In vitro scaffold protein-mediated laccase / xylanase multi-enzyme complex and its preparation method and application

Abstract

The present invention relates to the field of enzyme engineering, and particularly to an in vitro scaffold protein-mediated laccase / xylanase multi-enzyme complex and its preparation method and application. First, xylanase and laccase are immobilized on the scaffold protein mCipA by using the anchor protein DocS and the cohesin domain on the scaffold protein mCipA to form a laccase / xylanase multi-enzyme complex. The laccase / xylanase multi-enzyme complex is used for the biological bleaching of pulp, which can effectively reduce the Kappa number of kraft poplar pulp and improve the whiteness of the pulp.

Description

Technical Field

[0001] The invention relates to the field of enzyme engineering, and in particular to an in vitro scaffold protein-mediated laccase / xylanase multi-enzyme complex and a preparation method and application thereof. Background Art

[0002] Lignin is a large class of biopolymers composed of phenylpropane analogs. The structure of the units and their connecting bonds are complex and stable, making them difficult to degrade. In the pulp, lignin and xylan form a complex that is tightly attached to the fiber and difficult to remove. After the oxidation reaction of lignin, colored substances will be generated, causing the paper to turn yellow. At the same time, some researchers believe that the presence of lignin will make the pH value of the paper acidic, which will in turn aggravate the hydrolysis and breakage of the glycosidic bonds in the cellulose chain and cause a significant decrease in the mechanical strength of the paper. It can be seen that lignin is currently generally considered to be the main cause of the yellowing of paper and low physical strength.

[0003] In order to improve the whiteness and physical strength of paper, removing lignin is the main research direction at present. Traditional mechanical and chemical methods remove lignin. The mechanical method consumes energy and cannot remove lignin. Although the chemical method consumes less energy and reduces the amount of fiber, it is not environmentally friendly. In contrast, biological pulping has the characteristics of cleanliness and gentleness. At present, in the process of pulp biological bleaching, microorganisms or enzyme preparations such as hemicellulase and lignin degrading enzyme are often used to synergistically treat pulp, which is conducive to delignification, so as to improve the color of pulp, increase the whiteness of pulp, and improve the bleachability of pulp. However, there is a problem of low catalytic efficiency of lignin in pulp when multiple enzymes are synergistically catalyzed. The reason is that multiple enzymes exist in free form, and the transfer efficiency of synergistically catalyzed intermediates is low. Summary of the invention

[0004] In order to overcome the above problems, the purpose of the present invention is to provide an in vitro scaffold protein mediated laccase / xylanase multi-enzyme complex and its preparation method and application. The prepared laccase / xylanase multi-enzyme complex can significantly improve the degradation ability of lignin in pulp.

[0005] To achieve the above object, the method for preparing the in vitro scaffold protein-mediated laccase / xylanase multi-enzyme complex designed by the present invention comprises the steps of:

[0006] Step 1: Obtaining the scaffold protein mCipA:

[0007] The scaffold protein mCipA gene is cut from the CipA gene, the scaffold protein mCipA gene is loaded into a vector plasmid to obtain a recombinant plasmid, and the recombinant plasmid is then transferred into a host bacterium to obtain a recombinant strain, and the recombinant strain is induced to express and the protein is purified to obtain the scaffold protein mCipA, which has 2 to 9 cohesin domains and a cellulose domain;

[0008] Step 2: Obtaining laccase CotA-DocS:

[0009] The anchor protein gene DocS with the nucleotide sequence shown in SEQ ID NO.7 is tandemly linked to the C-terminus of the wild-type laccase CotA gene with the nucleotide sequence shown in SEQ ID NO.3 and then loaded into a vector plasmid to obtain a recombinant plasmid. The recombinant plasmid is then transferred into a host bacterium to obtain a recombinant strain. After inducing expression and protein purification of the recombinant strain, laccase CotA-DocS is obtained;

[0010] Step 3: Obtaining xylanase Xyn-DocS:

[0011] The anchor protein gene DocS with the nucleotide sequence shown in SEQ ID NO.7 is tandemly linked to the C-terminus of the wild-type xylanase Xyn gene with the nucleotide sequence shown in SEQ ID NO.5 and then loaded into a vector plasmid to obtain a recombinant plasmid. The recombinant plasmid is then transferred into a host bacterium to obtain a recombinant strain. After inducing expression and protein purification of the recombinant strain, xylanase Xyn-DocS is obtained;

[0012] Step 4: In vitro assembly of laccase / xylanase multi-enzyme complex

[0013] The scaffold protein mCipA, laccase CotA-DocS, and xylanase Xyn-DocS are mixed. The anchor protein DocS at the C-terminus of laccase CotA and xylanase Xyn is mediated by hydrophobic interaction with the cohesin domain on the scaffold protein mCipA, and a laccase / xylanase multi-enzyme complex is assembled in vitro.

[0014] As a preferred embodiment, the nucleotide sequence of the scaffold protein mCipA gene is shown in SEQ ID NO.1, and the scaffold protein mCipA has 3 cohesin domains and 1 cellulose domain.

[0015] As a preferred embodiment, in Steps 1, 2, and 3, the vector plasmid is pET-23a(+), and the host bacterium is Escherichia coli E.coli BL21(DE3).

[0016] As a preferred embodiment, in Step 1, the specific process of inducing expression is to pick a single colony from a culture plate and activate it in a medium, transfer 4-5% of the strain amount to the medium, culture until the OD 600 reaches between 0.6 and 0.8, add IPTG to a final concentration of 0.08-0.11 mmol, and then add a 45-50 mM copper sulfate solution mother liquor to a final concentration of 0.20-0.25 mM. Induce for 4-5 h at 25-28 °C and 100-120 rpm, and then statically culture in a 25-28 °C constant temperature incubator for 16-18 h.

[0017] As a preferred embodiment, in the said Step 2 and Step 3, the specific process of induced expression is as follows: pick a single colony from the culture plate and activate it in the medium, then transfer 4-5% of the strain amount to the medium and culture until the OD 600 reaches between 0.6 and 0.8, add IPTG to a final concentration of 0.3-0.4 mmol, and induce at 18-20 °C and 140-150 rpm for 12-14 h.

[0018] As a preferred embodiment, in the said Step 4, the molar ratio of the scaffold protein mCipA, laccase CotA-DocS, and xylanase Xyn-DocS is 1.5-2:1-1.5:1-1.5, and the assembly temperature is 30-35 °C, pH is 6.0-7.0, and the binding time is 2-3 hours.

[0019] The laccase / xylanase multi-enzyme complex includes a mixture of mCipA-DocS-CotA laccase bodies, mCipA-DocS-Xyn xylanase bodies, and mCipA-DocS-CotA-Xyn laccase / xylanase bodies; the cohesin domain of the scaffold protein mCipA mediates the formation of mCipA-DocS-CotA laccase bodies through hydrophobic interaction; the cohesin domain of the scaffold protein mCipA mediates the formation of mCipA-DocS-Xyn xylanase bodies through hydrophobic interaction; the cohesin domain of the scaffold protein mCipA mediates the formation of mCipA-DocS-CotA-Xyn laccase / xylanase bodies through hydrophobic interaction.

[0020] An application of the prepared laccase / xylanase multi-enzyme complex in the pulp bleaching process.

[0021] As a preferred embodiment, in the reaction system of the said pulp bleaching process, the pulp concentration is 3-6%, pH is 6.5-7.0, temperature is 45-50 °C, the laccase activity of the laccase / xylanase multi-enzyme complex is 1-2 U, and the xylanase activity is 5-10 U.

[0022] As a preferred embodiment, the said pulp bleaching process includes an enzyme treatment process and a hydrogen peroxide treatment process.

[0023] The enzyme treatment process: in the enzyme reaction system, the pulp concentration is 3-6%, pH is 6.5-7.0, temperature is 45-50 °C, the laccase activity concentration of the laccase / xylanase multi-enzyme complex is 1-2 U, and the xylanase activity concentration is 5-10 U. React at 100-150 rpm for 12-14 h to obtain enzyme-treated pulp.

[0024] The hydrogen peroxide treatment process: After the enzymatic treatment, EDTA is added to the pulp for chelation, and then the chelated pulp is obtained through washing and drying. Then, H 2 O 2 1-5%, MgSO 4 0.1-0.2%, NaOH 1-2%, Na 2 SiO 3 0.2-0.5%, at 65-70°C, pH 10-11 for 1-2 h.

[0025] The advantages of the present invention are as follows: First, the present invention uses the cohesin domain on the anchoring protein DocS and the scaffold protein mCipA to immobilize xylanase and laccase on the scaffold protein mCipA, forming a laccase / xylanase multi-enzyme complex. The laccase / xylanase multi-enzyme complex includes a mixture of mCipA-DocS-CotA laccase bodies, mCipA-DocS-Xyn xylanase bodies, and mCipA-DocS-CotA-Xyn laccase / xylanase bodies. Compared with free laccase and free xylanase, on the one hand, immobilization by the scaffold protein mCipA can shorten the reaction distance between the enzyme and the substrate. On the other hand, although free laccase and free xylanase can play a synergistic role in the system, the distance between the two free enzymes is far, and the efficiency of synergistic effect transmission is too low. By immobilizing the two enzymes on the mCipA-DocS-CotA-Xyn laccase / xylanase body formed by the scaffold protein mCipA, the distance between the two enzymes can be shortened, and the efficiency of synergistic effect transmission can be improved. Description of the Drawings

[0026] Figure 1 is the plasmid map of pET-23a(+)-mCipA;

[0027] Figure 2 is the plasmid map of pET23a-cotA-DocS;

[0028] Figure 3 is the plasmid map of pET23a-Xyn-DocS;

[0029] Figure 4 is the effect of binding temperature on the assembly of the multi-enzyme complex;

[0030] Figure 5 is the graph of the effect of protein amount ratio on the assembly of the multi-enzyme complex;

[0031] Figure 6 is the effect of binding pH on the assembly of the multi-enzyme complex;

[0032] Figure 7 is the effect of binding time on the assembly of the multi-enzyme complex;

[0033] Figure 8A SDS-PAGE diagram of the supernatant bound to microcrystalline cellulose;

[0034] Figure 8B SDS-PAGE diagram of the precipitate bound to microcrystalline cellulose;

[0035] In the figure, lane 1 is the blank control; lane 2 is mCipA; lane 3 is Xyn; lane 4 is CotA; lane 5 is the multi-enzyme complex; lane 6 is the blank control; lane 7 is mCipA; lane 8 is Xyn; lane 9 is CotA; lane 10 is the multi-enzyme complex;

[0036] Figure 9 Native-PAG gel electrophoresis diagram of the multi-enzyme complex;

[0037] Figure 10A Optimal pH of xylanase and complex xylanase;

[0038] Figure 10B Optimal temperature of xylanase and complex xylanase;

[0039] Figure 10C Optimal pH of laccase and complex laccase;

[0040] Figure 10D Optimal temperature of laccase and complex laccase;

[0041] Figure 11A Bar graph of laccase pH stability;

[0042] Figure 11B Bar graph of laccase temperature stability;

[0043] Figure 11C Bar graph of xylanase pH stability;

[0044] Figure 11D Bar graph of xylanase temperature stability;

[0045] Figure 12A Bar graph of complex laccase pH stability;

[0046] Figure 12B Bar graph of complex laccase temperature stability;

[0047] Figure 12C Bar graph of complex xylanase pH stability;

[0048] Figure 12D Bar graph of complex xylanase temperature stability;

[0049] Figure 13A Diagram of the effect of different enzyme systems on reducing sugar;

[0050] Figure 13B Effect diagram of different enzyme systems on total phenols;

[0051] Figure 14 Column chart of pulp bleaching by combined enzyme treatment and chemical bleaching;

[0052] Figure 15 Schematic diagram of the process for an in vitro scaffold protein-mediated laccase / xylanase multi-enzyme complex; Detailed implementation manners

[0053] To better understand the present invention, the invention will be described in detail below with reference to the accompanying drawings and specific examples.

[0054] Example 1 combination Figure 15 As shown, a method for preparing an in vitro scaffold protein-mediated laccase / xylanase multi-enzyme complex:

[0055] Step 1. Obtaining of scaffold protein mCipA:

[0056] 1.1 The gene of scaffold protein CipA (UniProtKB: Q06851) was artificially synthesized and loaded on the pDGO-40 plasmid. There are 9 cohesin domains and one carbohydrate-binding module (CBM3) on the scaffold protein CipA. In this application, 3 cohesin domains were intercepted. Therefore, primers (Cohe-F taagaaggagatatacatgagaaaagtcatcagt and Cohe-Ratggtgatggtgatgatgatctccaacatt) were designed to amplify a partial scaffold protein CipA gene sequence from the pDGO-40 plasmid (the nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2), which contains three cohesin domains (Cohesins1-3) and one carbohydrate-binding module (CBM3), named mini-cipA (mCipA). His tags were designed in the primers for subsequent purification.

[0057] 1.2 Use the ClonExpress II One Step cloning kit for recombinant cloning, combined with Figure 1As shown, the amplified product was assembled into the pET-23a(+) plasmid to obtain the recombinant plasmid pET-23a(+)-mCipA. The recombinant plasmid was then transformed into Escherichia coli E. coli BL21(DE3) and spread on an LA plate. Colony PCR was used for verification. After confirmation, the bacteria were transferred into LA medium and cultured overnight, and then the plasmid was extracted. The plasmid was then transformed into the expression strain E. coli BL21(DE3) to induce the expression of the target protein. The formula for the LA solid medium is as follows: 1% Tryptone; 1% NaCl, 0.5% Yeast extract, 1.5% Agar (added for solid medium), sterilized at 121°C for 25 min. When in use, 0.01% ampicillin (100 mg / mL) needs to be added.

[0058] 1.3 Protein expression: A single colony was picked from the LA plate and transferred to 50 mL of LA medium, and activated overnight at 37°C and 200 rpm. Then, 5% of the bacterial strain was transferred to 500 mL of LA medium and cultured at 37°C and 200 rpm until the OD600 reached between 0.6 and 0.8. 24 mg / mL IPTG was added to a final concentration of 0.4 mmol. Induction was carried out at 20°C and 150 rpm for 12 h. After the induction of expression, the bacteria were collected by centrifugation and washed with pH 7.3 Tris-HCl buffer more than twice. Lysis buffer (20 mM pH 7.3 Tris-HCl, 20 mM imidazole, 0.5 M NaCl, 3 mg / mL lysozyme, 1 mM PMSF) was added, and the mixture was placed at 4°C for 2 h and then sonicated.

[0059] 1.4 Protein purification: The recombinant enzyme was purified using Ni 2+ affinity chromatography. The recombinant protein was fully mixed with Ni2+ chelating resin and equilibrated at 4°C for 2 h. The impurity proteins were washed away with 10 column volumes of binding buffer (20 mM pH 7.3 Tris-HCl, 20 mM imidazole, 0.5 M NaCl). Then, the target protein was eluted with elution buffer (20 mM pH 7.3 Tris-HCl, 20 mM imidazole, 0.5 M NaCl). After collecting the target protein, ultrafiltration was carried out using a 10K ultrafiltration tube, and the target protein was rinsed with 20 mM pH 7.3 Tris-HCl, and ultrafiltered and concentrated to 1 - 1.5 mL. The protein concentration was detected using a Bradford kit, and the recombinant protein was stored at 4°C for later use.

[0060] Step 2: Obtaining laccase CotA-DocS:

[0061] 2.1 Design primers (pET23a-F-1 catcatcaccatcaccattgatggctagcatgactg and pET23a-R-1 gtatatctccttcttaaagttaaacaaaattatttctag), and use PCR technology to reverse amplify the pET23a(+) vector to obtain a vector carrying homologous arms. Design primers (CotA-F ttaagaaggagatatacatgaacctagaaaaatttgt and CotA-R atcattgacgtcgccaataatatccatcgg) to amplify the CotA gene shown in the nucleotide sequence SEQ ID NO.3 (GenBank: MW373470) from the pEt28a-CotA vector. The amino acid sequence of laccase CotA is SEQ ID NO.4. Tandemly connect the anchor protein gene DocS to the C-terminus of the laccase gene and construct them together into the vector pET23a(+); Tandemly connecting the anchor protein gene DocS directly to the C-terminus of the laccase gene is a conventional technical means and will not be elaborated here;

[0062] 2.2 The transformation of the recombinant plasmid and the purification of the protein are the same as steps 1.2 and 1.4 above and will not be elaborated here. The protein expression of laccase CotA-DocS is different from that in step 1.4 above. The protein expression process of laccase CotA-DocS is to pick a single colony from the LA plate into 50 mL of LA medium, activate it overnight at 37 °C and 200 rpm, transfer 5% of the bacterial strain amount to 500 mL of LA medium, culture it at 37 °C and 150 rpm until the OD600 reaches between 0.6 and 0.8, add 24 mg / mL IPTG to a final concentration of 0.1 mmol, and then add the 50 mM copper sulfate solution stock solution to a final concentration of 0.25 mM. After inducing for 4 h at 28 °C and 120 rpm, let it stand in a 28 °C constant temperature incubator for 16 h.

[0063] Step 3: Obtaining xylanase Xyn-DocS:

[0064] 3.1 Directly synthesize the Xyn-DocS gene, which includes the wild-type xylanase gene (the nucleotide sequence is shown in SEQ ID NO.5, and the amino acid sequence is shown in SEQ ID NO.6) and the DocS gene (the nucleotide sequence is shown in SEQ ID NO.7) tandemly connected at the C-terminus of the xylanase gene. The two genes are directly loaded into pET23a(+) through commercial gene synthesis. Design primers (pET23a-F-2caccaccaccaccactgatggctagcatga and pET23a-R-2actttaagaaggagatatacatgaacctagaaaaat), and a His tag is designed in the primers for subsequent purification. Combining Figure 3 as shown, use PCR technology to reverse amplify the pET23a(+) vector to obtain the recombinant plasmid pET23a-Xyn-DocS containing the His tag.

[0065] 3.2 Transfer the recombinant plasmid into Escherichia coli E.coli BL21(DE3) to obtain the recombinant strain. After inducing expression and protein purification of the recombinant strain, xylanase Xyn-DocS is obtained. The steps of inducing expression and protein purification of the recombinant strain are the same as those in steps 1.3 and 1.4 above, and will not be elaborated here.

[0066] Step 4: In vitro assembly of the laccase / xylanase multi-enzyme complex and optimization of the multi-enzyme complex assembly conditions to enable complete or nearly complete binding of free laccase, free xylanase, and the scaffold protein. Optimize the multi-enzyme complex assembly conditions from four factors: binding temperature, binding pH, binding time, and protein amount ratio. Based on the characteristic that the multi-enzyme complex can bind to microcrystalline cellulose, while free laccase and free xylanase cannot bind to microcrystalline cellulose, through a microcrystalline cellulose binding experiment, measure the enzyme activities of the remaining laccase and xylanase in the binding supernatant to judge the effect of the formation of the multi-enzyme complex.

[0067] 4.1 Effect of binding temperature on the assembly of the multi-enzyme complex. Explore the effect of binding temperature on the assembly of the multi-enzyme complex between 25 - 50°C. Add equimolar amounts (100 pmol) of laccase, xylanase, and the fiber scaffold protein A, incubate at 20 - 50°C for 2 h. After the binding is completed, conduct a microcrystalline cellulose binding experiment to detect the enzyme activities of the remaining laccase and xylanase in the binding supernatant. The results are as Figure 3 shown in -8. When the multi-enzyme complex is at 35°C, the assembly effect is the best. The remaining xylanase enzyme activity detected in the supernatant is 17.1%, and the remaining laccase enzyme activity detected is 23.3%. Approximately 83% of the xylanase and 77% of the laccase are successfully assembled onto the fiber scaffold protein A.

[0068] 4.2 Effect of protein amount ratio on the assembly of the multi-enzyme complex

[0069] The effect of protein ratio on the assembly of the multi-enzyme complex mainly explores the effect of the change in the content of the fibrous scaffold protein A on the assembly of the multi-enzyme complex. During the assembly process, the addition ratio of the fibrous scaffold protein A was changed, and laccase and xylanase were always added at an equimolar ratio of 1:1. As the ratio of the fibrous scaffold protein A in the system increased, the enzyme activity ratio of laccase and xylanase in the supernatant gradually decreased. Combining Figure 5 As shown, when the protein molar ratio of the fibrous scaffold protein A to laccase and xylanase was 1.5:1:1, the enzyme activities of laccase and xylanase in the supernatant decreased to the lowest. The residual laccase enzyme activity in the supernatant was 1.1%, and the residual xylanase enzyme activity was 24%. When the content of the fibrous scaffold protein A continued to increase, the residual laccase enzyme activity and xylanase enzyme activity in the supernatant remained unchanged.

[0070] 4.3 Effect of binding pH on the assembly of the multi-enzyme complex, combining Figure 6 As shown, the experiment shows that laccase is stable under the conditions of pH 6.0 - 10.0, and xylanase is stable under the conditions of pH 6.0 - 8.0. To avoid excessive damage to enzyme activity during protein assembly, considering the pH stability of laccase and xylanase comprehensively. We explored the effect of the change in pH in the binding environment on the assembly of the multi-enzyme complex under the conditions of pH 6.0 - 8.0. The results are as Figures 3 - 9 shown. As the pH increased, the assembly effect of the multi-enzyme complex showed a trend of first increasing and then decreasing. When the pH was 7.0, the assembly effect of the multi-enzyme complex was the best, and about 80.5% of the free laccase and 87% of the free xylanase were assembled onto the fibrous scaffold protein to form the multi-enzyme complex.

[0071] 4.4 Effect of binding time on the assembly of the multi-enzyme complex. To explore the optimal binding time of the multi-enzyme complex, three different proteins were added at an equimolar ratio (100 pmol) under the conditions of pH 7.0 and 35 °C for 0 - 3 h. The results are as Figure 7 shown. After laccase was bound for 1.5 h, the binding effect was the best, and only 5.1% of the laccase enzyme activity remained in the supernatant. After xylanase was bound for 2 h, the binding effect was the best, and 18% of the xylanase enzyme activity remained in the supernatant. When the binding time continued to extend, the residual laccase enzyme activity and xylanase enzyme activity in the supernatant remained basically unchanged. And if the incubation time in vitro is too long, the enzyme is easily inactivated. Therefore, the binding time is controlled at 2 h, and the assembly effect of the multi-enzyme complex is the best.

[0072] In this example, the protein molar amounts were the scaffold protein mCipA, laccase CotA, and xylanase Xyn at 1.5:1:1, the assembly temperature was 35 °C, the pH was 7.0, and the binding time was 2 hours. After detection, 86% of the xylanase and 82% of the laccase were successfully assembled.

[0073] Combining Figure 15As shown, in the laccase / xylanase multi-enzyme complex of this embodiment, since the binding sites of the three catalytic enzymes on the scaffold protein mCipA bind randomly to laccase and xylanase, the resulting laccase / xylanase multi-enzyme complex is a mixture of multiple enzyme bodies. Compared with free laccase and free xylanase, immobilization on the scaffold protein mCipA can, on the one hand, shorten the reaction distance between the enzyme and the substrate. On the other hand, although free laccase and free xylanase can exert a synergistic effect in the system, the two free enzymes are far apart, and the efficiency of synergistic effect transmission is too low. By immobilizing the two enzymes on the scaffold protein mCipA, the distance between the two enzymes can be shortened, and the efficiency of synergistic effect transmission can be improved.

[0074] Example 2 Analysis of the Formation of Multi-Enzyme Complex

[0075] The anchoring protein DocS located at the C-terminus of laccase and xylanase is mediated by hydrophobic interaction with the cohesin on the scaffold protein and assembled into a multi-enzyme complex in vitro. Since the scaffold protein contains a carbohydrate-binding module CBM3, it can bind to microcrystalline cellulose, while laccase and xylanase cannot bind to microcrystalline cellulose. Based on this property, we examined the formation of the multi-enzyme complex through a cellulose-binding experiment.

[0076] An equimolar mixture of purified proteins (100 pmol of each purified protein in 50 mM pH 6.0 citrate buffer, 10 mM CaCl 2 , 2 mM EDTA) was incubated at 37 °C for 2 hours and mixed with 20 mg of microcrystalline cellulose at 4 °C with shaking for 1 h, and the final volume was 200 μL. Then it was centrifuged at 14,000 rpm for 5 min. The supernatant (containing unbound proteins) was discarded, and the cellulose particles were resuspended and washed twice in 200 μL of the same buffer (added with 0.05% Tween-20 to eliminate non-specific binding) and centrifuged at 14,000 rpm for 5 min. 40 μL of buffer was added to the centrifuge tube to resuspend the cellulose particles, and 10 μL of loading buffer was added and mixed again, and heated at 100 °C for 10 min to dissociate any bound proteins. An equimolar protein without the scaffold protein was used as a negative control to ensure the specificity of binding. The bound and unbound components were analyzed by SDS-PAGE (5% stacking gel and 10% separating gel).

[0077] Results of Binding Figures 8A - 8BAs shown, laccase and xylanase appeared in the binding supernatant because they did not bind to microcrystalline cellulose. Some protein bands of laccase and xylanase were also detected in the binding precipitate, which might be caused by incomplete washing of the precipitate, resulting in some proteins in the supernatant remaining in the precipitate. The scaffold protein and the multi-enzyme complex could aggregate with microcrystalline cellulose and accumulate in the precipitate, and corresponding protein bands were detected in the binding precipitate. However, no protein was detected in the binding supernatant.

[0078] As a supplementary method for verifying the formation of the multi-enzyme complex, the formation of the multi-enzyme complex was determined by the differential mobility of proteins with different molecular weights in a native PAGE gel. Since the multi-enzyme complex had the largest molecular weight, it was located at the top of the native PAGE gel. As Figure 9 shown, a new protein band was formed at the top of the native PAGE gel, confirming the successful assembly of the multi-enzyme complex.

[0079] Example 3 Enzymatic Property Analysis

[0080] Analysis method: Sample preparation: The complex xylanase was formed according to the ratio of scaffold protein mCipA to xylanase Xyn 1.5:1, with an assembly temperature of 35°C, a pH of 7.0, and a binding time of 2 hours. The complex laccase was formed according to the ratio of scaffold protein mCipA to laccase CotA 1.5:1, with an assembly temperature of 35°C, a pH of 7.0, and a binding time of 2 hours.

[0081] Definition of laccase activity: The purified enzyme solution was diluted to an appropriate multiple. The reaction system consisted of 0.05 mL of the enzyme solution, 0.05 mL of 10 mmol / L ABTS substrate solution, and 0.9 mL of pH 5.0 HAc-NaAc buffer. The absorbance was measured at 420 nm, once every 10 s for 1 min (in parallel 3 times for each group). The enzyme activity was defined as: the amount of enzyme required to oxidize 1 μmol of ABTS under the same conditions.

[0082] The definition of xylanase activity was: the amount of xylanase in 1 mL of the enzyme solution that hydrolyzed xylan to produce 1 μmol of xylose reducing substance per unit time was defined as 1 enzyme activity unit.

[0083] Analyze the enzymatic activities at different temperatures. Under the conditions of 30 - 90 °C and 0.2 M HAC-NaAC buffer (pH 5.0), react the enzyme with the substrate and test the enzyme activities at different temperatures. Analyze the activities of laccase at different pH values. At 25 °C, use different pH gradients (50 mM citric acid-sodium citrate buffer (pH 3.0 - 6.0), Tris-HCl buffer (pH 7.0 - 8.0), 50 mM glycine-sodium hydroxide buffer (pH 9.0 - 10.0)), react the enzyme with the substrate and test the enzyme activities at different pH values. Analyze the thermal stability and pH stability of the enzyme. Incubate xylanase and laccase in 50 mM Tris-HCl (pH 7.3) at 30 - 80 °C, and take samples every 60 min to measure the enzyme activity. Incubate the enzyme in buffer at 4 °C and pH 3 - 10, and take samples every 60 min to measure the enzyme activity.

[0084] Results: As shown in Figure 10A 、 Figure 10B 、 Figure 10C 、 Figure 10D , free laccase and complex laccase have the same optimal pH and optimal temperature. The optimal reaction pH is 5 for both, and the optimal reaction temperature is 80 °C for both. There is no change in the optimal pH and optimal temperature of free xylanase and complex xylanase either. The optimal reaction pH is 6 for both, and the optimal reaction temperature is 70 °C for both. It can be seen that the binding of laccase and xylanase to the scaffold protein does not change the optimal reaction temperature and optimal reaction pH of laccase and xylanase.

[0085] As shown in Figure 11A 、 Figure 11B 、 Figure 12A 、 Figure 12B , free laccase and complex laccase have the same temperature stability and pH stability. Under the conditions of pH 6 - 10 and 30 - 50 °C, the enzymatic properties are very stable. After incubating for 6 h, more than 80% of the laccase activity remains. As shown in Figure 11C 、 Figure 11D 、 Figure 12C 、 Figure 12D , compared with free xylanase, the pH stability and temperature stability of complex xylanase are improved. When free xylanase is incubated at pH 9 and 70 °C for 2 h, no enzyme activity can be detected. However, for complex xylanase, when incubated at pH 9 for 2 h, 38% of the xylanase activity can be detected, and when incubated at 70 °C for 6 h, 9% of the xylanase activity can be detected. It can be seen that the binding of laccase to the scaffold protein does not change the temperature stability and pH stability of laccase. While the binding of xylanase to the scaffold protein helps to improve the temperature stability and pH stability of xylanase.

[0086] Example 4 Comparison of the lignin degradation ability between the free enzyme system and the laccase / xylan complex system:

[0087] To make the free enzyme system and the multi-enzyme complex system comparable, the lignin degradation ability was compared at similar laccase and xylanase activity ratios. In the laccase / xylan complex, the measured activity ratio of laccase to xylanase was 1:5. Then, the free laccase and free xylanase were compounded into a free laccase / xylanase system according to the activity ratio of 1:5. Since the enzymatic properties of the two enzymes were different, the optimal treatment conditions for the pulp were selected to be as close as possible to the optimal reaction conditions of the two enzymes. Finally, the poplar pulp was treated under the conditions of pH 6, temperature 50 °C, pulp consistency 3%, and time 12 h.

[0088] Preparation of the free enzyme system (CotA+Xyn): The bleached pulp of sulfate poplar was washed with deionized water and then dried in a constant-temperature oven at 50 °C. 3% of the oven-dried pulp was weighed, and pH 6 phosphate buffer was added, along with 5 U / g of xylanase and 1 U / g of laccase. The reaction was carried out at 50 °C and 150 rpm for 12 h. After the reaction, the contents of reducing sugar and total phenol in the enzyme reaction solution were measured. The pulp was washed with deionized water and dried at 50 °C for standby.

[0089] Preparation of the laccase / xylan complex system (mCipA:CotA+Xyn): The bleached pulp of sulfate poplar was washed with deionized water and then dried in a constant-temperature oven at 50 °C. 3 g of the oven-dried pulp was weighed, and 100 mL of pH 6 phosphate buffer was added, along with a laccase / xylan complex prepared from xylanase and laccase with the same enzyme activity as the above free enzyme system. The reaction was carried out at 50 °C and 150 rpm for 12 h. After the reaction, the contents of reducing sugar and total phenol in the enzyme reaction solution were measured. The pulp was washed with deionized water and dried at 50 °C for standby.

[0090] Combined Figure 13A and Figure 13B As shown, both the free enzyme system (CotA+Xyn) and the multi-enzyme complex system (mCipA:CotA+Xyn) showed strong lignin degradation ability. When the enzyme dosage was the same, the contents of reducing sugar and total phenol in the enzyme treatment solution of the multi-enzyme complex system (mCipA:CotA+Xyn) were always greater than those of the free enzyme system (CotA+Xyn). Compared with the treatment solution of the untreated pulp, the contents of reducing sugar and total phenol in the enzyme treatment solution of the multi-enzyme complex system (mCipA:CotA+Xyn) increased by 8.8% and 50.1% respectively; the contents of reducing sugar and total phenol in the enzyme treatment solution of the free enzyme system (CotA+Xyn) increased by 4.5% and 36.7% respectively. The multi-enzyme complex had a stronger ability to delignify the pulp than the free enzyme.

[0091] When treating pulp with different enzyme systems, the effects of the free enzyme system (CotA + Xyn) and the multi - enzyme complex system (mCipA:CotA + Xyn) on the Kappa number and whiteness of the pulp are shown in Table 1. After enzyme treatment of the pulp, part of the lignin and xylan in the pulp are degraded and dissolved. The Kappa number decreases with the degradation of lignin, and the whiteness increases with the degradation of lignin. Compared with the untreated pulp, the Kappa number of the pulp treated with the free enzyme system (CotA + Xyn) decreases by 3.1, and the whiteness increases by 1.78% ISO; the Kappa number of the pulp treated with the multi - enzyme complex system (mCipA:CotA + Xyn) decreases by 3.5, and the whiteness increases by 2.3% ISO. For the removal effect of lignin, the lignin removal rate of the free enzyme system (CotA + Xyn) is 25.4%, and the lignin removal rate of the multi - enzyme complex system (mCipA:CotA + Xyn) is 28.7%. For the pulp bleaching effect, the multi - enzyme complex is superior to the free enzyme.

[0092] Table 1 Comparison of the lignin - degrading abilities of different enzyme systems for poplar pulp

[0093]

[0094] In Table 1, the lignin removal rate: the percentage of the reduction in the Kappa number of the bleached pulp to the Kappa number of the original pulp;

[0095] To determine the impact of enzyme treatment on the fiber strength of the pulp, the physical properties of the pulp before and after enzyme treatment were compared. As shown in Table 2. Compared with the blank pulp, the tensile index, breaking length, and tearing index of the pulp treated with the free enzyme decreased by 1.2%, 0.1%, and 2.9% respectively. The tensile index, breaking length, and tearing index of the pulp treated with the multi - enzyme complex decreased by 0.6%, 1.2%, and 1.7% respectively. The mechanical strength of the enzyme - treated pulp fibers was not significantly weakened, indicating that while effectively removing lignin from the pulp, the enzyme treatment did not damage the paper fibers, showing good bleaching selectivity.

[0096] Table 2 Effects of different enzyme systems on the physical properties of poplar pulp

[0097]

[0098] Example 5 Combined promoting bleaching effect of enzyme treatment and chemical bleaching

[0099] The enzyme treatment and chemical bleaching were combined to treat poplar pulp, and the improvement of the chemical bleaching performance by enzyme treatment was investigated.

[0100] First, poplar pulp was treated with enzymes. 3 g of oven-dry pulp was weighed and 100 mL of pH 6 phosphate buffer, free enzymes (5 U of xylanase and 1 U of laccase), and the addition amount of laccase / xylanase multi-enzyme complex (a laccase / xylanase complex prepared from xylanase and laccase with the same enzyme activity as the above free enzyme system) were added. The reaction was carried out at 50 °C and 150 rpm for 12 h. After the reaction, enzyme-treated pulp was obtained;

[0101] Then, the hydrogen peroxide treatment process: After the enzyme treatment, 100 ml of 0.5% EDTA was added to 10 g of the pulp and chelated at 70 °C for 1 h. Then, after washing and drying, chelated pulp was obtained. Then, 5 g of the chelated pulp was taken, and H 2 O 2 1-5%, MgSO 4 0.1%, NaOH 1%, Na 2 SiO 3 0.2% were added, and the treatment was carried out at 70 °C and pH 11 for 2 h. It was washed with deionized water, made into paper, and the whiteness was measured. The blank control was directly treated with hydrogen peroxide without enzyme treatment.

[0102] Combined Figure 14 As shown, within the tested range of H 2 O 2 The final bleached whiteness of the enzyme-treated pulp was significantly higher than that of the control. Among them, when using 3% hydrogen peroxide for chemical bleaching, the bleaching effects of the free enzyme system and the multi-enzyme complex were the best, and the final bleaching degrees reached 60.6% ISO and 61.5% ISO respectively. Compared with the control group, the whiteness increased by 10% and 11.5%. And the promoting bleaching effect of the multi-enzyme complex in chemical bleaching was better than that of the free enzyme.

[0103] When the hydrogen peroxide concentration reached 5%, the original pulp could be bleached to 59.5% ISO. And when using 3% H 2 O 2 to bleach the enzyme-treated pulp, the pulp whiteness could be bleached to 60.6% ISO and 61.5% ISO. Adding enzyme treatment could save 40% of the hydrogen peroxide consumption for subsequent chemical bleaching.

Claims

1. A method for preparing an in vitro scaffold protein-mediated laccase-xylanase multi-enzyme complex, characterized in that: Includes steps: Step 1: Obtaining the scaffold protein mCipA: The scaffold protein mCipA gene is cut from the CipA gene, the scaffold protein mCipA gene is loaded into a vector plasmid to obtain a recombinant plasmid, and the recombinant plasmid is then transferred into a host bacterium to obtain a recombinant strain, and the recombinant strain is induced to express and the protein is purified to obtain the scaffold protein mCipA, which has 2 to 9 cohesin domains and a cellulose domain; Step 2: Acquisition of laccase CotA-DocS: The anchor protein gene DocS with a nucleotide sequence as shown in SEQ ID NO.7 and the C-terminus of the wild-type laccase CotA gene with a nucleotide sequence as shown in SEQ ID NO.3 are connected in series and loaded into a vector plasmid to obtain a recombinant plasmid, and the recombinant plasmid is then transferred into a host bacterium to obtain a recombinant strain, and the recombinant strain is induced to express and the protein is purified to obtain the laccase CotA-DocS; Step 3: Obtaining xylanase Xyn-DocS: The anchor protein gene DocS with a nucleotide sequence as shown in SEQ ID NO.7 and the C-terminus of the wild-type xylanase Xyn gene with a nucleotide sequence as shown in SEQ ID NO.5 are connected in series and loaded into a vector plasmid to obtain a recombinant plasmid, and then the recombinant plasmid is transferred into a host bacterium to obtain a recombinant strain, and the recombinant strain is induced to express and the protein is purified to obtain xylanase Xyn-DocS; Step 4. In vitro assembly of laccase-xylanase multienzyme complex The scaffold protein mCipA, laccase CotA-DocS and xylanase Xyn-DocS were mixed, and the anchor protein DocS located at the C-terminus of laccase CotA and xylanase Xyn and the cohesin domain on the scaffold protein mCipA were assembled into a laccase-xylanase multienzyme complex in vitro through hydrophobic interaction. The nucleotide sequence of the scaffold protein mCipA gene is shown in SEQ ID NO.1, and the scaffold protein mCipA has three cohesin domains and one cellulose domain; In the steps 1, 2 and 3, the vector plasmids are all pET-23a, and the host bacteria are all Escherichia coli E. coli BL21DE3 ; In step 4, the protein molar ratio of the scaffold protein mCipA, the laccase CotA-DocS and the xylanase Xyn-DocS is 1.5:1:1, the assembly temperature is 35° C., the pH is 7.0, and the binding time is 2 hours; The laccase-xylanase multienzyme complex is a mixture of mCipA-DocS-CotA laccase bodies, mCipA-DocS-Xyn xylanase bodies and mCipA-DocS-CotA-Xyn laccase-xylanase bodies; the mCipA-DocS-CotA laccase bodies are formed by the cohesive protein domain of the scaffold protein mCipA mediating the formation of laccase through hydrophobic interaction; the mCipA-DocS-Xyn xylanase bodies are formed by the cohesive protein domain of the scaffold protein mCipA mediating the formation of xylanase through hydrophobic interaction; the mCipA-DocS-CotA-Xyn laccase-xylanase bodies are formed by the cohesive protein domain of the scaffold protein mCipA mediating the formation of laccase and xylanase simultaneously through hydrophobic interaction.

2. The method for preparing the in vitro scaffold protein-mediated laccase-xylanase multi-enzyme complex according to claim 1, characterized in that: In step 1, the specific process of inducing expression is to pick a single colony from the culture plate and activate it in the culture medium, transfer 4-5% of the strain volume to the culture medium, and culture it until OD 600 When the pH reaches between 0.6 and 0.8, add IPTG to a final concentration of 0.08 to 0.11 mmol, and then add 45 to 50 mM copper sulfate solution stock solution to a final concentration of 0.20 to 0.25 mM. After inducing at 25 to 28 ° C and 100 to 120 rpm for 4 to 5 hours, place in a constant temperature incubator at 25 to 28 ° C for 16 to 18 hours.

3. The method for preparing the in vitro scaffold protein-mediated laccase-xylanase multi-enzyme complex according to claim 1, characterized in that: In step 2 and step 3, the specific process of inducing expression is to pick a single colony from the culture plate and activate it in the culture medium, then transfer 4-5% of the strain volume to the culture medium, and culture it until OD 600 When the pH reaches between 0.6 and 0.8, add IPTG to a final concentration of 0.3 to 0.4 mmol. Induce for 12 to 14 h at 18 to 20 °C and 140 to 150 rpm.

4. Use of the laccase-xylanase multi-enzyme complex prepared according to any one of claims 1 to 3 in pulp bleaching, characterized in that: The pulp bleaching reaction system has a pulp concentration of 3-6%, a pH of 6.5-7.0, a temperature of 45-50° C., an enzyme activity concentration of laccase in the laccase-xylanase multienzyme complex of 1-2 U, and an enzyme activity concentration of xylanase of 5-10 U. The pulp bleaching includes an enzyme treatment process and a hydrogen peroxide treatment process: The enzyme treatment process: the concentration of pulp in the enzyme reaction system is 3-6%, the pH is 6.5-7.0, the temperature is 45-50°C, the enzyme activity concentration of the laccase in the laccase-xylanase multi-enzyme complex is 1-2U, the enzyme activity concentration of the xylanase is 5-10 U, and the reaction is carried out at 100-150rpm for 12-14h to obtain the enzyme-treated pulp; The hydrogen peroxide treatment process: after the enzyme treatment is completed, EDTA is added to the pulp for chelation, and then the chelated pulp is obtained by washing and drying, and then H2O2 2~3%, MgSO4 0.1%, NaOH 1%, Na2SiO3 0.2% are added to the chelated pulp, and the treatment is carried out at 70°C and pH 11 for 2 hours.

Images