Double-Gap modified oligonucleotides and their applications in anti-hepatitis B and hepatitis D viruses

Abstract

The present invention provides double-Gap modified oligonucleotides and their applications in anti-hepatitis B and hepatitis D viruses. Specifically, the present invention provides a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof, wherein (a) the compound is a double-Gap modified oligonucleotide; and wherein the oligonucleotide has a sequence as shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5; (b) the double-Gap modification refers to that each nucleoside portion in the oligonucleotide is modified in a manner as shown in Formula I; and (c) the internucleoside bond of the oligonucleotide is an unmodified or modified internucleoside bond, wherein P1, P2, P3, S1 and S2 and specific modifications are as described in the text. The double-Gap modified oligonucleotide of the present invention has significantly improved antiviral activity. P1-S1-P2-S2-P3(I).

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and specifically relates to a double-Gap modified oligonucleotide and application thereof in resisting hepatitis B and hepatitis D viruses. Background Art

[0002] Hepatitis B is a viral disease caused by hepatitis B virus (HBV) infection. The main transmission routes include blood transmission, sexual transmission and mother-to-child transmission. The World Health Organization (World Health Organization) estimates that in 2015, more than 200 million people were chronically infected with HBV worldwide, and 887,000 people died from complications caused by HBV infection. 90% of adults infected with HBV can recover on their own, but 90% of infants and young children infected with HBV will develop chronic hepatitis. Chronic HBV infection may cause liver fibrosis, further developing into cirrhosis and hepatocellular carcinoma (HCC). In addition, studies have shown that hepatitis B increases the risk of pancreatic cancer.

[0003] Hepatitis D virus (HDV) is a satellite virus of HBV. It relies on hepatitis B surface antigen (HBsAg) to form its complete infectious HDV virus particles. HDV infection can only occur in patients with concomitant HBV infection. HDV / HBV co-infection has significant complications and also significantly increases the progression rate of liver fibrosis to cirrhosis. For patients with chronic HDV infection, there is currently only one intervention method, interferon treatment, and there is no marketed drug that directly targets the HDV virus. Existing treatments are ineffective and have significant side effects.

[0004] HBV adheres to the surface of hepatocytes through low-affinity receptors, and then enters the hepatocytes through endocytosis with the help of specific receptors on the hepatocyte membrane. The nucleocapsid disintegrates and introduces rcDNA into the host cell nucleus. In the nucleus, rcDNA is converted into covalently closed circular DNA (cccDNA) through the cell's DNA repair mechanism. cccDNA is the storage form of HBV genetic material in the cell and is also the main transcription template of HBV. Host cells recognize the promoter and enhancer on cccDNA and transcribe 3.5kb, 2.4kb, 2.1kb and 0.7kb mRNAs, of which 3.5kb is pregenomic RNA (pgRNA). mRNA enters the cytoplasm and is translated into viral proteins, including core antigen (HBcAg), e antigen (HBeAg), surface antigen (HBsAg), x protein (HBx) and polymerase (Polymerase). Under the action of Polymerase, pgRNA is used as a template for reverse transcription to synthesize the negative sense strand of HBV DNA, and then the negative sense strand is used as a template to further synthesize part of the positive strand to form rcDNA. At the same time, HBcAg assembles into nucleocapsids to encapsulate rcDNA to form viral core particles. After HBsAg is synthesized, it polymerizes in the endoplasmic reticulum and is transported to the Golgi apparatus to package viral core particles. The assembled viral particles are finally secreted out of the cell by budding.

[0005] After HBV infects human liver cells, two different particles are mainly produced. One is Dane particles, which are the complete HBV virus itself, including the viral nucleocapsid assembled by hepatitis B core antigen (HBcAg) and viral nucleic acid (RcDNA), and has a viral envelope composed of hepatitis B surface antigen (HBsAg); the other is subviral particles (SVP), which are non-infectious particles composed of lipids, cholesterol, cholesterol esters and hepatitis B surface antigen (HBsAg). The hepatitis B surface antigen contained in SVP accounts for the vast majority of hepatitis B surface antigen in the patient's blood (>99.9%). HBV-infected liver cells also secrete an e-antigen (HBeAg) into the blood. Hepatitis B surface antigen (HBsAg), hepatitis B surface antibody (HBsAb), hepatitis B core antibody (HBcAb), hepatitis B e antigen (HBeAg) and hepatitis B e antibody (HBeAb) are important molecular markers for evaluating the intervention of drugs on the virus.

[0006] A large amount of hepatitis B surface antigen (HBsAg) in the form of subviral particles (SVP) in the blood of patients with chronic HBV infection can neutralize specific hepatitis B surface antibodies (HBsAb) secreted by B lymphocytes, thereby leading to immune tolerance, while only a small number of HBV virus particles can escape immune detection, which may be one of the important reasons why HBV maintains chronic infection. The serological conversion of hepatitis B surface antigen (HBsAg) (HBsAg clearance from the blood and the appearance of free HBsAb) is a recognized prognostic indicator for functional control of viral infection during treatment. Another key reason for HBV to maintain chronic infection characteristics is that it synthesizes a stable circular DNA repository, namely HBV covalently closed circular DNA (cccDNA), in the nucleus of infected hepatocytes with the help of host DNA repair enzymes. cccDNA can exist stably in hepatocytes for a long time and can be continuously replenished. It can produce HBV viral nucleic acid RcDNA and mRNA required to encode all viral antigens through transcription and reverse transcription. Transcriptional inhibition or elimination of cccDNA is crucial for curing or functionally curing HBV infection. Long-term treatment with nucleoside (acid) analogs cannot completely eliminate cccDNA, nor can it inhibit its transcription, so the expression level of hepatitis B surface antigen (HBsAg) is almost unaffected by nucleoside (acid) drugs. Immunomodulation can mediate humoral and cellular immunity, thereby inhibiting cccDNA transcription or clearing infected cells, but a large antigen load will greatly inhibit the immune process, so significantly reducing antigens, especially hepatitis B surface antigen (HBsAg), combined with immunomodulation is an effective means to help patients achieve lasting immune control.

[0007] The drugs used clinically to treat hepatitis B mainly include interferons and nucleoside (acid) drugs. Interferon drugs include ordinary interferon and polyethylene glycol-modified long-acting interferon, the latter including PEG-IFNα-2a and PegIntron (PEG-IFNα-2b). Nucleoside (acid) drugs include lamivudine, telbivudine, adefovir dipivoxil, tenofovir disoproxil fumarate (TDF), tenofovir alafenamide fumarate (TAF), entecavir, etc. These nucleoside drugs can effectively control the replication of the virus and improve liver function, so they are the most widely used. Interferon needs to be injected, individual reactions vary greatly, adverse reactions are obvious, and the efficacy is poor. Nucleoside drugs only act on the replication process of the virus from pgRNA to rcDNA, and have no inhibitory effect on other links in the life cycle of hepatitis B virus. After long-term treatment, the negative conversion rate of hepatitis B e antigen (HBeAg) is still low, and very few patients can turn negative for hepatitis B surface antigen (HBsAg). After 48 weeks of treatment with entecavir (354 cases) and tenofovir (176 cases), the negative conversion rates of hepatitis B surface antigen (HBsAg) in patients with positive hepatitis B e antigen (HBeAg) were 2% and 3.2%, respectively, and the negative conversion rates of hepatitis B surface antigen (HBsAg) in patients with negative hepatitis B e antigen (HBeAg) were 0.3% and 0%, respectively. Since existing treatment options cannot cure hepatitis B, patients need to take medication for a long time, which may expose patients to major side effects. For example, long-term use of adefovir dipivoxil and tenofovir disoproxil fumarate can cause nephrotoxicity and bone toxicity. Existing drug therapies or combination therapies cannot induce effective immune responses or HBsAg seroconversion that can provide lasting control of infection or functional cure, except in a small number of patients (<3%). Cure or functional cure of chronic HBV infection is a huge unmet clinical need.

[0008] In summary, the field urgently needs to discover and develop new antiviral treatment methods, especially new treatments that can effectively inhibit hepatitis B virus antigens HBsAg and / or HBeAg and improve their seroconversion rate. Summary of the invention

[0009] The purpose of the present invention is to provide a new compound for anti-hepatitis B virus / hepatitis D virus treatment.

[0010] In a first aspect of the present invention, a compound is provided, or a pharmaceutically acceptable salt, hydrate or solvate thereof, wherein the compound is a double-Gap modified oligonucleotide;

[0011] in,

[0012] (a) The oligonucleotide has a sequence as shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5;

[0013] SEQ ID NO.2 GCAGAGGTGAAGCGAAGTGC SEQ ID NO.3 GTGCAGAGGTGAAGCGAAGT SEQ ID NO.4 AGAGGTGAAGCGAAGTGCAC SEQ ID NO.5 GTGAAGCGAAGTGCACACGG

[0014] (b) The double-Gap modification means that each nucleoside portion in the oligonucleotide is modified in the manner shown in Formula I;

[0015] P1-S1-P2-S2-P3 (I)

[0016] In Formula I,

[0017] P1 represents a modified region located at the 5′ end consisting of at least one consecutive nucleotide;

[0018] P2 represents a modified region consisting of at least one consecutive nucleotide starting from the 3′ end of the S1 region;

[0019] P3 represents a modified region located at the 3′ end consisting of at least one consecutive nucleotide;

[0020] S1 represents a spacer region consisting of at least 1 consecutive nucleotide; and

[0021] S2 represents a spacer region consisting of at least one continuous nucleotide starting from the 3′ end of the P2 region;

[0022] and,

[0023] In the modified region, all nucleoside moieties have sugar modifications, and all nucleoside moieties optionally have base modifications; and

[0024] In the spacer region, all nucleoside moieties are free of sugar modification, and all nucleoside moieties are optionally free of base modification;

[0025] as well as,

[0026] (c) the internucleoside bonds of the oligonucleotide are unmodified or modified internucleoside bonds; and the modified internucleoside bonds refer to that some or all of the phosphodiester internucleoside bonds in the oligonucleotide are independently replaced by internucleoside bonds selected from the following groups: phosphorothioate internucleoside bonds, phosphorodithioate internucleoside bonds or a combination thereof.

[0027] In another preferred embodiment, each nucleoside in P1, P2 and P3 is a modified nucleoside (preferably, the modified nucleoside comprises a modified sugar and a modified or unmodified base); and each nucleoside in S1 and S2 is an unmodified nucleoside or a sugar in an unmodified nucleoside.

[0028] In another preferred embodiment, the glycosyl modification is selected from: 2'-O-methylated glycosyl modification, 2'-O-methoxyethylated glycosyl modification, or a combination thereof; preferably, it is 2'-O-methoxyethylated glycosyl modification (moe).

[0029] In another preferred embodiment, the base modification is a methyl modification (5-methyl, 5Me) at the 5-position of cytosine (C) base.

[0030] In another preferred embodiment, the internucleoside bond of the oligonucleotide is a phosphorothioate internucleoside bond, a phosphorodithioate internucleoside bond or a combination thereof.

[0031] In another preferred embodiment, the internucleoside bond of the oligonucleotide is a phosphorothioate bond.

[0032] In another preferred embodiment, P1 represents a modified region located at the 5' end and consisting of 2 to 6 (preferably 3 to 4) consecutive nucleotides.

[0033] In another preferred embodiment, P2 represents a modified region consisting of 1 to 5 (preferably 1, 2, 3 or 4) consecutive nucleotides.

[0034] In another preferred embodiment, P3 represents a modified region consisting of 2 to 6 (preferably 3 or 4) consecutive nucleotides.

[0035] In another preferred embodiment, S1 represents a spacer region consisting of 3 to 7 (preferably 4, 5, 6 or 7, more preferably 4, 5 or 6, most preferably 5 or 6) consecutive nucleotides.

[0036] In another preferred embodiment, S2 represents a spacer region consisting of 3 to 7 (preferably 4, 5, 6 or 7, more preferably 4, 5 or 6, and most preferably 5 or 6) consecutive nucleotides.

[0037] In another preferred embodiment, the oligonucleotide described in (a) has a sequence as shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5; (b) the double-Gap modification refers to that each nucleoside portion in the oligonucleotide is modified in a manner as shown in Formula I; P1-S1-P2-S2-P3 (I); in Formula I, P1 represents a modified region located at the 5' end consisting of 2 to 6 consecutive nucleotides; P2 represents a modified region consisting of 1 to 5 consecutive nucleotides; P3 represents a modified region consisting of 2 to 6 consecutive nucleotides; S1 represents a spacer region consisting of 4, 5 or 6 consecutive nucleotides; S2 represents a spacer region consisting of 4, 5 or 6 consecutive nucleotides; and in the modified region, all nucleoside portions are sugar-modified, and all nucleoside portions are sugar-modified. and in the spacer region, all nucleoside moieties are free of sugar modification, and all nucleoside moieties are optionally base modified; wherein the sugar modification is selected from: 2'-O-methylated sugar modification, 2'-O-methoxyethylated sugar modification, or a combination thereof; the base modification is a methyl modification at position 5 of cytosine (C) base; and, (c) the internucleoside bonds of the oligonucleotide are modified internucleoside bonds; and the modified internucleoside bonds refer to that some or all of the phosphodiester internucleoside bonds in the oligonucleotide are independently replaced by internucleoside bonds selected from the following groups: phosphorothioate internucleoside bonds, phosphorodithioate internucleoside bonds, or a combination thereof.

[0038] In another preferred embodiment, the oligonucleotide described in (a) has a sequence as shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5; (b) the double-Gap modification refers to that each nucleoside portion in the oligonucleotide is modified in a manner as shown in Formula I; P1-S1-P2-S2-P3 (I); in Formula I, P1 represents a modified region consisting of 3 to 4 consecutive nucleotides located at the 5' end; P2 represents a modified region consisting of 1, 2, 3 or 4 consecutive nucleotides; P3 represents a modified region consisting of 3 or 4 consecutive nucleotides; S1 represents a spacer region consisting of 5 or 6 consecutive nucleotides; S2 represents a spacer region consisting of 5 or 6 consecutive nucleotides. and, in the modified region, all nucleoside moieties are sugar-modified, and all nucleoside moieties are optionally base-modified; and in the spacer region, all nucleoside moieties are not sugar-modified, and all nucleoside moieties are optionally base-modified; wherein the sugar modification is selected from: 2'-O-methylated sugar modification, 2'-O-methoxyethylated sugar modification, or a combination thereof; the base modification is a methyl modification at position 5 of cytosine (C); and, (c) the internucleoside bonds of the oligonucleotide are all phosphorothioate internucleoside bonds.

[0039] In another preferred embodiment, the oligonucleotide has a sequence as shown in SEQ ID NO.2 or SEQ ID NO.5.

[0040] In another preferred embodiment, the oligonucleotide has a sequence as shown in SEQ ID NO.2.

[0041] In another preferred embodiment, when the oligonucleotide has a sequence as shown in SEQ ID NO.2, the sugar modification is a 2'-O-methoxyethylated sugar modification; and / or, when the oligonucleotide has a sequence as shown in SEQ ID NO.5, the sugar modification is a 2'-O-methylated sugar modification.

[0042] In another preferred embodiment, the oligonucleotide has a sequence as shown in SEQ ID NO. 2, and the sugar modification is a 2'-O-methoxyethylated sugar modification.

[0043] In another preferred embodiment, the oligonucleotide described in (a) has a sequence as shown in SEQ ID NO.2; (b) the double-Gap modification refers to that each nucleoside portion in the oligonucleotide is modified in a manner as shown in Formula I; P1-S1-P2-S2-P3 (I); in Formula I, P1 represents a modified region consisting of 3 to 4 consecutive nucleotides located at the 5' end; P2 represents a modified region consisting of 1, 2, 3 or 4 consecutive nucleotides; P3 represents a modified region consisting of 3 or 4 consecutive nucleotides; S1 represents a spacer region consisting of 5 or 6 consecutive nucleotides; S2 represents a spacer region consisting of 5 or 6 (c) the oligonucleotides are all phosphorothioate internucleoside bonds.

[0044] In another preferred embodiment, the compound is selected from Table A and Table B

[0045] Table A

[0046]

[0047] In Table A, A / T / G / C represent conventional unmodified deoxyribonucleotide residues; A / T / G / Crepresents a 2'-O-methyl modified nucleoside base; and the internucleoside bonds of each oligonucleotide are phosphorothioate internucleoside bonds;

[0048] Table B

[0049]

[0050] In Table B, A / T / G represent conventional unmodified deoxyribonucleotide residues and C represents 5-methyl modified deoxyribonucleotide residues; A / T / G / C represents a 2'-O-methoxyethyl modified nucleotide base; and the internucleoside bonds of each oligonucleotide are phosphorothioate internucleoside bonds.

[0051] In another preferred embodiment, the compound is selected from: PA0088, PA0089, PA0114, PA0090, PA0115, PA0091, PA0116, PA0092, PA0093, PA0094 and PA0095.

[0052] In another preferred embodiment, the compound is selected from the following group:

[0053] 5'-Gmoe* 5Me Cmoe*Amoe*Gmoe*dA*dG*dG*dT*dG*Amoe*dA*dG* 5Me dC*dG*dA*dA*Gmoe*Tmoe*Gmoe* 5Me Cmoe-3'(PA0088); or 5'-Gmoe* 5Me Cmoe*Amoe*dG*dA*dG*dG*dT*dG*Amoe*dA*dG* 5Me dC*dG*dA*dA*dG*Tmoe*Gmoe* 5Me Cmoe-3'(PA0089).

[0054] Among them, * represents thiophosphate; Amoe, Gmoe, 5Me The meo in Cmoe and Tmoe represents the presence of 2'-O-methoxyethyl sugar modification on the sugar group of the corresponding nucleoside (i.e., Amoe, Gmoe, Cmoe, and Tmoe represent 2'-O-methoxyethyl modified nucleosides); dA, dG, 5Me dA, dG, dC, and dT in dC and dT represent unmodified nucleosides; 5Me dC 5Me Indicates the presence of a methyl modification at the 5th position of the base.

[0055] In the second aspect of the present invention, a pharmaceutical composition is provided, which comprises the compound as described in the first aspect, or a pharmaceutically acceptable salt, hydrate or solvate thereof, and a pharmaceutically acceptable carrier.

[0056] In the third aspect of the present invention, there is provided a compound as described in the first aspect, or a pharmaceutically acceptable salt, hydrate or solvate thereof, or a pharmaceutical composition as described in the third aspect for use in the preparation of a drug for treating and / or preventing diseases associated with hepatitis B virus or hepatitis D virus.

[0057] In another preferred embodiment, the disease includes one or more of the following diseases: diseases associated with hepatitis B virus infection, and diseases associated with co-infection of hepatitis B virus and hepatitis D virus.

[0058] In another preferred embodiment, the disease may be an acute disease or a chronic disease.

[0059] In another preferred embodiment, the disease includes hepatitis B, hepatitis D, liver fibrosis, cirrhosis, hepatocellular carcinoma (HCC), or a combination thereof.

[0060] In another preferred embodiment, the disease includes acute or chronic liver disease.

[0061] In the fourth aspect of the present invention, a method for treating and / or preventing diseases related to hepatitis B virus or hepatitis D virus is provided, the method comprising the steps of administering a safe and effective amount of the compound as described in the first aspect, or a pharmaceutically acceptable salt, hydrate or solvate thereof, or the pharmaceutical composition as described in the second aspect to a subject in need.

[0062] In another preferred embodiment, the disease is as defined in the third aspect.

[0063] In another preferred embodiment, the method comprises administering a safe and effective amount of the compound as described in the first aspect, or a pharmaceutically acceptable salt, hydrate or solvate thereof, or the pharmaceutical composition as described in the second aspect to a subject in need thereof by intravenous injection and / or subcutaneous injection.

[0064] In another preferred embodiment, the subject is a mammal; preferably, the subject is selected from humans, rats, mice, or a combination thereof.

[0065] In the fifth aspect of the present invention, a method for regulating the expression of HBV DNA / RNA, HBsAg and / or HBeAg is provided, the method comprising the steps of: contacting a subject with a compound as claimed in claim 1, or a pharmaceutically acceptable salt, hydrate or solvate thereof, thereby regulating the expression of HBV DNA / RNA, HBsAg and / or HBeAg.

[0066] In another preferred embodiment, the method is non-therapeutic in vitro.

[0067] In another preferred embodiment, the object is a cell.

[0068] In another preferred embodiment, the regulation refers to inhibiting the expression of HBV DNA / RNA, HBsAg and / or HBeAg, or reducing the level of HBV RNA and / or HBeAg outside the cell (such as the culture medium of the cell).

[0069] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 and Figure 2 The relative inhibition rate of antisense oligonucleotides with different Gap modification patterns on the expression and secretion of HBsAg by HepG2.2.1.5 is shown.

[0071] Figure 3 The antiviral effects of antisense oligonucleotides with different Gap modification patterns in HepG2.2.15 cell line are shown.

[0072] Figure 4 The efficacy of antisense oligonucleotides with Gap modification patterns in animals was shown.

[0073] Figure 5 Body weight gain of animals treated with antisense oligonucleotides showing Gap modification patterns. DETAILED DESCRIPTION

[0074] After long-term and in-depth research, the inventor unexpectedly found that modifying an oligonucleotide having a specific sequence (especially a sequence as shown in SEQ ID NO.2) in a double-Gap modification manner can enhance, or even significantly enhance, the antiviral activity of the antisense oligonucleotide and the concentration of HBsAg at the cellular level. Based on the above findings, the inventor completed the present invention.

[0075] the term

[0076] The term "oligonucleotide" refers to an oligomer of nucleotides in ribonucleic acid (RNA) and / or deoxyribonucleic acid (DNA). The term includes oligonucleotides consisting of modified or unmodified nucleobases, modified or unmodified sugars (ribose or deoxyribose) and modified or unmodified internucleoside bonds (phosphodiester bonds), and one or more bases in the oligonucleotides may be optionally replaced (such as replacing T with modified or unmodified U), and oligonucleotides with similar functions of non-naturally occurring parts. In particular, modified or substituted oligonucleotides may be superior to natural forms due to desirable properties such as the following: for example, reduced immunoreactivity, enhanced cellular uptake, enhanced affinity for nucleic acid targets and / or improved stability to nuclease-mediated degradation. In the present invention, oligonucleotides may be single-stranded or double-stranded, including single-stranded molecules, such as antisense oligonucleotides (ASOs), and aptamers and miRNAs, and double-stranded molecules, such as small interfering RNAs (siRNAs) or small hairpin RNAs (shRNAs). Oligonucleotides may include various modifications, such as stabilizing modifications, and thus may be modified in part or in whole, and / or in sugars and / or bases, or may include at least one modification or modifying group. For example, an oligonucleotide may be modified, including but not limited to, one or more modifications, or may be completely modified so as to contain all bonds or sugars or bases with the modifications described (that is, each phosphodiester bond, sugar, and base constituting the oligonucleotide is unmodified, or partially modified or fully modified). In the present invention, the modified internucleoside bond may be a phosphorothioate bond and / or a phosphorodithioate bond. Other modifications useful for the present invention include, but are not limited to, modifications at the 2' position of the sugar, including 2'-O-alkyl modifications (such as 2'O-methyl modifications, 2'-O-methoxyethyl modifications (2'MOE)), 2'-amino modifications, 2'-halogen modifications (such as 2'-fluoro substitutions); acyclic nucleotide analogs. Other 2' position modifications are also well known in the art and may be used, such as locked nucleic acids. Specifically, the oligonucleotide has modified bonds throughout or has each modified bond, for example, phosphorothioate; with 3'-cap and / or 5'-cap: including terminal 3'-5' bonds. Base modification can include 5' methylation (5' methylcytosine) of cytosine bases and / or 4' thiolation (4' thiouracil) of uracil bases. When the synthesis conditions are chemically compatible, different chemically compatible modified bonds can be combined, for example, with oligonucleotides with phosphorothioate bonds, 2' ribose modifications (e.g., 2' O-methylation) and modified bases (e.g., 5' methylcytosine). All of these different modifications (e.g., each phosphorothioate bond, each 2' modified ribose and each modified base) can be used to further fully modify the oligonucleotide.

[0077] For the sake of brevity, unless otherwise specified, the oligonucleotides represented herein in the form of DNA / RNA sequences or defined in the manner shown in, for example, SEQ ID NO. 2 include modified or unmodified oligonucleotides having the sequence.

[0078] The term "antisense oligonucleotide" refers to a single-stranded oligonucleotide having a nucleic acid base sequence that allows hybridization to the corresponding segment of a target nucleic acid.

[0079] As used herein, the term "nt" refers to nucleotide.

[0080] The term "complementary" refers to the ability of the nucleic acid base sequence of the antisense oligonucleotide to accurately base pair with the corresponding nucleic acid base sequence in the target nucleic acid, and is mediated by hydrogen bonding between the corresponding nucleic acid bases, such as adenine base pairing with thymine (or uracil) and guanine pairing with cytosine.

[0081] In the present invention, the terms "comprising", "including" or "comprising" indicate that various components can be applied together in the mixture or composition of the present invention. Therefore, the terms "consisting mainly of" and "consisting of" are included in the term "comprising".

[0082] In the present invention, the term "pharmaceutically acceptable" ingredient refers to a substance that is suitable for use in humans and / or animals without excessive adverse side effects (such as toxicity, irritation and allergic reaction), that is, has a reasonable benefit / risk ratio.

[0083] In the present invention, the term "effective amount" refers to the amount of a therapeutic agent to treat, alleviate or prevent a target disease or condition, or to an amount that exhibits a detectable therapeutic or preventive effect. The exact effective amount for a subject depends on the subject's size and health, the nature and extent of the condition, and the therapeutic agent and / or combination of therapeutic agents selected for administration. Therefore, it is useless to specify an exact effective amount in advance. However, for a given condition, the effective amount can be determined by routine experimentation, which a clinician is able to judge.

[0084] As used herein, the term "pharmaceutically acceptable salt" refers to a salt formed between a compound of the present invention and a base that is suitable for use as a pharmaceutical.

[0085] Unless otherwise specified, in the present invention, all compounds appearing are intended to include all possible optical isomers, such as single chiral compounds, or mixtures of various chiral compounds (i.e., racemates). Among all compounds of the present invention, each chiral carbon atom can be optionally in R configuration or S configuration, or a mixture of R configuration and S configuration.

[0086] Some compounds of the present invention may be crystallized or recrystallized with water or various organic solvents, in which case various solvates may be formed. The solvates of the present invention include stoichiometric solvates such as hydrates, and also include compounds containing variable amounts of water formed when prepared by low-pressure sublimation drying.

[0087] The present invention provides methods, compounds and compositions for regulating the expression of HBV DNA / RNA and HBsAg and HBeAg. In an embodiment, the compound suitable for regulating the expression of HBV DNA / RNA and HBsAg and HBeAg is an antisense oligonucleotide.

[0088] In certain embodiments, the regulation can be performed in cells. In certain embodiments, the regulation is performed in animals. In certain embodiments, the animals are humans. In certain embodiments, HBV RNA levels are reduced. In certain embodiments, HBV-DNA levels are reduced. In certain embodiments, HBsAg levels are reduced. In certain embodiments, HBeAg levels are reduced. The reduction occurs in a dose- and time-dependent manner.

[0089] Also provided are methods, compounds and compositions suitable for preventing, treating and ameliorating diseases, disorders and conditions. In certain embodiments, the HBV-related diseases, disorders and conditions are acute or chronic liver diseases. In certain embodiments, the liver diseases, disorders and conditions include hepatitis B, hepatitis D, liver fibrosis, cirrhosis, hepatocellular carcinoma (HCC), etc.

[0090] In certain embodiments, the method of treatment comprises administering an HBV antisense oligonucleotide to an individual in need thereof by intravenous or subcutaneous injection.

[0091] Oligonucleotides (Antisense Oligonucleotides)

[0092] The present invention unexpectedly discovered oligonucleotides (or antisense oligonucleotides) that can inhibit the expression of viral proteins such as hepatitis B virus DNA / RNA and hepatitis B virus (HBV) surface antigen (HBsAg) and e antigen (HBeAg). Typically, the antisense oligonucleotides provided by the present invention can complement a pan-genotype conserved sequence of the hepatitis B virus genome. For example, the antisense oligonucleotides provided by the present invention can complement a pan-genotype conserved sequence such as SEQ ID NO.6 in the hepatitis B virus genome (genotype D) as shown in SEQ ID NO.1, or a sequence having more than 96% or more than 98% homology with the sequence.

[0093]

[0094]

[0095] Preferably, the sequence of the oligonucleotide of the present invention is as shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, more preferably, as shown in SEQ ID NO.2.

[0096] In another preferred example, the oligonucleotide is complementary to at least a portion of the fragment in SEQ ID NO.6.

[0097] In another preferred embodiment, the oligonucleotide is complementary to at least a portion of SEQ ID NO.6 and at least a portion of SEQ ID NO.1.

[0098] In another preferred embodiment, the oligonucleotide is at least 96% complementary to SEQ ID NO.6.

[0099] Double-Gap modified oligonucleotides

[0100] The present invention also provides modified antisense oligonucleotides. The preferred antisense oligonucleotides provided by the present invention are modified by double-Gap design, i.e., the ribose of the 5' and 3' terminal nucleotides of the oligonucleotide is modified, which improves the affinity with the target RNA, enhances the efficacy, can reduce the effective dose, and increases the safety window; at the same time, the ribose modification at both ends further improves the stability of the oligonucleotide. The more preferred modified antisense oligonucleotides provided by the present invention are thiophosphate-modified oligonucleotides, wherein the thiophosphate modification improves the stability of the oligonucleotide in vivo, enhances plasma protein binding, and facilitates the distribution of the oligonucleotide to target tissues such as the liver. The most preferred antisense oligonucleotides provided by the present invention are double Gap antisense oligonucleotides, which are modified at the 5' and 3' ends of the oligonucleotide and in the middle of the sequence, and the bases of the cytosine nucleotides in the CpG sequence (i.e., cytosine (C)-phosphate (p)-guanine (G)) are modified, thereby further improving the affinity of the oligonucleotide and reducing the off-target toxicity caused by its activation of the innate immune Toll-like receptor.

[0101] In a specific embodiment, a compound, or a pharmaceutically acceptable salt, hydrate or solvate thereof is provided, wherein the compound is a modified or unmodified oligonucleotide, and the length of the oligonucleotide is 14 to 26 nt (e.g., 16 to 24 nt, preferably, 18 to 22 nt, most preferably, 20 nt); and the oligonucleotide has the structural characteristics of formula I

[0102] P1-S1-P2-S2-P3 Formula I

[0103] In the formula, P1, P2 and P3 are one or more modified nucleotides, S1 and S2 are deoxyribonucleosides, the spacer region represented by S1 is Gap1, and the spacer region represented by S2 is Gap2.

[0104] Wherein, the modification is one or more modifications selected from the following group:

[0105] (i) modification of nucleosides; the modification of nucleosides includes 2'-O-methylated sugar modification, 2'-O-methoxyethylated sugar modification, and / or methylation modification of position 5 of cytosine;

[0106] (ii) modification of internucleoside bonds; the modification of internucleoside bonds is that part or all of the internucleoside bonds in the oligonucleotide are replaced by phosphorothioate internucleoside bonds and / or phosphorodithioate internucleoside bonds.

[0107] In another preferred embodiment, each nucleoside in P1, P2 and P3 is a modified nucleoside (preferably, the modified nucleoside comprises a modified sugar and a modified or unmodified base);

[0108] Each nucleoside in S1 and S2 is an unmodified nucleoside or a sugar in an unmodified nucleoside;

[0109] Each nucleoside portion of the oligonucleotide is independently linked via a phosphodiester bond or a phosphorothioate bond (preferably, both are linked via a phosphorothioate bond).

[0110] In another preferred embodiment, the internucleoside bonds in the modified oligonucleotide are at least partially modified internucleoside bonds (ie, phosphorothioate internucleoside bonds).

[0111] In another preferred embodiment, all the internucleoside bonds in the modified oligonucleotide are modified internucleoside bonds (ie, phosphorothioate internucleoside bonds).

[0112] In another preferred embodiment, the P1 corresponds to a region of 2-6 nt at the 5' end where the modification exists.

[0113] In another preferred embodiment, the S1 corresponds to L1 consecutive nucleotides without nucleoside modification in the spacer region Gap1, wherein L1 is a positive integer of 3-7, preferably 4, 5 or 6, and more preferably 5 or 6.

[0114] In another preferred example, the P2 corresponds to a region of 2-5 nt where the modification occurs.

[0115] In another preferred embodiment, S2 corresponds to L2 consecutive nucleotides without nucleoside modification in the spacer region Gap2, wherein L1 is a positive integer of 3-7, preferably 4, 5 or 6, and more preferably 5 or 6.

[0116] In another preferred embodiment, the P3 corresponds to a region of 2-6 nt at the 3' end.

[0117] In another preferred embodiment, P1 is 3, 4 or 5 nt in length, S1 is 4, 5 or 6 nt in length, P2 is 2, 3 or 4 nt in length, S2 is 4, 5 or 6 nt in length, and / or P3 is 3, 4 or 5 nt in length.

[0118] In another preferred embodiment, in P1, P2 and P3, the modified nucleosides are each independently sugar-modified nucleosides, or sugar-modified nucleosides and base-modified nucleosides.

[0119] In another preferred embodiment, the sugar-modified nucleoside refers to a nucleoside whose sugar group contains a 2'-O-methyl group or a 2'-O-methoxyethyl group.

[0120] In another preferred embodiment, the nucleoside in which both the sugar group and the base are modified refers to a nucleoside in which the sugar group contains a 2'-O-methyl group or a 2'-O-methoxyethyl group and the base is 5-methylcytosine.

[0121] In another preferred embodiment, in P1, P2 and P3, the modified nucleosides are each independently a sugar-modified nucleoside, or a nucleoside moiety in which both the sugar and the base are modified when the base is cytosine;

[0122] The sugar-modified nucleoside refers to a nucleoside whose sugar contains a 2'-O-methyl group or a 2'-O-methoxyethyl group, and the sugar-and-base-modified nucleoside refers to a nucleoside whose sugar contains a 2'-O-methyl group or a 2'-O-methoxyethyl group and whose base is 5-methylcytosine.

[0123] In another specific embodiment, the present invention provides an oligonucleotide, or an optical isomer, a pharmaceutically acceptable salt, a hydrate, or a solvate thereof, wherein the antisense oligonucleotide sequence is selected from: SEQ ID NO.2-5, and wherein one or more Ts may be optionally replaced by U.

[0124] SEQ ID NO.2 GCAGAGGTGAAGCGAAGTGC SEQ ID NO.3 GTGCAGAGGTGAAGCGAAGT SEQ ID NO.4 AGAGGTGAAGCGAAGTGCAC SEQ ID NO.5 GTGAAGCGAAGTGCACACGG

[0125] In another preferred embodiment, the modified oligonucleotide is PA0088, the sequence of which is SEQ ID No. 2, and the sugar modification and base modification are: 5'-Gmoe* 5Me Cmoe*Amoe*Gmoe*dA*dG*dG*dT*dG*Amoe*dA*dG* 5Me dC*dG*dA*dA*Gmoe*Tmoe*Gmoe* 5Me Cmoe-3', where *: phosphorothioate; Amoe, Gmoe, 5MeCmoe, Tmoe: 2'-O-methoxyethyl-modified monomers; dA, dG, 5Me dC, dT: natural DNA monomers; 5Me : Methyl modification at position 5 of the base.

[0126] In another preferred embodiment, the modified oligonucleotide is PA0089, the sequence of which is SEQ ID No. 2, and the sugar modification and base modification are: 5'-Gmoe* 5Me Cmoe*Amoe*dG*dA*dG*dG*dT*dG*Amoe*dA*dG* 5Me dC*dG*dA*dA*dG*Tmoe*Gmoe* 5Me Cmoe-3', where *: phosphorothioate; Amoe, Gmoe, 5Me Cmoe, Tmoe: 2'-O-methoxyethyl-modified monomers; dA, dG, 5Me dC, dT: natural DNA monomers; 5Me : Methyl modification at position 5 of the base.

[0127] Preparation of antisense oligonucleotides

[0128] The antisense oligonucleotides of the present invention can be prepared and synthesized using conventional synthesis methods in the oligonucleic acid industry. For example, phosphorothioate bonds can be synthesized using standard phosphoramidite chemical synthesis methods on equipment such as GE OP100, and 1,2-benzodithiol-3-one-1,1-dioxide is used instead of iodine as an oxidizing agent.

[0129] Pharmaceutical compositions and methods of administration

[0130] Since the compounds of the present invention (or modified or unmodified oligonucleotides of the present invention) have excellent ability to inhibit hepatitis B virus DNA replication, the compounds of the present invention and isomers (such as optical isomers), crystal forms, solvates, pharmaceutically acceptable inorganics, and pharmaceutical compositions containing the compounds of the present invention as main active ingredients can be used to treat, prevent and alleviate diseases related to or caused by hepatitis B virus (i.e., hepatitis B virus) infection or diseases related to or caused by co-infection of hepatitis B virus and hepatitis D virus. These diseases can be acute or chronic. According to the prior art, the compounds of the present invention can be used to treat the following diseases: hepatitis B; pancreatic cancer, cirrhosis and hepatocellular carcinoma (such as pancreatic cancer, cirrhosis and hepatocellular carcinoma caused by chronic hepatitis B).

[0131] The pharmaceutical composition provided by the present invention comprises a safe and effective amount of the compound of the present invention or other pharmacologically acceptable forms thereof (such as optical isomers, pharmaceutically acceptable salts, hydrates or solvates thereof), and a pharmaceutically acceptable adjuvant, diluent or carrier. Wherein "safe and effective amount" means: the amount of the compound is sufficient to significantly improve the condition without causing serious side effects. Usually, the pharmaceutical composition contains 1-2000 mg of the compound of the present invention / dose, and more preferably, contains 10-500 mg of the compound of the present invention / dose. Preferably, the "one dose" is an ampoule or a vial.

[0132] "Pharmaceutically acceptable carrier" refers to: one or more compatible solid or liquid fillers or gel substances, which are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here means that the components in the composition can be mixed with the compounds of the present invention and with each other without significantly reducing the efficacy of the compounds. Some examples of pharmaceutically acceptable carriers include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (such as ), wetting agents (such as sodium lauryl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0133] Application method

[0134] The compounds of the present invention and compositions containing them can be administered by any suitable means, for example, oral ingestion; oral inhalation; subcutaneous, intravenous injection or infusion. The compounds of the present invention or compositions containing them can be administered in the form of dosage unit preparations containing non-toxic pharmaceutically acceptable carriers or diluents; or can be administered in the form of immediate release or sustained release preparations.

[0135] The dosage regimen for the antisense oligonucleotides of the present invention is effective for human administration; follow the dosage regimen commonly used for other antisense oligonucleotides; the routine use of weekly parenteral administration of 100-500 mg of the compound is well established in the art.

[0136] In light of the disclosure presented herein, it is useful to treat subjects having HBV infection or HBV / HDV co-infection using pharmaceutically acceptable antisense oligonucleotide formulations.

[0137] The main advantages of the present invention include:

[0138] (a) The double-Gap modified compounds or oligonucleotides of the present invention have significantly improved antiviral ability compared to unmodified or non-double-Gap modified oligonucleotides

[0139] (b) The compounds or oligonucleotides provided by the present invention can effectively inhibit viral gene products at the transcription level in vitro, thereby significantly inhibiting hepatitis B virus antigens (such as HBsAg).

[0140] (c) The modified oligonucleotides provided by the present invention have the ability to inhibit hepatitis B virus antigens (such as HBsAg) comparable to or even significantly superior to that of unmodified oligonucleotides while improving their in vivo stability through modification.

[0141] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0142] It should be understood that those skilled in the art can obtain the oligonucleotides used in the examples according to the sequences and corresponding modifications described in the examples, according to conventional techniques in the prior art (such as standard solid phase synthesis methods) and using raw materials that are commercially available or synthesized according to prior art methods (such as modified or unmodified nucleosides).

[0143] Example 1 Antiviral effects of antisense oligonucleotides with different Gap modification patterns in HepG2.2.15 cell lines

[0144] HepG2.2.1.5 cell line stably expresses and replicates HBV virus and secretes HBV virus particles, HBsAg and HBeAg into the cell supernatant. HepG2.2.1.5 cells were cultured in DMEM:F12 medium (Hyclone) containing 10% FBS (ExCell Bio) and 400 μg / ml G418 and could be used after three generations.

[0145] On day 0, siRNA was diluted with PBS to 2 concentrations (final concentration 1nM and 10nM). HepG2.2.15 cells were taken, washed with DPBS, and digested with trypsin. 10% FBSDMEM: F12| medium (without G418) was used to adjust the cells to a suitable density. At the same time, Lipofectamine RNAiMax was used to transfect siRNA into HepG2.2.15 cells, and the cells were inoculated into 96-well plates at a density of 225,00 cells per well, with 135μl of culture medium per well. The cells were cultured in a 5% CO2, 37°C incubator for 3 days. The collected cell supernatant was tested for HBsAg by ELISA. At the same time, CellTiter-Glo was used to detect cell viability.

[0146] ELISA is briefly described as follows: Take 50μl of sample and standard and add them to the reaction plate respectively, then add 50μl of enzyme conjugate to each well, shake and mix, incubate at 37℃ for 60 minutes, then wash the plate 5 times with washing solution, then add 50μl of luminescent substrate to each well, mix, react at room temperature in the dark for 10 minutes, and finally detect the chemiluminescence intensity with an enzyme reader.

[0147] CellTiter-Glo is briefly described as follows: 100 μl CTG was added to each well and reacted for 10 min in the dark. The chemiluminescence intensity was detected by an ELISA reader.

[0148] The antisense oligonucleotides used are shown in Table 1.

[0149] Table 1 Description of oligonucleotides used in Example 1

[0150]

[0151]

[0152] A / T / G / C represent conventional unmodified deoxyribonucleotide residues; A / T / G / C represents a 2'-O-methyl modified nucleoside base; and the internucleoside bonds of each oligonucleotide are phosphorothioate internucleoside bonds.

[0153] The relative inhibition rate of transfected antisense oligonucleotide on the expression and secretion of HBsAg by HepG2.2.1.5 was calculated as follows:

[0154] Relative inhibition rate = 100% * [1-(HBsAg concentration in treatment group / HBsAg concentration in blank group)]

[0155] The relative inhibition rates of each antisense oligonucleotide treatment group are shown in Table 2

[0156] Table 2 Relative inhibition rate of oligonucleotides in Example 1 on the expression and secretion of HBsAg by HepG2.2.1.5

[0157]

[0158] From Table 2 and Figure 1 It can be seen that compared with the antisense oligonucleotide PA0087 with a single-Gap modification pattern, the addition of double-Gap modification helps to improve the relative inhibition rate of HBsAg. The combined results of the two experiments showed that the weighted average of PA0075, PA0077, PA0079 and PA0081 was significantly better than the antisense oligonucleotide with a single-Gap modification pattern.

[0159] Example 2 Antiviral effects of antisense oligonucleotides with different Gap modification patterns in HepG2.2.15 cell lines

[0160] HepG2.2.1.5 cell line stably expresses and replicates HBV virus and secretes HBV virus particles, HBsAg and HBeAg into the cell supernatant. HepG2.2.1.5 cells were cultured in DMEM:F12 medium (Hyclone) containing 10% FBS (ExCell Bio) and 400 μg / ml G418 and could be used after three generations.

[0161] On day 0, siRNA was diluted with PBS to 2 concentrations (final concentration 10nM and 30nM). HepG2.2.15 cells were taken, washed with DPBS, and digested with trypsin. 10% FBSDMEM: F12| medium (without G418) was used to adjust the cells to a suitable density. At the same time, Lipofectamine RNAiMax was used to transfect siRNA into HepG2.2.15 cells, and the cells were inoculated into 96-well plates at a density of 225,00 cells per well, with 135μl of culture medium per well. The cells were cultured in a 5% CO2, 37°C incubator for 3 days. The collected cell supernatant was tested for HBsAg by ELISA. At the same time, CellTiter-Glo was used to detect cell viability.

[0162] ELISA is briefly described as follows: Take 50μl of sample and standard and add them to the reaction plate respectively, then add 50μl of enzyme conjugate to each well, shake and mix, incubate at 37℃ for 60 minutes, then wash the plate 5 times with washing solution, then add 50μl of luminescent substrate to each well, mix, react at room temperature in the dark for 10 minutes, and finally detect the chemiluminescence intensity with an enzyme reader.

[0163] CellTiter-Glo is briefly described as follows: 100 μl CTG was added to each well and reacted for 10 min in the dark. The chemiluminescence intensity was detected by an ELISA reader.

[0164] The antisense oligonucleotides used are shown in Table 3.

[0165] Table 3 Description of oligonucleotides used in Example 2

[0166]

[0167]

[0168] A / T / G represent conventional unmodified deoxyribonucleotide residues and C represents 5-methyl modified deoxyribonucleotide residues; A / T / G / C represents a 2'-O-methoxyethyl modified nucleotide base; and the internucleoside bonds of each oligonucleotide are phosphorothioate internucleoside bonds.

[0169] The relative inhibition rate of transfected antisense oligonucleotide on the expression and secretion of HBsAg by HepG2.2.1.5 was calculated as follows:

[0170] Relative inhibition rate = 100% * [1-(HBsAg concentration in treatment group / HBsAg concentration in blank group)]

[0171] The relative inhibition rates of each antisense oligonucleotide treatment group are shown in Table 4

[0172] Table 4 Relative inhibition rate of oligonucleotides in Example 2 on the expression and secretion of HBsAg by HepG2.2.1.5

[0173]

[0174]

[0175] From Table 4 and Figure 2 It can be seen that compared with the antisense oligonucleotide Bepirovirsen with a single-Gap modification mode, which is currently in clinical phase III, the antisense oligonucleotide with a double-Gap modification helps to improve the relative inhibition rate of HBsAg. The combined results of the two experiments showed that the weighted average of PA0088 and PA0089 was significantly better than the antisense oligonucleotide with a single-Gap modification mode.

[0176] Example 3 Antiviral EC of antisense oligonucleotides with different Gap modification patterns in HepG2.2.15 cell line 50 value

[0177] HepG2.2.1.5 cell line stably expresses and replicates HBV virus and secretes HBV virus particles, HBsAg and HBeAg into the cell supernatant. HepG2.2.1.5 cells were cultured in DMEM:F12 medium (Hyclone) containing 10% FBS (ExCell Bio) and 400 μg / ml G418 and could be used after three generations.

[0178] On day 0, siRNA was gradiently diluted with PBS to concentrations of 100 nM, 33.33 nM, 11.11 nM, 3.70 nM, 1.23 nM, 0.41 nM, 0.14 nM and 0.05 nM (Note: GSK-3228836 compound concentrations are: 40 nM, 13.33 nM, 4.44 nM, 1.48 nM, 0.49 nM, 0.16 nM, 0.05 nM and 0.02 nM). HepG2.2.15 cells were washed with DPBS, and then digested with trypsin. The cells were adjusted to a suitable density with 10% FBSDMEM:F12| medium (without G418). At the same time, Lipofectamine RNAiMax was used to transfect siRNA into HepG2.2.15 cells. The cells were inoculated into 96-well plates at a density of 225,00 cells per well, and the culture medium per well was 135μl. The cells were placed in a 5% CO2, 37°C incubator and cultured for 3 days. The collected cell supernatant was tested for HBsAg by ELISA. At the same time, CellTiter-Glo was used to detect cell viability.

[0179] ELISA is briefly described as follows: Take 50μl of sample and standard and add them to the reaction plate respectively, then add 50μl of enzyme conjugate to each well, shake and mix, incubate at 37℃ for 60 minutes, then wash the plate 5 times with washing solution, then add 50μl of luminescent substrate to each well, mix, react at room temperature in the dark for 10 minutes, and finally detect the chemiluminescence intensity with an enzyme reader.

[0180] CellTiter-Glo is briefly described as follows: 100 μl CTG was added to each well and reacted for 10 min in the dark. The chemiluminescence intensity was detected by an ELISA reader.

[0181] The antisense oligonucleotides used are shown in Table 5.

[0182] Table 5 Description of oligonucleotides used in Example 3

[0183]

[0184] A / T / G represent conventional unmodified deoxyribonucleotide residues and C represents 5-methyl modified deoxyribonucleotide residues; A / T / G / C represents a 2'-O-methoxyethyl modified nucleotide base; and the internucleoside bonds of each oligonucleotide are phosphorothioate internucleoside bonds.

[0185] The relative inhibition rate of transfected antisense oligonucleotide on the expression and secretion of HBsAg by HepG2.2.1.5 was calculated as follows:

[0186] Relative inhibition rate = 100% * [1-(HBsAg concentration in treatment group / HBsAg concentration in blank group)]

[0187] The relative inhibition rates of each antisense oligonucleotide treatment group are shown in Table 6

[0188] Table 6 Relative inhibition rate and cell viability of the oligonucleotides in Example 3 on the expression and secretion of HBsAg by HepG2.2.1.5

[0189]

[0190] From Table 6 and Figure 3 It can be seen that the double-Gap modified compounds are helpful to improve the relative inhibition rate of HBsAg. The combined results of the two experiments showed that the weighted average of PA0088 and PA0089 was significantly better than the antisense oligonucleotides with a single Gap modification pattern. 50 They are 10.5 times and 9.6 times that of the control Bepirovirsen (i.e. GSK-3228836), respectively.

[0191] Example 4 Antiviral effects of double-gap antisense oligonucleotides PA0088, PA0089 and Bepirovirsen in AAV-HBV mouse model

[0192] The dose-dependency of the antiviral activity of antisense oligonucleotide PA0020 was evaluated by increasing the dose of antisense oligonucleotide PA0020 in c57 mice infected with adeno-associated virus carrying HBV 1.3 fold (AAV-HBV, Acanthopanax spp.) and continuously replicating HBV-DNA and expressing HBV antigens. The oligonucleotide PA0020 used is shown in Table 7.

[0193] Oligonucleotides SEQ ID Oligonucleotide modification PA0088 SEQ ID NO.2 GCAGAGGTGAAGCGAAGTGC PA0089 SEQ ID NO.2 GCAGAGGTGAAGCGAAGTGC Bepirovirsen SEQ ID NO.2 GCAGAGGTGAAGCGAAGTGC

[0194] Use 5X10 10rAAV8-1.3HBV (Acanthopanax acutiloba) was injected into male C57BL / 6 mice through the tail vein to prepare a mouse model of persistent hepatitis B infection. After confirming the stable replication of HBV virus, the mice were randomly divided into 4 groups (5 mice in each group) according to body weight. The first group was the control group (Vehicle) and was gavaged with normal saline every day. The second to fourth groups were intraperitoneally injected with Bepirovirsen, PA0088 and PA0089, respectively. The frequency of administration was once a week, and the dosages were: 30 mg / kg, 60 mg / kg, 60 mg / kg, 90 mg / kg*5. Blood was collected 1-2 times a week, and the hepatitis B virus nucleic acid (HBV-DNA) load in the serum was analyzed by qPCR method, and the HBsAg and HBeAg concentrations in the serum were analyzed by ELISA method, and the curves were drawn. Figure 4 .

[0195] Test results, such as Figure 4 As shown, HBsAg and HBV-DNA in the serum of animals in the control group showed a stable fluctuation; HBV-DNA in the serum of animals in the Bepirovirsen, PA0088 and PA0089 groups continued to decrease, and the decrease at the end of administration was >3log compared with day 0. 10 , which was reduced by >99.9%. HBsAg and HBeAg in the serum of animals in the Bepirovirsen, PA0088 and PA0089 groups also continued to decrease, with a decrease of >2log compared with day 0 at the end of administration. 10 , PA0088 has a slightly greater reduction than the control drug Bepirovirsen. Therefore, PA0088 and PA0089 can not only reduce HBV-DNA, but also reduce surface antigen. In the future, clinically, it is hoped that they can achieve the goal of functional cure of hepatitis B. In addition, Figure 5 As shown, the body weight of animals in all groups has been increasing. The body weight of the control group Bepirovirsen did not continue to increase after 42 days of administration, while the body weight of PA0088 and PA0089 increased more, indicating that PA0088 and PA0089 are safer than Bepirovirsen.

[0196] In particular, the cytosine bases of the CpG sequence were further methylated, i.e., 2'-O-methoxyethylated-5-methylcytosine was used to replace cytosine to reduce its possibility of activating Toll-like receptors (TLRs), especially TLR9, thereby reducing its risk of immune off-target toxicity.

[0197] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A compound, or a pharmaceutically acceptable salt thereof, characterized in that: The compound is selected from the following table In the above table, A / T / G represent conventional unmodified deoxyribonucleotide residues and C represents 5-methyl modified deoxyribonucleotide residues; A / T / G / C represents a 2'-O-methoxyethyl modified nucleotide base; and the internucleoside bonds of each oligonucleotide are phosphorothioate internucleoside bonds.

2. The compound according to claim 1, characterized in that The compound is selected from the following group: PA0088, PA0089, PA0090, PA0091, PA0093 and PA0094.

3. The compound according to claim 1, characterized in that The compound is selected from the following group: PA0089, PA0090, PA0091, PA0093, and PA0094.

4. The compound according to claim 1, characterized in that The compound is selected from the following group: PA0089, PA0093, and PA0094.

5. The compound according to claim 1, characterized in that The compound is selected from the following group: PA0089 and PA0093.

6. A pharmaceutical composition, comprising the compound according to any one of claims 1 to 5, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

7. Use of a compound according to any one of claims 1 to 5, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition according to claim 6 in the preparation of a medicament for treating a disease associated with hepatitis B virus or hepatitis D virus.

8. The use according to claim 7, characterized in that The disease includes hepatitis B virus, hepatitis D virus, liver fibrosis, liver cirrhosis, hepatocellular carcinoma (HCC), or a combination thereof.

9. An in vitro non-therapeutic method for regulating HBV DNA / RNA, HBsAg and / or HBeAg expression, the method comprising the step of contacting a subject with a compound as described in any one of claims 1 to 5, or a pharmaceutically acceptable salt thereof, thereby regulating HBV DNA / RNA, HBsAg and / or HBeAg expression.

10. The method according to claim 9, characterized in that The object is a cell.

Images