076] SEQ ID No. 1:

[0077] GGGCGCGTGCTATAATGCAAGTCGAGCGGACAGATGGGAGCTTGCTCCCTG

[0078] ATGTTAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCTGTAAGAC

[0079] TGGGATAACTCCGGGAAACCGGGGCTAATACCGGATGGTTGTTTGAACCGC

[0080] ATGGTTCAAACATAAAAGGTGGCTTCGGCTACCACTTACAGATGGACCCGC

[0081] GGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCAACGATGCGTA

[0082] GCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAG

[0083] ACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCT

[0084] GACGGAGCAACGCCGCGTGAGTGATGAAGGTTTTCGGATCGTAAAGCTCT

[0085] GTTGTTAGGGAAGAACAAGTACCGTTCGAATAGGGCGGTACCTTGACGGTA

[0086] CCTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGTAATACGT

[0087] AGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGCAGGCGG

[0088] TTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGG

[0089] AAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCACGTGTAGC

[0090] GGTGAAATGCGTAGAGATGTGGAGGAACACCAGTGGCGAAGGCGACTCTC

[0091] TGGTCTGTAACTGACGCTGAGGAGCGAAAGCGTGGGGAGCgGAACAGGAT

[0092] TAGATACCCTGGTAGTCCACGCCGTAAACGATGAGTGCTAAGKGTTAGGGG

[0093] GKTTYCCGCCCCTTAGTGCTGCAGCTAACGCAtTTAAGCACTCCGCCTGGG

[0094] GRRKWMGGTCGCAAGACTGAAACTCAAAGGAATTGACGGGGGCCCGCAC

[0095] AAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAACCTTACCA

[0096] GGTCTTGACATCCTCTGACAATCCTAGAGATAGGACGTCCCCTTCGGGGGC

[0097] AGAGTGACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGATGTTGG

[0098] GTTAAGTCCCGCAACGAGCGCAACCCTTGATCTTAGTTGCCAGCATTCAGT

[0099] TGGGCACTCTAAGGTGACTGCCGGTGACAAACCGGAGGAAGGTGGGGATG

[0100] ACGTCAAATCATCATGCCCCTTATGACCTGGGCTACACACGTGCTACAATGG

[0101] ACAGAACAAAGGGCAGCGAAACCGCGAGGTTAAGCCAATCCCACAAATCT

[0102] GTTCTCAGTTCGGATCGCAGTCTGCAACTCGACTGCGTGAAGCTGGAATCG

[0103] CTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGTTCCCGGGCCTTGTA

[0104] CACACCGCCCGTCACACCACGAGAGTTTGTAACACCCGAAGTCGGTGAGGTAACCTTTTAGGAGCCAGCCGCCGAAGGGACAGAGT.

Claims

1. The application of a strain of Bacillus subtilis CGMCC No. 13010 in fermented Dendrobium, characterized by: Dendrobium stem powder was fermented using the Bacillus subtilis CGMCC No.13010 fermentation broth to increase the dendrobine content of the fermented Dendrobium. The fermented Dendrobium was used to prepare feed to improve the growth performance and / or immune performance of Litopenaeus vannamei or large yellow croaker.

2. The application according to claim 1, characterized in that, The fermented Dendrobium is prepared through the following steps: Dissolve 1g of Dendrobium stem powder in 10ml of Bacillus subtilis CGMCC No.13010 fermentation broth, shake to mix, and incubate at 37℃ for 24h to obtain the final product.

3. The application according to claim 2, characterized in that, The Bacillus subtilis CGMCC No. 13010 fermentation broth was prepared according to the following fermentation medium and fermentation conditions: (1) Fermentation medium: glucose 5g / L, yeast powder 10g / L, sodium chloride 10g / L; (2) Fermentation conditions: pH 7.0, culture temperature 37 ℃, culture time 20 h.

4. The application according to claim 1, characterized in that, Feed was prepared by adding 5% Bacillus subtilis CGMCC No. 13010 fermented Dendrobium to the basic feed and used to feed whiteleg shrimp or large yellow croaker.

5. The application according to claim 1, characterized in that, The fermented Dendrobium contains 7 mg / g of dendrobine.

Images