Application of arabidopsis thaliana cpk12 gene in improving plant tolerance to cadmium

By overexpressing the Arabidopsis thaliana CPK12 gene in plants, the problem of insufficient cadmium resistance in plants was solved, and a significant improvement in cadmium resistance was achieved, providing a theoretical basis for the cultivation of cadmium-tolerant crops.

CN118685418BActive Publication Date: 2025-12-16SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410555587.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-07
Publication Date
2025-12-16
Estimated Expiration
2044-05-07

AI Technical Summary

Technical Problem

Existing technologies have failed to effectively utilize the Arabidopsis thaliana CPK12 gene to enhance cadmium resistance in plants, and cadmium pollution seriously threatens the safety of farmland and the food chain.

Method used

Using genetic engineering techniques, an overexpression vector of the Arabidopsis thaliana CPK12 gene was transformed into plants. The overexpression of the Arabidopsis thaliana CPK12 gene was driven by the 35SPPDK promoter, resulting in homozygous overexpression lines of the Arabidopsis thaliana CPK12 gene.

Benefits of technology

It significantly improved the cadmium resistance of plants and enhanced their tolerance to cadmium, laying a theoretical foundation for cultivating cadmium-tolerant and high-yielding crop varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118685418B_ABST
    Figure CN118685418B_ABST
Patent Text Reader

Abstract

The application discloses application of Arabidopsis thaliana CPK12 gene in improving plant cadmium tolerance and resistance. The application obtains an RNAi vector and an overexpression vector of the Arabidopsis thaliana CPK12 gene through genetic engineering technology, and thereby obtains RNAi strains and overexpression strains of the Arabidopsis thaliana, and finally obtains homozygous strains of the RNAi and overexpression of the Arabidopsis thaliana CPK12 gene after screening. It is found through a phenotype experiment that the root length of the RNAi strain is shorter than that of the wild type, and the root length of the overexpression strain is longer than that of the wild type under cadmium treatment, which indicates that the Arabidopsis thaliana CPK12 gene plays a function in plant cadmium tolerance and resistance. The application confirms through experiments that the Arabidopsis thaliana CPK12 gene has potential application value in plant cadmium tolerance and resistance, and provides a theoretical basis and guiding value for cultivating cadmium-tolerant crop varieties by using the Arabidopsis thaliana CPK12 gene.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant genetic engineering, and particularly relates to application of Arabidopsis thaliana CPK12 gene in improving plant cadmium tolerance. BACKGROUND

[0002] Cadmium (Cd) is a non-essential element for organisms and has strong physiological toxicity to organisms. Its pollution characteristics are strong concealment, easy to enter farmland with irrigation water, atmospheric deposition, and application of cadmium-containing fertilizers, and long-term accumulation, and it is a common heavy metal element in contaminated farmland. With the development of industry, the application of "three wastes", phosphorus fertilizer and organic fertilizer containing cadmium, sewage irrigation and sludge farming, cadmium pollution in rice fields is becoming increasingly serious, and cadmium is easily absorbed and accumulated by rice, which not only produces toxicity to rice itself, but also can harm human health and other animals through the food chain. With the continuous reduction of arable land and the continuous growth of population, it is of great practical significance to study the mechanism of cadmium tolerance of crops and breed cadmium-tolerant varieties for the development and effective use of land.

[0003] The genes in the Arabidopsis thaliana CDPK family are closely related to plant signal transduction pathways and participate in stress response, but there is no report on the application of CPK12 gene in improving plant cadmium tolerance. SUMMARY

[0004] The application provides application of Arabidopsis thaliana CPK12 gene in improving plant cadmium tolerance.

[0005] The application adopts the following technical solutions:

[0006] The application of Arabidopsis thaliana CPK12 gene in improving plant cadmium tolerance, wherein the nucleotide sequence of the Arabidopsis thaliana CPK12 gene is shown in SEQ ID NO: 1.

[0007] Preferably, the overexpression vector containing the Arabidopsis thaliana CPK12 gene is transformed into plants by inflorescence infection method to obtain plants with cadmium tolerance.

[0008] Preferably, the overexpression vector comprises pFGC-pHBT-CPK12.

[0009] Preferably, the method for obtaining the overexpression vector comprises:

[0010] The Arabidopsis thaliana CPK12 gene is connected to the pFGC-pHBT plasmid, and the overexpression vector is obtained by driving the 35SPPDK promoter.

[0011] Preferably, the amplification primer of the Arabidopsis thaliana CPK12 gene comprises:

[0012] CPK12-F: CTTGCTCCGTGGATCCATGGCGAACAAACCAAGA;

[0013] CPK12-R:

[0014] TGCTCACCATGGATCCGACATTCATAGACTCATCAGGAAG.

[0015] Compared with the prior art, the beneficial effects of the present application are: the present application overexpresses Arabidopsis thaliana CPK12 gene through genetic engineering technology, then obtains an overexpression vector, transforms the vector into a plant strain, and obtains an Arabidopsis thaliana CPK12 gene overexpression homozygous strain through screening, thereby significantly improving the plant cadmium tolerance resistance. The present application confirms for the first time that the Arabidopsis thaliana CPK12 gene can improve the cadmium tolerance resistance of plants, and in view of the application of the CPK12 gene in cadmium tolerance resistance, it can be considered that the Arabidopsis thaliana CPK12 gene has potential application value in improving the cadmium tolerance resistance of plants, and the present application also lays a good theoretical and application foundation for cultivating cadmium-tolerant and high-yield crop varieties by using the Arabidopsis thaliana CPK12 gene. BRIEF DESCRIPTION OF DRAWINGS

[0016] The drawings incorporated into the specification and constituting a part of the specification show embodiments consistent with the present application and, together with the specification, serve to explain the principles of the present application.

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or the prior art description will be briefly introduced below, and obviously, other drawings can also be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0018] In the drawings:

[0019] Figure 1 : Expression detection diagram of CPK12 RNAi strain CPK12-RNAi#1 and CPK12 overexpression strain CPK12-OE#1;

[0020] Figure 2 : Growth of wild type strain Col-0, CPK12 RNAi strain CPK12-RNAi#1 and CPK12 overexpression strain CPK12-OE#1 under Cd treatment;

[0021] Figure 3 : Root length change of wild type strain Col-0, CPK12 RNAi strain CPK12-RNAi#1 and CPK12 overexpression strain CPK12-OE#1 under Cd treatment;

[0022] Figure 4 Figure 4: Fresh weight changes of wild type line Col-0, CPK12 RNAi line CPK12-RNAi#1 and CPK12 overexpression line CPK12-OE#1 under Cd treatment. DETAILED DESCRIPTION

[0023] The following examples are intended to illustrate the present application but not to limit the scope of the present application. Modifications or substitutions of the methods, steps or conditions of the present application, without departing from the spirit and essence of the present application, all belong to the protection scope of the present application. If not specifically indicated, the experimental materials, reagents, instruments and the like used in the examples of the present application can be commercially available; if not specifically indicated, all the technical means in the examples of the present application are conventional means known to those skilled in the art.

[0024] Example 1: Obtaining of Arabidopsis thaliana CPK12 RNAi line CPK12-RNAi#1 and CPK12 overexpression line CPK12-OE#1

[0025] I. Arabidopsis thaliana CPK12 gene

[0026] The CDS sequence of CPK12 gene was obtained in Arabidopsis thaliana database, which has a length of 1473 bp, encodes a protein containing 490 amino acids, and the nucleotide sequence of the gene is shown as SEQ ID NO: 1, specifically as follows:

[0027]

[0028] II. Obtaining of Arabidopsis thaliana CPK12 RNAi line CPK12-RNAi#1 and CPK12 overexpression line CPK12-OE#1

[0029] 1. Obtaining of Arabidopsis thaliana CPK12 gene overexpression line

[0030] (1) Construction of overexpression vector of CPK12 driven by constitutive expression promoter 35SPPDK (35SPPDK: : CPK12): According to the CDS sequence of Arabidopsis thaliana CPK12 gene, gene-specific primers were designed, the sequences of which are as follows (5'-3'):

[0031] CPK12-F: CTTGCTCCGTGGATCCATGGCGAACAAACCAAGA (SEQ ID NO: 2);

[0032] CPK12-R:

[0033] TGCTCACCATGGATCCGACATTCATAGACTCATCAGGAAG (SEQ ID NO: 3);

[0034] The CPK12 gene was amplified by PCR technology, and the amplification product was recovered and purified. The pFGC-pHBT plasmid was digested by restriction enzyme BamHI, and the CPK12 gene was cloned into the pFGC-pHBT plasmid to obtain the pFGC-pHBT-CPK12 recombinant plasmid driven by the promoter 35SPPDK.

[0035] (2) The pFGC-pHBT-CPK12 recombinant plasmid was subjected to plasmid PCR sequencing confirmation;

[0036] (3) The overexpression vector pFGC-pHBT-CPK12 was transformed into the Agrobacterium GV3101 competent cells, and then transformed into Arabidopsis thaliana by inflorescence infection method to obtain the CPK12 gene overexpression line.

[0037] 2. Obtaining of Arabidopsis thaliana CPK12 gene RNAi line

[0038] (1) Construction of RNAi vector of CPK12 driven by constitutive expression promoter CaMV35S (CaMV35S: : CPK12): According to the CDS sequence of 242 bp fragment specific to Arabidopsis thaliana CPK12 gene (7-249 bp of CPK12 coding sequence) and its corresponding antisense fragment, gene-specific primers were designed, the sequences of which are as follows (5'-3'):

[0039] CPK12-RNAi-F:

[0040] AGAGGACACGCTCGAGAACAAACCAAGAACCAGATGG (SEQ ID NO: 4);

[0041] CPK12-RNAi-R:

[0042] TTGGGGTACCGAATTCAACGTTGGGGTATTCAGACA (SEQ ID NO: 5);

[0043] antisense-CPK12-RNAi-F:

[0044] CGATAAGCTTGGATCCAACGTTGGGGTATTCAGACA (SEQ ID NO: 6);

[0045] antisense-CPK12-RNAi-R:

[0046] AAAGCAGGACTCTAGAAACAAACCAAGAACCAGATGG (SEQ ID NO: 7);

[0047] The 242 bp fragment specific to CPK12 gene (7-249 bp of CPK12 coding sequence) and its corresponding antisense fragment are amplified by PCR technology, and the amplification products are recovered and purified. The pFGC-pHANNIBAL plasmid is digested with restriction enzymes Xho I / Eco RI and Hind III / Xba I, respectively, and the 242 bp fragment specific to CPK12 gene (7-249 bp of CPK12 coding sequence) and its corresponding antisense fragment are cloned into the pFGC-pHANNIBAL vector to obtain the pFGC-pHANNIBAL-CPK12 recombinant plasmid. Specifically, the 242 bp fragment specific to the Arabidopsis CPK12 gene (7-249 bp of CPK12 coding sequence) and its corresponding antisense fragment are connected to the Xho I-Eco RI and Hind III-Xba I sites of the vector plasmid, respectively, to obtain the recombinant plasmid.

[0048] (2) The pFGC-pHANNIBAL-CPK12 recombinant plasmid is subjected to plasmid PCR sequencing confirmation.

[0049] (3) The RNAi vector pFGC-pHANNIBAL-CPK12 is transformed into the Agrobacterium GV3101 competent cells, and then transformed into Arabidopsis thaliana by the inflorescence infection method to obtain the CPK12 gene RNAi strain.

[0050] 3. Screening of CPK12 transgenic positive homozygous strain

[0051] (1) Seeds of single plants that have been infected with the CPK12 gene RNAi line or overexpression line are used as T0 generation;

[0052] (2) T0 generation seeds were cultured on a medium containing herbicide (0.001% glufosinate), and green seedlings were selected and cultured in nutrient soil medium. Seeds received from a single plant were T1 generation.

[0053] (3) T1 generation seeds were cultured on a medium containing herbicide, and green seedlings from the offspring with a green seedling: yellow seedling segregation ratio of 3:1 were selected and planted in nutrient soil medium. Seeds received from a single plant were T2 generation.

[0054] (4) T2 generation seeds were cultured on a medium containing herbicide. Lines with green seedlings in their offspring were selected and planted in nutrient soil medium. The seeds obtained were the seeds of CPK12 gene RNAi line or homozygous transgenic line overexpressing the gene, and were named CPK12-RNAi#1 and CPK12-OE#1, respectively.

[0055] 3. RT-qPCR detection

[0056] RT-qPCR experiments were performed on the leaves of plants from transgenic homozygous lines positive for the CPK12 gene. The primers used in the RT-qPCR experiment were (5'-3'):

[0057] CPK12-qRT-F:GAGAGTGCGTACGAGGACAC(SEQ ID NO:8)

[0058] CPK12-qRT-R:AGAGAGTGACACGCCTCAAC(SEQ ID NO:9)

[0059] The results show that... Figure 1 As shown, the CPK12 gene exhibits high expression levels in the homozygous overexpression line CPK12-OE#1 and low expression levels in the RNAi homozygous line CPK12-RNAi#1. Therefore, this line was selected for subsequent studies. After one-way ANOVA test, different significance levels were marked with different numbers of asterisks (**, p<0.01; ***, p<0.001).

[0060] Example 2: Functional analysis of Arabidopsis thaliana CPK12 under cadmium treatment

[0061] 1. Preparation of culture medium

[0062] (1) Preparation of 1 / 2MS medium for plant tissue culture: weigh MS powder 2.22 g / L, sucrose 10 g / L, MES 0.5 g / L, dissolve in pure water and make up, adjust PH to 5.8, add agar 7 g / L;

[0063] (2) Sterilization: 121℃, 20min high pressure sterilization;

[0064] (3) After the medium is sterilized, when the medium is cooled to 50-60℃, it is placed in a clean bench, 1 / 2MS medium containing cadmium is added with 100mM cadmium chloride stock solution, so that the final concentration of cadmium in the medium is 100μM. Pour the medium into a 13cm plastic square dish, about 50ml per square dish. After the medium solidifies, it is sealed in a sterile bag for use.

[0065] 2. Seed disinfection

[0066] Select the same period, uniform size, full grain of Arabidopsis thaliana wild type (Col-0), CPK12 RNAi strain CPK12-RNAi#1 and CPK12 overexpression strain CPK12-OE#1 seeds in 1.5mL centrifuge tube, add 1mL 75% alcohol (containing 0.1% Tween 20), rotate for 15 minutes, wash with sterile water 3-5 times in a clean bench.

[0067] 3. Cadmium treatment and root length measurement

[0068] Disinfected seeds are placed on 1 / 2MS medium containing 100μM Cd2+ and without Cd2+. Put in 4℃ cold treatment for 3 days, 16h (light) / 8h (dark) culture. Wild type, CPK12 RNAi strain and overexpression strain are cultured for 14d, then take photos, measure root length and weigh fresh weight.

[0069] 4. Experimental results

[0070] As shown in Figure 2 and Figure 3 , under the condition of no Cd treatment, there is no significant difference in the growth of wild type and CPK12 RNAi strain or overexpression strain. However, under the condition of Cd treatment, the root length of CPK12 gene RNAi strain is shorter than that of wild type, and the root length of overexpression strain is significantly longer than that of wild type.

[0071] As shown in Figure 4As shown, the relative fresh weight of the CPK12 gene RNAi strain is obviously less than that of the wild type, and the relative fresh weight of the overexpression strain is greater than that of the wild type. The relative fresh weight is the ratio of the fresh weight of the seedling after Cd treatment to the fresh weight of the seedling without cadmium treatment. The different significance levels are marked by different number of asterisks (*, p<0.05; **, p<0.01; ***, p<0.001) by single factor ANOVA test. These results show that the loss of function of CPK12 leads to the decrease of the tolerance of Arabidopsis to cadmium, and the overexpression of CPK12 enhances the tolerance of Arabidopsis to cadmium, i.e., CPK12 positively regulates the cadmium tolerance.

[0072] The present application overexpresses the CPK12 gene by genetic engineering technology, then obtains an overexpression vector, transforms the vector into an Arabidopsis strain, and obtains a homozygous strain of the CPK12 gene overexpression by screening, thereby significantly improving the ability of plant cadmium tolerance and resistance. The present application confirms for the first time that the Arabidopsis CPK12 gene can improve the cadmium tolerance and resistance of plants, and in view of the application of the CPK12 gene in cadmium tolerance and resistance, it can be considered that the gene has potential application value for improving the cadmium tolerance and resistance of plants. Meanwhile, the present application also lays a good theoretical and application foundation for cultivating cadmium-tolerant and high-yield crop varieties by using the CPK12 gene.

[0073] It can be understood that the above examples only express the preferred embodiments of the present application, which are described in detail and specifically, but cannot be understood as limiting the scope of the patent of the present application; it should be pointed out that for ordinary skilled in the art, the above technical features can be freely combined without departing from the concept of the present application, and several modifications and improvements can be made, which all belong to the protection scope of the present application; therefore, any equivalent transformation and modification within the scope of the claims of the present application should belong to the scope of the claims of the present application.

Claims

1. The use of Arabidopsis CPK12 gene in improving the cadmium tolerance of plants, characterized in that, The nucleotide sequence of the Arabidopsis CPK12 gene is shown as SEQ ID NO: 1; the plant is Arabidopsis, and the Arabidopsis CPK12 gene is overexpressed in the plant.

2. Use according to claim 1, characterized in that, An overexpression vector containing the Arabidopsis CPK12 gene is transformed into a plant by inflorescence infection to obtain a plant with cadmium tolerance.

3. Use according to claim 2, characterized in that, The overexpression vector comprises pFGC-pHBT-CPK12.

4. Use according to claim 3, characterized in that, The method for obtaining the overexpression vector comprises: connecting the Arabidopsis CPK12 gene to a pFGC-pHBT plasmid, and obtaining the overexpression vector driven by a 35SPPDK promoter.

5. Use according to claim 4, characterized in that, The amplification primer of the Arabidopsis CPK12 gene is: CPK12-F: CTTGCTCCGTGGATCCATGGCGAACAAACCAAGA; CPK12-R: TGCTCACCATGGATCCGACATTCATAGACTCATCAGGAAG.

Citation Information

Patent Citations

  • Salt-resistant and drought-resistant CPK (creatine phosphokinase) protein kinase gene derived from arabidopsis thaliana

    CN102108364A

  • Mulberry calcium dependent protein kinase as well as coding gene and application thereof

    CN111454925A