Application of AL807757.2 in the diagnosis of pulmonary hypertension

Abstract

The present invention discloses the application of AL807757.2 in diagnosing pulmonary hypertension. The present invention screens out the differentially expressed gene AL807757.2 by analyzing sequencing data, and further collects clinical samples for verification, proving that AL807757.2 is significantly downregulated in patients with chronic thromboembolic pulmonary hypertension and has a high diagnostic efficacy, providing a new direction for the diagnosis and treatment of pulmonary hypertension, and has broad application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular relates to the application of AL807757.2 in diagnosing pulmonary hypertension. Background Art

[0002] Pulmonary hypertension (PH) is a cardiovascular disease characterized by progressive increase in pulmonary vascular resistance and pulmonary vascular remodeling, which eventually leads to right heart failure or even death. When pulmonary artery pressure increases to a certain level, a series of changes will occur in the right ventricle of PH patients, such as hypertrophy, ventricular cavity enlargement, fibrosis, and metabolic changes. The body will use compensatory mechanisms to counteract the increased afterload of the heart, eventually leading to right heart failure in PH patients, and even endangering their lives.

[0003] Therefore, timely diagnosis of pulmonary hypertension is crucial for prompt and effective treatment of patients. Summary of the invention

[0004] To make up for the deficiencies of the prior art, the present invention provides the use of AL807757.2 in diagnosing pulmonary hypertension.

[0005] To achieve the above object, the present invention adopts the following technical solution:

[0006] A first aspect of the present invention provides use of a reagent for detecting the expression level of AL807757.2 in a sample in the preparation of a product for diagnosing pulmonary arterial hypertension.

[0007] Furthermore, the reagents include primers for specifically amplifying AL807757.2 and probes for specifically recognizing AL807757.2.

[0008] Furthermore, the sequences of the primers for specifically amplifying AL807757.2 are shown in SEQ ID NOs: 1 and 2.

[0009] Furthermore, the reagents also include reagents used to detect the expression level of AL807757.2 by reverse transcription PCR, real-time quantitative PCR, nucleic acid hybridization technology, nucleic acid amplification technology, sequencing technology, chromatography technology, mass spectrometry technology or chip technology.

[0010] Furthermore, the reagent also includes a detectable label.

[0011] Furthermore, the pulmonary hypertension is selected from pulmonary hypertension caused by pulmonary artery obstruction.

[0012] Furthermore, the pulmonary hypertension caused by pulmonary artery obstruction is chronic thromboembolic pulmonary hypertension.

[0013] Furthermore, the sample is selected from blood.

[0014] A second aspect of the present invention provides a product for diagnosing pulmonary arterial hypertension, the product comprising a reagent for detecting the expression level of AL807757.2 in a sample.

[0015] Furthermore, the product includes a test kit, a test paper or a chip.

[0016] Furthermore, the kit also includes instructions.

[0017] Furthermore, the kit also includes a buffer solution.

[0018] Furthermore, the pulmonary hypertension is selected from pulmonary hypertension caused by pulmonary artery obstruction.

[0019] Furthermore, the pulmonary hypertension caused by pulmonary artery obstruction is chronic thromboembolic pulmonary hypertension.

[0020] The third aspect of the present invention provides a method for screening candidate drugs for treating pulmonary arterial hypertension, the method comprising: treating a culture system expressing or containing the AL807757.2 gene or a protein encoded by it with a substance to be screened; and detecting the expression or activity of the AL807757.2 gene or a protein encoded by it in the system; wherein, when the substance to be screened promotes the expression level or activity of the AL807757.2 gene or a protein encoded by it, the substance to be screened is a candidate drug for treating pulmonary arterial hypertension.

[0021] Furthermore, the pulmonary hypertension is selected from pulmonary hypertension caused by pulmonary artery obstruction.

[0022] Furthermore, the pulmonary hypertension caused by pulmonary artery obstruction is chronic thromboembolic pulmonary hypertension.

[0023] The fourth aspect of the present invention provides the use of AL807757.2 as a target in screening candidate drugs for treating pulmonary arterial hypertension.

[0024] Furthermore, the method for screening candidate drugs for treating pulmonary arterial hypertension comprises: treating a culture system expressing or containing the AL807757.2 gene or a protein encoded by it with a substance to be screened; and detecting the expression or activity of the AL807757.2 gene or a protein encoded by it in the system; wherein, when the substance to be screened promotes the expression level or activity of the AL807757.2 gene or a protein encoded by it, the substance to be screened is a candidate drug for treating pulmonary arterial hypertension.

[0025] Furthermore, the pulmonary hypertension is selected from pulmonary hypertension caused by pulmonary artery obstruction.

[0026] Furthermore, the pulmonary hypertension caused by pulmonary artery obstruction is chronic thromboembolic pulmonary hypertension.

[0027] The fifth aspect of the present invention provides the use of AL807757.2 in the preparation of a medicament for treating pulmonary hypertension.

[0028] Furthermore, the drug also includes a pharmaceutically acceptable carrier.

[0029] Furthermore, the pulmonary hypertension is selected from pulmonary hypertension caused by pulmonary artery obstruction.

[0030] Furthermore, the pulmonary hypertension caused by pulmonary artery obstruction is chronic thromboembolic pulmonary hypertension.

[0031] A sixth aspect of the present invention provides the use of AL807757.2 in constructing a computational model for diagnosing pulmonary hypertension.

[0032] Furthermore, the pulmonary hypertension is selected from pulmonary hypertension caused by pulmonary artery obstruction.

[0033] Furthermore, the pulmonary hypertension caused by pulmonary artery obstruction is chronic thromboembolic pulmonary hypertension.

[0034] The seventh aspect of the present invention provides the use of AL807757.2 in constructing a system / device for diagnosing pulmonary hypertension.

[0035] Furthermore, the pulmonary hypertension is selected from pulmonary hypertension caused by pulmonary artery obstruction.

[0036] Furthermore, the pulmonary hypertension caused by pulmonary artery obstruction is chronic thromboembolic pulmonary hypertension.

[0037] Advantages and beneficial effects of the present invention:

[0038] The present invention screened out the differentially expressed gene AL807757.2 by analyzing sequencing data, and further collected clinical samples for verification, proving that AL807757.2 was significantly downregulated in patients with chronic thromboembolic pulmonary hypertension and had a high diagnostic efficacy, providing a new direction for the diagnosis and treatment of pulmonary hypertension and having broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 This is the ROC curve of AL807757.2 in the test set;

[0040] Figure 2 is the expression level graph of AL807757.2 in the validation set;

[0041] Figure 3 This is the ROC curve of AL807757.2 in the validation set. DETAILED DESCRIPTION

[0042] The definitions of some terms used in this specification are provided below. Unless otherwise defined, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0043] The present invention provides use of a reagent for detecting the expression level of AL807757.2 in a sample in the preparation of a product for diagnosing pulmonary hypertension.

[0044] In one embodiment, the expression level or level refers to the absolute or relative amount of AL807757.2. The expression level of AL807757.2 in the present invention can be determined by a variety of techniques, in particular, the absolute or relative amount of AL807757.2 can be detected by methods well known to those skilled in the art.

[0045] In one embodiment, diagnosis and its variations refer to the discovery, judgment or recognition of the health status or condition of an individual based on one or more signs, symptoms, data or other information related to the individual. The health status of an individual can be diagnosed as healthy / normal (i.e., the absence of a disease or illness), or can be diagnosed as unhealthy / abnormal (i.e., the presence of a disease or illness). Diagnosis includes early detection of disease in relation to a specific disease or illness; characterization or classification of a disease; discovery of the progression, cure or recurrence of a disease; discovery of the response to a disease after treatment or treatment of an individual.

[0046] The reagents include primers for specifically amplifying AL807757.2 and probes for specifically recognizing AL807757.2.

[0047] In one embodiment, primers refer to short nucleic acid molecules, such as DNA oligonucleotides, which can anneal to complementary target nucleic acid molecules through nucleic acid hybridization to form a hybrid between the primer and the target nucleic acid strand. Primers can be extended along the target nucleic acid molecule by a polymerase. Therefore, primers can be used to amplify target nucleic acid molecules, wherein the sequence of the primer is specific for the target nucleic acid molecule, such as the primer will hybridize to the target nucleic acid molecule under very high stringency hybridization conditions.

[0048] In one embodiment, the probe can be DNA, RNA, DNA-RNA chimera, PNA or other derivatives. The length of the probe is not limited, as long as it can achieve specific hybridization and specific binding to the target nucleotide sequence, any length is acceptable. The length of the probe can be as short as 25, 20, 15, 13 or 10 bases. Similarly, the length of the probe can be as long as 60, 80, 100, 150, 300 bases or longer, or even the entire gene.

[0049] In one embodiment, primers or probes can be chemically synthesized using phosphoramidite solid phase support methods or other well-known methods. Many means known in the art can also be used to modify. Non-limiting examples of these modifications include methylation, capping, displacement with one or more analogs of natural nucleotides and modifications between nucleotides. For example, modifying uncharged linkers (e.g., methyl phosphate, phosphotriester, phosphoramidite, carbamate, etc.), or modifying charged linkers (e.g., phosphorothioate, phosphorodithioate, etc.).

[0050] The reagent also includes a detectable label.

[0051] In one embodiment, detectable label refers to a composition that can produce a detectable signal indicating the presence of a target polynucleotide in a determination sample. Suitable detectable labels include, but are not limited to, radioisotopes, nucleotide chromophores, enzymes, substrates, fluorescent molecules, chemiluminescent moieties, magnetic particles, bioluminescent moieties. Therefore, labeling is any composition that can be detected by a device or method, including but not limited to spectroscopy, photochemistry, biochemistry, immunochemistry, electricity, optics, chemical detection devices or any other suitable device. In some embodiments, labeling can be detected visually without the aid of a device.

[0052] Among them, radioactive isotopes include but are not limited to 3 H. 14 C. 35 S. 125 I. 131 I.

[0053] Enzymes include, but are not limited to, horseradish peroxidase, beta-galactosidase, luciferase, alkaline phosphatase, acetylcholinesterase.

[0054] Fluorescent molecules include, but are not limited to, FITC, rhodamine, and lanthanide phosphors.

[0055] The products include test kits, test strips or chips.

[0056] In one embodiment, the kit further comprises instructions and a buffer. The instructions may include instructions for obtaining and processing samples. In addition, the kit may comprise genomic DNA of bacteria used as a positive control for PCR and sterile water used as a negative control.

[0057] The components of the test kit can be packaged in the form of an aqueous medium or in a lyophilized form. Suitable containers in the test kit usually include at least a vial, test tube, flask, syringe or other container, in which a component can be placed, and preferably, can be appropriately divided. When there is more than one component in the test kit, the test kit will usually also include a second, third or other additional container, in which additional components are placed separately. However, the components of different combinations can be contained in a vial. The test kit will also usually include a container for accommodating reactants, sealed for commercial sale. This container can include a plastic container of injection molding or blow molding, in which the required vial can be retained.

[0058] The solid support of the kit can be plastic, silicon wafer, metal, resin, glass, membrane, particle, precipitate, gel, polymer, sheet, ball, polysaccharide, capillary, film, plate or slide. The biological sample can be cell culture, cell line, tissue, oral tissue, gastrointestinal tissue, organ, organelle, biological fluid, serum sample, urine sample or skin.

[0059] In one embodiment, the chip comprises a solid support of connected nucleic acid or peptide probes. The array generally comprises a plurality of different nucleic acid or peptide probes connected to the substrate surface according to different known positions. Generally, mechanical synthesis methods or light-guided synthesis methods can be used to produce, and the light-guided synthesis method combines photolithography and solid phase synthesis methods. The array can comprise a flat surface, or can be a nucleic acid or peptide on a bead, gel, polymer surface, fiber such as an optical fiber, glass or any other suitable substrate. The array can be packaged in a certain manner to allow the diagnosis of a fully functional device or other manipulations.

[0060] In one embodiment, pulmonary hypertension includes idiopathic pulmonary arterial hypertension (PAH), pulmonary arterial hypertension caused by left heart disease, pulmonary arterial hypertension caused by lung disease / hypoxia, pulmonary arterial hypertension caused by pulmonary artery obstruction, and pulmonary arterial hypertension caused by unknown or multiple factors.

[0061] Among them, idiopathic pulmonary hypertension includes heritable PH, PH caused by drugs and toxins, primary PH related to other diseases (connective tissue disease, HIV infection, portal hypertension, congenital heart disease, schistosomiasis, etc.), primary pulmonary hypertension with obvious venous / capillary involvement, and persistent pulmonary hypertension of the newborn.

[0062] Pulmonary hypertension caused by left heart disease includes PH caused by heart failure with preserved ejection fraction, PH caused by heart failure with reduced ejection fraction, post-capillary PH caused by congenital / acquired cardiovascular disease, and PH related to valvular heart disease.

[0063] Pulmonary hypertension caused by lung disease / hypoxia, such as chronic obstructive pulmonary disease, idiopathic pulmonary fibrosis and mixed lung disease. In addition, pulmonary hypoxia without lung disease can also cause PH.

[0064] Pulmonary hypertension caused by pulmonary artery obstruction, such as chronic thromboembolic pulmonary hypertension (CTEPH).

[0065] PH of unknown cause or multifactorial cause, such as blood system diseases, systemic and metabolic diseases, and other systemic diseases.

[0066] In a preferred embodiment, the pulmonary hypertension is selected from pulmonary hypertension caused by pulmonary artery obstruction.

[0067] In a specific embodiment, the pulmonary hypertension caused by pulmonary artery obstruction is chronic thromboembolic pulmonary hypertension.

[0068] The present invention provides application of AL807757.2 in constructing a system / device for diagnosing pulmonary hypertension.

[0069] The system / device comprises:

[0070] Acquisition unit: used to obtain the expression level of AL807757.2 in the sample;

[0071] Processing unit: used for obtaining a result of diagnosing pulmonary hypertension according to the expression level of AL807757.2.

[0072] If the expression level of AL807757.2 is significantly downregulated, pulmonary hypertension is diagnosed.

[0073] In one embodiment, the implementation of the system may include performing or completing selected tasks manually, automatically, or a combination thereof. Moreover, actual instruments and devices according to embodiments of the system of the present invention may implement multiple selected tasks using an operating system by hardware, by software, or by firmware, or by a combination thereof.

[0074] For example, the hardware for performing the selected task can be a chip or a circuit. As software, the selected task can be implemented as a plurality of software instructions executed by a computer using any suitable operating system. In the present invention, one or more tasks according to the exemplary embodiments of the method and / or system as described in the present invention can be performed by a processing unit, such as a computing platform for executing a plurality of instructions. Optionally, the processing unit includes a volatile memory for storing instructions and / or data, and / or a non-volatile memory for storing instructions and / or data, for example, a magnetic hard disk and / or a removable medium. Optionally, a network connection is also provided. A display and / or a user input device such as a keyboard or a mouse are also optionally provided.

[0075] The invention will be further described below in conjunction with specific examples. It should be understood that the specific embodiments described herein are presented by way of example and are not intended to limit the invention. The main features of the invention may be used in a variety of embodiments without departing from the scope of the invention.

[0076] Example

[0077] 1. Experimental Materials

[0078] Test set: sequencing data of 7 CTEPH patients and 5 healthy volunteers.

[0079] Validation set: 28 CTEPH patients and 30 healthy samples.

[0080] Inclusion criteria:

[0081] CTEPH was diagnosed by right heart catheterization (RHC) combined with lung ventilation and perfusion scanning and computed tomographic pulmonary angiography (CTPA).

[0082] All healthy volunteers were from the Health Examination Center of the China-Japan Friendship Hospital, with normal lung and liver functions, routine blood and urine tests, thyroid hormone levels, and electrocardiograms.

[0083] Exclusion criteria:

[0084] 1) Patients who underwent balloon pulmonary angioplasty (BPA).

[0085] 2) Patients without complete RHC data or who received PEA before blood sample collection.

[0086] 3) Participants with other types of pulmonary hypertension, smoking, chronic obstructive pulmonary disease, obstructive sleep apnea syndrome, asthma, infection, interstitial lung disease, connective tissue disease, endocrine disease, hypertension, diabetes, coronary heart disease, cardiomyopathy, congenital heart disease, malignant tumors, hepatitis and cirrhosis, nephritis and renal failure.

[0087] 2. Experimental methods

[0088] RNA extraction and library construction

[0089] For whole blood samples Total RNA was extracted with reagents, and the RNA concentration and purity were detected by Nanodrop 2000. The RNA integrity was detected by agarose gel electrophoresis, and the RNA integrity number (RIN) was determined by Agilent 2100. The total amount of RNA required for single library construction was 5 μg, and the RNA concentration should be ≥200 ng / μL, and the optical density (OD) value should be between 1.8 and 2.0. DNA fragments in the total RNA sample were digested with DNase I, and the reaction products were purified and recovered with magnetic beads, and rRNA was removed from the total RNA sample after digestion. The RNA sample obtained in the previous step was placed in a polymerase chain reaction (PCR) instrument for heat blocking, and single-stranded cDNA and double-stranded cDNA with dUTP were synthesized in the PCR instrument. Subsequently, end repair and sequencing connector connection were performed, and finally PCR amplification was performed to complete library preparation.

[0090] Sequencing and raw data processing

[0091] The library quality was tested using Agilent 2100 Bioanalyzer and ABI StepOnePlus Real-Time PCR System, and qualified libraries were sequenced using the PE100 strategy on the BGIseq platform. The sequencing data was quality controlled using "FASTP", including the removal of adapter sequences, 5' fragments, 3' fragments, bases with a quality of <20, and reads with N>10%. In the transcriptome sequencing data, only data aligned with the reference genome can be used for subsequent analysis. The high-quality sequencing sequences obtained after quality control were analyzed using HISAT2

[0092] (https: / / ccb.jhu.edu / software / hisat2 / index.shtml) was compared with the specified reference genome, which was from the Ensembl database, with the genome version of GRCh38 and the gene annotation information of Ensemble92. Stringtie (http: / / ccb.jhu.edu / software / stringtie / ) was used to quantitatively analyze the expression of lncRNA and standardize the output results. Based on the alignment results of HISAT2 software, Stringtie calculated the exon model kilobase fragment number (FPKM) value of each gene / transcript in the sample per million mapped reads, and used this value as the expression level of the gene / transcript in the sample.

[0093] Differential analysis of lncRNA

[0094] First, the raw read counts were standardized, and then the hypothesis test probability (p-value) was calculated using a statistical model, and then multiple hypothesis testing correction (Benjiamini and Hochberg method) was performed to obtain the corrected p-value (false discovery rate, FDR). The DESeq2 package in R was used to screen genes with significant differences between different samples, with p<0.05 and |log2 fold change| (|log2FC|)>1 as the differential expression screening criteria for lncRNA.

[0095] Primer design

[0096] Real Time PCR detection target gene primers are as follows:

[0097] AL807757.2-F: CTGAAGTCACATGGGGCACT (SEQ ID NO: 1);

[0098] AL807757.2-R: TATCTGCAGGGTGTGAGGGA (SEQ ID NO: 2).

[0099] Extract total RNA from samples

[0100] 1) Add 0.75 mL MagZol LS Reagent to the EP tube, then add 0.25 mL blood sample, mix by pipetting 3-5 times, then vortex mix for more than 15 seconds to completely disperse the precipitate, and leave at room temperature for 5-10 minutes.

[0101] 2) Add 0.2 mL of chloroform, shake vigorously for 15 seconds, and place on ice for 10 minutes.

[0102] 3) Centrifuge at 12000 rpm for 10 min at 4°C. The sample will separate into three layers: a lower organic phase, a middle layer, and an upper colorless aqueous phase. RNA is present in the upper aqueous phase. The volume of the aqueous phase is approximately 70% of the added RLS volume. Transfer the aqueous phase to a new tube and proceed to the next step.

[0103] 4) Add 1.5 times the volume of anhydrous ethanol, vortex mix for 15 seconds, and purify the RNA through a column (the following centrifugation is performed at room temperature).

[0104] 5) Place the HiPure Viral Mini Column in a 2 mL collection tube. Transfer half of the mixed solution to the column, centrifuge at 12,000 rpm for 60 seconds, discard the waste liquid, and put the adsorption column back into the collection tube. Transfer the remaining mixed solution to the column, centrifuge at 12,000 rpm for 60 seconds. Discard the waste liquid and put the adsorption column back into the collection tube.

[0105] 6) Add 350 μL Buffer RWC to the column and centrifuge at 12000 rpm for 60 seconds. Discard the waste liquid and put the adsorption column back into the collection tube.

[0106] 7) Add 500 μL Buffer RW2 to the column and centrifuge at 12000 rpm for 60 seconds. Discard the waste liquid and put the adsorption column back into the collection tube.

[0107] 8) Repeat step 7), discard the waste liquid, put the adsorption column back into the collection tube, and centrifuge at 13000 rpm for 3 minutes to dry the matrix of the column.

[0108] 9) Transfer the column to a 1.5 mL centrifuge tube, add 30-50 μL RNase free water to the middle of the adsorption membrane according to the expected RNA yield, place at room temperature for 2 minutes, and centrifuge at 13,000 rpm for 1 minute.

[0109] 10) Discard the RNA column and store the RNA sample at -80°C.

[0110] Reverse transcription to synthesize mRNA cDNA

[0111] The FastQuant cDNA First-Strand Synthesis Kit (Cat. No. KR106) was used for mRNA reverse transcription. First, the genomic DNA reaction was removed, and 2.0 μL of 5×gDNA Buffer and 1 μg of TotalRNA were added to the test tube. RNase Free ddH2O was added to make the total volume 10 μL, and the mixture was heated at 42°C for 3 min in a water bath. Then, 2.0 μL of 10×Fast RT Buffer, 1.0 μL of RTEnzyme Mix, 2.0 μL of FQ-RT Primer Mix, and 5.0 μL of RNase Free ddH2O were mixed and added to the above test tube to mix together for a total of 20 μL. The mixture was heated at 42°C for 15 min and at 95°C for 3 min in a water bath. If the synthesized cDNA needs to be stored for a long time, it should be stored at -20°C or lower.

[0112] Real-Time PCR

[0113] Gene-9660 fluorescence quantitative PCR instrument was used. -△△CT Relative quantitative analysis of the data was performed.

[0114] 1) Reaction system: Use SuperReal PreMix Plus (SYBR Green) (Cat. No.: FP205) for amplification, and perform the experimental operation according to the product manual. The Real Time PCR reaction system is shown in Table 1.

[0115] Table 1 Real Time PCR reaction system

[0116] Reagents Usage 2×SuperReal PreMix Plus 10μL Upstream primer (10 μM) 0.6μL Downstream primer (10 μM) 0.6μL <![CDATA[50×ROX Reference Dye △ ]]> 2μL DNA template 2μL Sterile distilled water 4.8μL

[0117] 2) The amplification program was: 95°C for 15 min, (95°C for 10 sec, 55°C for 30 sec, 72°C for 32 sec) × 40 cycles, 95°C for 15 sec, 60°C for 60 sec, 95°C for 15 sec.

[0118] 3) Primer screening

[0119] After mixing the cDNA of each sample, use it as a template for 3-10 times gradient dilution. Take 2 μL of each diluted sample as a template and amplify with target gene primers and internal reference gene primers respectively. At the same time, perform melting curve analysis at 60-95°C, and screen primers based on high amplification efficiency and single peak of melting curve.

[0120] 4) Real Time PCR detection of samples

[0121] After diluting the cDNA of each sample 3-10 times, 2 μL was taken as a template and amplified using target gene primers and internal reference gene primers (Table 2). At the same time, melting curve analysis was performed at 60-95°C.

[0122] Table 2 Sample RealTime PCR detection design

[0123] template Sample cDNA Sample cDNA Repeated detection channel number 3 3 Primers Target gene primers Internal reference gene primers

[0124] 3. Experimental results

[0125] The ROC curve analysis of AL807757.2 in the training set showed that its AUC was 0.843 ( Figure 1 ), which has a high diagnostic efficacy.

[0126] In the validation set, AL807757.2 was significantly downregulated in CTEPH ( Figure 2 ), ROC curve analysis showed that its AUC was 0.801( Figure 3 ), which has a high diagnostic efficacy.

[0127] The description of the above embodiments is only used to understand the method and core idea of ​​the present invention. It should be pointed out that, for those skilled in the art, several improvements and modifications can be made to the present invention without departing from the principle of the present invention, and these improvements and modifications will also fall within the scope of protection of the claims of the present invention.

Claims

1. Use of a reagent for detecting the expression level of AL807757.2 gene in a sample in the preparation of a product for diagnosing pulmonary hypertension, wherein the pulmonary hypertension is chronic thromboembolic pulmonary hypertension, The expression level of AL807757.2 gene is significantly downregulated in patients with chronic thromboembolic pulmonary hypertension. The reagent includes primers for specifically amplifying AL807757.2 and probes for specifically recognizing AL807757.

2.

2. The use according to claim 1, characterized in that: The sequences of the primers for specifically amplifying AL807757.2 are shown in SEQ ID NO:1 and SEQ ID NO:

2.

3. The use according to claim 1, characterized in that: The reagents also include reagents used to detect the expression level of AL807757.2 by reverse transcription PCR and real-time quantitative PCR.

4. The use according to claim 1, characterized in that: The reagent also includes a detectable label.

5. The use according to claim 1, characterized in that: The sample is selected from blood.

6. A product for diagnosing pulmonary hypertension, characterized in that: The product includes a reagent for detecting the expression level of the AL807757.2 gene in a sample, the pulmonary hypertension is chronic thromboembolic pulmonary hypertension, and the reagent includes primers for specifically amplifying AL807757.2, and the sequences of the primers for specifically amplifying AL807757.2 are shown in SEQ ID NO:1 and SEQ ID NO:

2.

7. The product according to claim 6, characterized in that The product includes a test kit, a test paper or a chip.

8. The product according to claim 7, characterized in that The kit also includes instructions.

9. The product according to claim 7, characterized in that The kit also includes a buffer.

Images