TaTPR-b1 gene, encoded protein and application thereof in breeding of different spike type wheat

By regulating the TaTPR-B1 gene using CRISPR/Cas9 technology and constructing CRISPR/Cas9 knockout or overexpression vectors, the problem of improving wheat spike morphology was solved, and wheat varieties with different spike types and high yields and disease resistance were bred.

CN118667834BActive Publication Date: 2026-02-13CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410807679.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-21
Publication Date
2026-02-13
Estimated Expiration
2044-06-21

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively regulate wheat ear morphology to improve yield and disease resistance, especially in terms of insufficient improvement in ear length and spikelet density.

Method used

By knocking out or overexpressing the TaTPR-B1 gene using CRISPR/Cas9 technology, and then transforming wheat using Agrobacterium-mediated transformation, CRISPR/Cas9 knockout or overexpression vectors were constructed to regulate wheat spike length and spikelet density.

Benefits of technology

Significant regulation of spike length and spikelet density was achieved, resulting in the breeding of wheat varieties with different spike types, which improved wheat yield and quality and enhanced disease resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118667834B_ABST
    Figure CN118667834B_ABST
Patent Text Reader

Abstract

The present application relates to TaTPR-B1 gene, coding protein and its application in different spike type wheat breeding, and the present application is characterized in that: by utilizing genetic engineering technology, the expression of TaTPR-B1 gene is inhibited, so that the wheat variety with long spike and small spike density is cultivated; in addition, the expression of TaTPR-B1 gene can be overexpressed through genetic engineering technology, so that the wheat variety with long spike and small spike density is cultivated, and a new molecular breeding method for improving the yield and quality of wheat is provided.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of wheat breeding technology, and relates to the TaTPR-B1 gene, its encoded protein, and its application in breeding different spike types of wheat. Background Technology

[0002] Improvements in spike morphology traits, including spike length and spikelet density, have a direct or indirect effect on wheat yield. Furthermore, abiotic stresses such as various diseases are significant threats to wheat yield; regulating spike morphology can serve as a supplementary means to enhance wheat disease resistance, such as resistance to Fusarium head blight. Therefore, marker-assisted selection breeding can rapidly regulate spike morphology and efficiently breed ideal spike types. Summary of the Invention

[0003] In view of this, the purpose of this invention is to provide the TaTPR-B1 gene, its encoded protein, and its application in breeding different spike types of wheat.

[0004] To achieve the above objectives, the present invention provides the following technical solution:

[0005] 1. The TaTPR-B1 gene, whose nucleotide sequence is shown in SEQ ID NO.1.

[0006] 2. The protein encoded by the TaTPR-B1 gene has the amino acid sequence shown in SEQ ID NO.2.

[0007] 3. Application of TaTPR-B1 gene knockout or overexpression in breeding different spike types of wheat.

[0008] As one of the preferred technical solutions, different ear types are selected from:

[0009] (a) Reduce spikelet length and increase spikelet density;

[0010] (b) Increase spike length and reduce spikelet density.

[0011] 4. Application of inhibiting or enhancing the expression of the aforementioned encoded proteins in breeding different spike types of wheat.

[0012] As one of the preferred technical solutions, different ear types are selected from:

[0013] (a) Reduce spikelet length and increase spikelet density;

[0014] (b) Increase spike length and reduce spikelet density.

[0015] 5. Application of gRNA for knocking out or overexpressing the TaTPR-B1 gene in breeding different spike types of wheat.

[0016] As one of the preferred technical solutions, different ear types are selected from:

[0017] (a) Reduce spikelet length and increase spikelet density;

[0018] (b) Increase spike length and reduce spikelet density.

[0019] 6. Application of the aforementioned inhibitors or promoters of protein expression in breeding different spike types of wheat.

[0020] As one of the preferred technical solutions, different ear types are selected from:

[0021] (a) Reduce spikelet length and increase spikelet density;

[0022] (b) Increase spike length and reduce spikelet density.

[0023] 7. A breeding method for reducing spikelet length and increasing spikelet density, the specific steps of which are as follows:

[0024] (1) Construct a CRISPR / Cas9 knockout expression vector for the TaTPR-B1 gene;

[0025] (2) Wheat was transformed using CRISPR / Cas9 knockout expression vector via Agrobacterium-mediated transformation to obtain transgenic wheat plants.

[0026] As one of the preferred technical solutions, the specific method of step (1) is as follows:

[0027] (1-1) Design target primers specific to the TaTPR-B1 gene for knocking out the TaTPR-B1 gene;

[0028] (1-2) Link the target primer to the wheat U6 promoter to form an sgRNA expression cassette: This promoter drives the expression of the CRISPR / Cas9 system, ensuring the correct guidance of the primer;

[0029] (1-3) Prepare pBUE-414 plasmid: a plasmid suitable for the CRISPR / Cas9 system, which includes Cas9 protein and corresponding RNA components;

[0030] (1-4) Restriction endonuclease digestion: The sgRNA expression cassette and pBUE-414 plasmid were digested with restriction endonucleases respectively so that they could be ligated together;

[0031] (1-5) Ligation: The enzyme-digested sgRNA expression cassette is ligated to the pBUE-414 plasmid to form a CRISPR / Cas9 knockout expression vector.

[0032] (1-6) Colony PCR detection: PCR detection was performed to ensure that the sgRNA expression cassette was successfully ligated to the pBUE-414 plasmid;

[0033] (1-7) Sequencing analysis of sgRNA sequence: Sequencing analysis of sgRNA sequence in CRISPR / Cas9 vector was performed to confirm its correctness and pairing with TaTPR-B1 gene.

[0034] As a further preferred technical solution, in step (1-1), the target primer sequence is as follows:

[0035] CCGCTAACTACGCCGACAGCGG, as shown in SEQ ID NO.3;

[0036] GGGAAGTCCAGGCGCGAGTAGG, as shown in SEQ ID NO.4.

[0037] As one of the preferred technical solutions, step (2) specifically includes: induction, subculture, pre-culture, co-culture, resistance screening, differentiation, rooting culture, hardening, and transplanting.

[0038] 8. A breeding method for increasing spikelet length and reducing spikelet density, the specific steps of which are as follows:

[0039] (1) Construct an overexpression vector for the TaTPR-B1 gene;

[0040] (2) Wheat was transformed using an overexpression vector via Agrobacterium-mediated transformation to obtain transgenic wheat plants.

[0041] As one of the preferred technical solutions, the specific method of step (1) is as follows:

[0042] (1-1) Specific amplification of the CDS sequence of the TaTPR-B1 gene: used for overexpression of the TaTPR-B1 gene;

[0043] (1-2) Prepare pWMB-110 plasmid: a plasmid suitable for wheat overexpression systems, which includes the Ubi promoter;

[0044] (1-3) Restriction endonuclease digestion: The pWMB-110 plasmid was digested with restriction endonuclease in order to be ligated with the TaTPR-B1 gene CDS sequence with the same sticky ends.

[0045] (1-4) Ligation: The CDS sequence of the TaTPR-B1 gene is ligated with the enzyme-digested pWMB-110 plasmid to form the TaTPR-B1 overexpression vector.

[0046] (1-5) Colony PCR detection: PCR detection was performed to ensure that the CDS sequence of the TaTPR-B1 gene was successfully ligated to the pWMB-110 plasmid.

[0047] (1-6) Sequencing analysis of the TaTPR-B1 gene CDS sequence: The TaTPR-B1 gene CDS sequence in the pWMB-110 vector was sequenced to confirm its correctness and pairing with the TaTPR-B1 gene.

[0048] As one of the preferred technical solutions, step (2) specifically includes: induction, subculture, pre-culture, co-culture, resistance screening, differentiation, rooting culture, hardening, and transplanting.

[0049] The beneficial effects of this invention are as follows:

[0050] This invention relates to the TaTPR-B1 gene (TraesCS6B03G1214400), its encoded protein, and its application in breeding wheat with different spikelet types. This invention utilizes genetic engineering technology to suppress the expression of the TaTPR-B1 gene, thereby breeding wheat varieties with short spikelets and high spikelet density. Furthermore, it also utilizes genetic engineering technology to overexpress the TaTPR-B1 gene, thereby breeding wheat varieties with long spikelets and low spikelet density, providing a new molecular breeding method for improving wheat yield and quality.

[0051] Experimental results showed that, compared to the wild type, TaTPR-B1 knockout significantly reduced spike length and increased spikelet density in knockout lines; TaTPR-B1 overexpression significantly increased spike length and decreased spikelet density in overexpressing lines. This indicates that the TaTPR-B1 protein has the potential to regulate wheat spike length and spikelet density, and can be applied to research on wheat spike type improvement. This invention aims to breed wheat varieties with different spike lengths and spikelet densities, which is expected to play a role in improving wheat yield and quality, and has potential value in wheat spike type improvement.

[0052] This invention utilizes two transgenic technologies to knock out and overexpress the TaTPR-B1 gene in wheat, respectively, to cultivate wheat varieties with different spikelet types. Specifically, firstly, a CRISPR / Cas9 knockout expression vector for the TaTPR-B1 gene is constructed, including sgRNA target primer pairs and the U6 promoter; secondly, an overexpression vector for the TaTPR-B1 gene is constructed, including the TaTPR-B1 gene CDS sequence and the Ubi promoter. The construction of both vectors includes restriction endonuclease digestion, ligation, colony PCR detection, sequencing analysis, and transformation.

[0053] This invention introduces the constructed CRISPR / Cas9 knockout expression vector and overexpression vector of the TaTPR-B1 gene into wheat materials CB037 and Fielder, respectively, via Agrobacterium-mediated transformation, enabling them to carry the CRISPR / Cas9 knockout system and overexpression system, respectively. During subsequent generational segregation, various molecular biology techniques, including PCR, qRT-PCR, and sequencing analysis, are used to identify and analyze the transgenic wheat plants. These techniques determine whether homozygous mutant plants of the TaTPR-B1 gene and TaTPR-B1 gene overexpression plants have been obtained.

[0054] Transgenic wheat plants were planted simultaneously with wild-type wheat in the field. After the plants matured, the spike length and spikelet density were compared and analyzed to identify knockout plants with reduced spike length and increased spikelet density of the TaTPR-B1 gene, as well as overexpression plants with increased spike length and reduced spikelet density of the TaTPR-B1 gene. Attached Figure Description

[0055] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the following figures are provided for illustration:

[0056] Figure 1 The target sites for TaTPR-B1 gene knockout and the editing types of mutant plants.

[0057] Figure 2 Phenotypic results of spikelet length and spikelet density in TaTPR-B1 gene knockout mutant plants and wild-type CB037.

[0058] Figure 3 Statistics on spike length and spikelet density of TaTPR-B1 gene knockout mutant plants and wild-type CB037, where A represents spike length and B represents spikelet density.

[0059] Figure 4 Phenotypic characteristics of spikelet length and spikelet density in TaTPR-B1 gene overexpressing plants and wild-type Fielder plants.

[0060] Figure 5 Statistics on TaTPR-B1 gene overexpression plant and wild-type Fielder traits, including expression level, spike length, and spikelet density. In this data, A represents relative expression level, B represents spike length, and C represents spikelet density. Detailed Implementation

[0061] The preferred embodiments of the present invention will now be described in detail with reference to the accompanying drawings.

[0062] 1) Target site selection and vector construction

[0063] The CDS sequence (SEQ ID No. 1) of wheat TaTPR-B1 was obtained. CRISPR / Cas9 knockout target primer pairs for TaTPR-B1 were designed using the online software E-CRISPR (http: / / www.e-crisp.org / E-CRISP / ), and BLAST was performed using PlantsEnsembl (http: / / plants.ensembl.org / index.html) to select specific targets, including SEQ ID No. 3: CCGCTAACTACGCCGACAGCGG and SEQ ID No. 4:

[0064] GGGAAGTCCAGGCGCGAGTAGG. These primers correspond to the target sites in the CRISPR / Cas9 system. Figure 1 )

[0065] Referring to the reference "Optimization of Agrobacterium-mediated transformation in spring bread wheat using mature and immature embryos" (Kumar R., Mamrutha HM, Kaur A., ​​Venkatesh K., Sharma D., Singh GP (2019) Molecular Biology Reports 46:1845-1853), the designed primer pair was linked to the wheat U3 promoter to form an sgRNA expression cassette. The sgRNA expression cassette was digested with enzymes and ligated into the PUbi-414 plasmid to obtain the TaTPR-B1 CRISPR / Cas9 knockout vector.

[0066] Referring to the reference "Generation of marker-free transgenic hexaploid wheat via an Agrobacterium-mediated co-transformation strategy in commercial Chinese wheat varieties" (Wang K., Liu H., Du L. and Ye X. (2017) Plant Biotechnol. J. 15: 614-623), the vector was transformed into the spring wheat variety Fielder using Agrobacterium-mediated transformation. The transformation process included induction, subculture, pre-culture, co-culture, resistance selection, differentiation, rooting culture, hardening-off, and transplanting. The specific operations are as follows:

[0067] Prepare a culture medium containing an appropriate amount of hormones, and select suitable plant materials, such as leaves, stem segments, or embryos. Place the plant materials in the culture medium, ensuring they are fully covered. Control temperature, humidity, and light conditions to promote the induction process.

[0068] Subculture: Plant tissues or cells are removed from the original culture, isolated, and transplanted onto a new culture medium. Ensure the use of fresh culture media and aseptic techniques to prevent contamination. Perform subculture regularly to prevent tissue aging and death.

[0069] Pre-culture: Plant materials are placed in a culture medium containing basic nutrients and pre-cultured for a period of time. The temperature and humidity are adjusted to allow the plant materials to gradually adapt to the culture conditions and gradually reduce their dependence on external conditions before transitioning to the formal culture medium.

[0070] Co-culture: Select the plant materials that need to be co-cultured and place them together on the culture medium.

[0071] Ensure that the hormones and nutrients in the culture medium are suitable for the growth needs of both plants, and monitor their interactions or cooperative growth.

[0072] Resistance screening: Introduce resistance-related genes, which can be achieved through gene transformation or other appropriate methods. Screen for plant individuals that exhibit resistance for further cultivation and research.

[0073] Differentiation: Adjusting the type and concentration of hormones to promote cell development in a specific direction.

[0074] Provide appropriate light and temperature to simulate the developmental environment inside the plant, monitor the developmental status of cells and tissues, and ensure that the expected differentiation level is achieved.

[0075] Rooting culture: Plant tissues or seedlings are cultured on a culture medium containing an appropriate amount of rooting hormones, with appropriate humidity and light provided to promote root development. The rooting process is monitored to ensure healthy root development.

[0076] Hardening off seedlings: Gradually reduce humidity and temperature in the cultivation conditions to allow the plant material to adapt to the external environment. Increase external light and wind stimulation to strengthen the plant structure. Gradually reduce dependence on the culture medium to allow the plants to adapt to the soil or other growth media.

[0077] Transplanting: Carefully remove the cultured plant material, make grooves or holes in the target growth medium, place the plant in, ensure sufficient water and nutrients to support plant growth, monitor the plant's adaptation process, and ensure successful transplanting.

[0078] The wheat U3 promoter and PUbi-414 plasmid are referenced in the article "Potential high-frequency off-target mutation induced by 414CRISPR / Cas9 in Arabidopsis and its prevention" (Zhang Q., Xing HL, Wang Z., Zhang HY, Yang F., Wang XC, and Chen QJ (2018) Plant Mol. Biol.

[0079] 96:445-456) obtained.

[0080] Two different homozygous mutation types were identified through sequencing.

[0081] Genomic DNA was extracted from these transgenic wheat plants using the CTAB method.

[0082] Using fresh wheat seedling leaves as material, the main steps are as follows:

[0083] DNA extraction using the CTAB method: Grind wheat leaves and add 600 μL of preheated CTAB extraction buffer. Heat in a 65°C water bath for 30 minutes to lyse the cells. After heating, add an equal volume of a 24:1 (chloroform:isoamyl alcohol, volume ratio) mixture to the sample, gently shake to mix, and allow the sample to separate into layers. Next, centrifuge at 10,000 rpm for 10 minutes to separate the layers. This will cause the DNA to precipitate as isopropanol in the upper layer.

[0084] After discarding the waste liquid, centrifuge at 4°C for 5-10 minutes to remove residual isopropanol. Then, wash the DNA with a 75% (v / v) aqueous ethanol solution and air dry the DNA.

[0085] The formulation of CTAB extract is as follows: 16.7 g CTAB, 639.1 mL water, 83.5 mL 1 mol Tris-HCl (pH = 8.0), 234 mL 5 mol NaCl, and 33.4 mL 0.5 mol EDTA (pH = 8.0).

[0086] These steps help extract wheat genomic DNA for subsequent molecular biology experiments or analyses.

[0087] PCR identification is performed, and the specific PCR steps are as follows:

[0088] The amplification system is as follows: Taq Mix: 5.0 μL; DNA template: 2.0 μL; double-distilled water: 1.0 μL; primers: 2.0 μL, totaling 10 μL.

[0089] The amplification program is as follows: 94℃ pre-denaturation for 5 minutes, (94℃ denaturation for 30 seconds, 56℃ annealing for 30 seconds, 72℃ extension for 30 seconds) for 35 cycles, and 72℃ final extension for 5 minutes.

[0090] To determine whether these transgenic wheat plants were positive, specific primer pairs (414-F: TTTCCCAGTCACGACGTTGT and 414-R: ATCTCTAGAGAGGGGCACGA) were used to amplify the PUbi-414 vector backbone. The TaTPR-B1 gene was amplified using TaTPR-B1 primers (TaTPR-B1-F: CTGCCGCCGTATAACCCA and TaTPR-B1-R: TTATGTTCCCTCGTATTG) to determine the specific mutation type.

[0091] 2) Obtaining and molecularly identifying edited mutants

[0092] How do homozygous mutations of TaTPR-B1 affect spike length and spike density in wheat?

[0093] The homozygous mutant of TaTPR-B1 (Tatpr-b1 with a 1bp insertion) encodes a frameshift mutation type of TaTPR-B1 protein. Wild-type CB037 and the homozygous mutant of TaTPR-B1 were planted in the field.

[0094] The inserted sequence is as follows: CB037: CCTACTCGCGCCTGGACTTCCC

[0095] The sequence after insertion is: Tatpr-b1: CCTACT T CGCGCCTGGACTTCCC

[0096] 3) Phenotypic identification of edited mutants

[0097] refer to Figure 2 and Figure 3At maturity, it was observed that the spike length of the TaTPR-B1 homozygous mutant, Tatpr-b1, was significantly smaller than that of the wild-type CB037, while the spikelet density of Tatpr-b1 was significantly greater than that of the wild-type CB037. A comparative analysis of spike length and spikelet density between CB037 and Tatpr-b1 revealed that, compared to CB037, Tatpr-b1 exhibited a significantly reduced spike length and a significantly increased spikelet density. This indicates that the TaTPR-B1 deletion has a significant effect on spike density. These results suggest that the homozygous mutation of TaTPR-B1 induces a dense spike characteristic in wheat, which holds significant potential for breeding wheat varieties with shorter spike lengths and higher spikelet densities.

[0098] 4) Construction of overexpression vectors

[0099] TaTPR-B1 was amplified using TaTPR-B1 primers (TaTPR-B1-F: CTGCCGCCGTATAACCCA; TaTPR-B1-R: TTATGTTCCCTCGTATTG). KY5214 Alleles were used as templates to amplify gene fragments containing overexpression vector adapter sequences, using primer sequences containing adapters (TaTPR-B1-OE-F:

[0100] AGGTCGACTCTAGAGGATCCATGTCGACCGGCCGGTCGAT and TaTPR-B1-OE-R: AGCTCGGTACCCGGGGATCCCGATTTCGAACCCGGGGTACC).

[0101] Referring to the literature "Optimization of Agrobacterium-mediated transformation inspring bread wheat using mature and immature embryos" (Kumar R., Mamrutha HM, Kaur A., ​​Venkatesh K., Sharma D., Singh GP (2019) Molecular Biology Reports 46:1845-1853), TaTPR-B1 KY5214 Alleles were ligated into pWMB110 plasmid to obtain TaTPR-B1 KY5214 Overexpression vectors.

[0102] Referring to the reference "Generation of marker-free transgenic hexaploid wheat via an Agrobacterium-mediated co-transformation strategy in commercial Chinese wheat varieties" (Wang K., Liu H., Du L. and Ye X. (2017) Plant Biotechnol. J. 15: 614-623), the vector was transformed into the spring wheat variety Fielder using Agrobacterium-mediated transformation. The transformation process included induction, subculture, pre-culture, co-culture, resistance selection, differentiation, rooting culture, hardening-off, and transplanting. The specific operations are as follows:

[0103] Prepare a culture medium containing an appropriate amount of hormones, and select suitable plant materials, such as leaves, stem segments, or embryos. Place the plant materials in the culture medium, ensuring they are fully covered. Control temperature, humidity, and light conditions to promote the induction process.

[0104] Subculture: Plant tissues or cells are removed from the original culture, isolated, and transplanted onto a new culture medium. Ensure the use of fresh culture media and aseptic techniques to prevent contamination. Perform subculture regularly to prevent tissue aging and death.

[0105] Pre-culture: Plant materials are placed in a culture medium containing basic nutrients and pre-cultured for a period of time. The temperature and humidity are adjusted to allow the plant materials to gradually adapt to the culture conditions and gradually reduce their dependence on external conditions before transitioning to the formal culture medium.

[0106] Co-culture: Select the plant materials that need to be co-cultured and place them together on the culture medium.

[0107] Ensure that the hormones and nutrients in the culture medium are suitable for the growth needs of both plants, and monitor their interactions or cooperative growth.

[0108] Resistance screening: Introduce resistance-related genes, which can be achieved through gene transformation or other appropriate methods. Screen for plant individuals that exhibit resistance for further cultivation and research.

[0109] Differentiation: Adjusting the type and concentration of hormones to promote cell development in a specific direction.

[0110] Provide appropriate light and temperature to simulate the developmental environment inside the plant, monitor the developmental status of cells and tissues, and ensure that the expected differentiation level is achieved.

[0111] Rooting culture: Plant tissues or seedlings are cultured on a culture medium containing an appropriate amount of rooting hormones, with appropriate humidity and light provided to promote root development. The rooting process is monitored to ensure healthy root development.

[0112] Hardening off seedlings: Gradually reduce humidity and temperature in the cultivation conditions to allow the plant material to adapt to the external environment. Increase external light and wind stimulation to strengthen the plant structure. Gradually reduce dependence on the culture medium to allow the plants to adapt to the soil or other growth media.

[0113] Transplanting: Carefully remove the cultured plant material, make grooves or holes in the target growth medium, place the plant in, ensure sufficient water and nutrients to support plant growth, monitor the plant's adaptation process, and ensure successful transplanting.

[0114] Wheat pWMB110 plasmid reference "Ectopic expression of VRT-A2 underlies the origin of Triticum polonicum and Triticum petropavlovskyi with long outerglumes and grains" (Jing L., Zhaoyan C., Zhihui W., Zhaoheng Z., Xiaoming X., Zihao W., Lingling C., Long S., Xuejiao C., Man F., Xiaobo W., Yanhong L., Zhaorong H., Jiewen X., Zhenqi S., Huiru P., Mingming X., Yingyin Y., Weilong G., Qixin S., Jie L., and Zhong N. (2021) Molecular Plant 14:1-17) were obtained.

[0115] Three independent overexpression lines were obtained by identifying expression levels.

[0116] Transcriptomic RNA was extracted from these overexpressing wheat plants using the Trizol method.

[0117] Using fresh wheat seedling leaves as material, the main steps are as follows:

[0118] Take a small amount of fresh sample, freeze it quickly with liquid nitrogen, grind it thoroughly with a grinder, then quickly add 1 ml of Trizol reagent, gently shake to mix, and let it stand at room temperature for 5 minutes for lysis.

[0119] Add 200 μL of chloroform to extract proteins and other substances, shake immediately for 15 seconds, and let stand at room temperature for 3 minutes.

[0120] Centrifuge at 4°C and 12,000 rpm for 15 minutes.

[0121] Carefully aspirate the supernatant (approximately 500 μL) into a new centrifuge tube, add an equal volume of isopropanol, invert to mix, and let stand at room temperature for 10 minutes.

[0122] Centrifuge at 4°C and 12,000 rpm for 15 minutes to precipitate RNA.

[0123] The following operations are performed on ice:

[0124] Discard the supernatant, add 1 mL of 75% ethanol aqueous solution to wash the RNA precipitate, and mix gently.

[0125] Centrifuge at 4°C and 7500 rpm for 5 minutes.

[0126] Discard the supernatant, centrifuge again, remove the remaining ethanol, and place the centrifuge tube containing the RNA precipitate on ice in a fume hood to dry for 15 minutes.

[0127] Add an appropriate amount of DEPC water to dissolve the RNA precipitate, and let it stand on ice for 30 minutes to fully dissolve the RNA.

[0128] RNA concentration was measured using a NanoDrop instrument and then stored at -80°C for later use.

[0129] cDNA synthesis:

[0130] RNA was reverse transcribed into cDNA using the Novizan HiScript IIQ RT SuperMix for qPCR (+gDNA wiper) kit (catalog number: R223). The specific steps are as follows:

[0131] After removing genomic DNA, prepare the following mixture in an RNase-free centrifuge tube:

[0132] Add 4 μL of 4×gDNA wiper mix, 1 μg of template RNA, and RNase-free ddH2O to 16 μL. After mixing, gently pipette to mix thoroughly, centrifuge briefly, and then incubate at 42°C for 2 minutes.

[0133] Configure the reverse transcription reaction system:

[0134] 4 μL of 5×HiScript II qRT SuperMix II and 16 μL of the first step reaction solution were mixed and then gently pipetted to mix. The mixture was then instantly centrifuged.

[0135] Perform reverse transcription:

[0136] The reaction was carried out at 50℃ for 15 minutes and 85℃ for 5 seconds. After the reaction was completed, the cDNA was placed in a -20℃ refrigerator for later use.

[0137] To determine whether these overexpressing wheat plants were positive, specific primer pairs (110-F: TTTGTTCGCTTGGTTGTG and 110-R: CGTATGAAGGCAGGGCTA) were used to amplify the pWMB110 vector backbone. Real-time quantitative amplification of TaTPR-B1 was performed using qPCR-TaTPR-B1 primers (qPCR-TaTPR-B1-F: AGCAAGTCGACCAATTCGAG and qPCR-TaTPR-B1-R: AGGAACAGGTGCTGCTTGAC). KY5214 Genes are used to determine specific expression levels.

[0138] 5) Obtaining and molecularly identifying overexpression vectors

[0139] TaTPR-B1 KY5214 How does overexpression affect spike length and spike density in wheat?

[0140] Using wild-type Fielder and 3 independent TaTPR-B1 KY5214 Overexpression lines, combining wild-type Fielder and 3 independent TaTPR-B1 gene expression lines. KY5214 The overexpression lines were planted in the field.

[0141] 6) Phenotypic identification of overexpressing plants

[0142] refer to Figure 4 and Figure 5 During the maturation period, TaTPR-B1 was observed to... KY5214 The overexpression lines (#1, #2, #3) had significantly longer spikes than the wild-type Fielder, TaTPR-B1. KY5214 The spikelet density of the overexpression lines (#1, #2, #3) was significantly lower than that of the wild-type Fielder. This was observed in Fielder and TaTPR-B1. KY5214 The spikelet length and spikelet density of the overexpression lines (#1, #2, #3) were compared and analyzed. The results showed that, compared with Fielder, TaTPR-B1... KY5214 The overexpression lines (#1, #2, #3) showed significantly increased spikelet length and significantly decreased spikelet density. This indicates that TaTPR-B1 KY5214 Overexpression has a significant thinning effect. These results indicate that TaTPR-B1 KY5214 Overexpression in wheat induces the characteristic of sparse spikelets, which has important potential for breeding wheat varieties with long spikelets and low spikelet density.

[0143] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made to it in form and detail without departing from the scope defined by the claims of the present invention.

Claims

1. The application of TaTPR-B1 gene knockout or overexpression in breeding different spike types of wheat, characterized in that, The nucleotide sequence of the TaTPR-B1 gene is shown in SEQ ID NO.

1. When the TaTPR-B1 gene is knocked out, the spike length of wheat decreases and the spikelet density increases. When the TaTPR-B1 gene is overexpressed, the spike length of wheat increases and the spikelet density decreases.

2. The application of gRNA for knocking out the TaTPR-B1 gene in breeding different spike types of wheat, characterized in that, The nucleotide sequence of the TaTPR-B1 gene is shown in SEQ ID NO.1; knocking out the TaTPR-B1 gene reduces the spike length and increases the spikelet density of wheat.

3. A breeding method for reducing spikelet length and increasing spikelet density, characterized in that, The specific steps are as follows: (1) Construct a CRISPR / Cas9 knockout expression vector for the TaTPR-B1 gene; (2) Wheat was transformed using the CRISPR / Cas9 knockout expression vector via Agrobacterium-mediated transformation to obtain transgenic wheat plants; The nucleotide sequence of the TaTPR-B1 gene is shown in SEQ ID NO.

1.

4. The breeding method according to claim 3, characterized in that, The specific method for step (1) is as follows: (1-1) Design target primers for the TaTPR-B1 gene to knock out the TaTPR-B1 gene; (1-2) Link the target primers to the wheat U6 promoter to form an sgRNA expression cassette: This promoter drives the expression of the CRISPR / Cas9 system and ensures the correct guidance of the primers; (1-3) Prepare pBUE-414 plasmid: a plasmid suitable for the CRISPR / Cas9 system, which includes the Cas9 protein and the corresponding RNA components; (1-4) Restriction endonuclease digestion: The sgRNA expression cassette and pBUE-414 plasmid were digested with restriction endonucleases respectively so that they could be ligated together; (1-5) Ligation: The enzyme-digested sgRNA expression cassette is ligated to the pBUE-414 plasmid to form a CRISPR / Cas9 knockout expression vector; (1-6) Colony PCR detection: PCR detection was performed to ensure that the sgRNA expression cassette was successfully ligated to the pBUE-414 plasmid; (1-7) Sequencing analysis of sgRNA sequence: Sequencing analysis of sgRNA sequence in CRISPR / Cas9 vector was performed to confirm its correctness and pairing with TaTPR-B1 gene.

5. A breeding method for increasing spikelet length and reducing spikelet density, characterized in that, The specific steps are as follows: (1) Construct an overexpression vector for the TaTPR-B1 gene; (2) Transgenic wheat plants were obtained by transforming wheat with an overexpression vector via Agrobacterium-mediated transformation; The nucleotide sequence of the TaTPR-B1 gene is shown in SEQ ID NO.

1.

6. The breeding method according to claim 5, characterized in that, The specific method for step (1) is as follows: (1-1) Specific amplification of the CDS sequence of the TaTPR-B1 gene: used for overexpression of the TaTPR-B1 gene; (1-2) Prepare pWMB-110 plasmid: a plasmid suitable for wheat overexpression systems, which includes the Ubi promoter; (1-3) Restriction endonuclease digestion: The pWMB-110 plasmid was digested with restriction endonuclease so that it could be ligated to the TaTPR-B1 gene CDS sequence with the same sticky ends. (1-4) Ligation: The CDS sequence of the TaTPR-B1 gene is ligated with the enzyme-digested pWMB-110 plasmid to form the TaTPR-B1 overexpression vector. (1-5) Colony PCR detection: PCR detection was performed to ensure that the CDS sequence of the TaTPR-B1 gene was successfully ligated to the pWMB-110 plasmid; (1-6) Sequencing analysis of the TaTPR-B1 gene CDS sequence: The TaTPR-B1 gene CDS sequence in the pWMB-110 vector was sequenced to confirm its correctness.