A gene LrCYP1, an antimicrobial protein of cyclophilin from Lilium minjiangense, and its application.

Abstract

This invention discloses a Cyclophilin antibacterial protein gene from the Minjiang lily. LrCYP1 Its nucleotide sequence is as described in SEQ ID NO: 1, encoding a protein with the amino acid sequence shown in SEQ ID NO: 2. This invention confirms through functional genomics-related research. LrCYP1 The gene has the function of enhancing plant antifungal resistance, and the antifungal properties of this invention... LrCYP1 Genes were constructed into plant expression vectors and overexpressed in tobacco. The transgenic tobacco plants exhibited strong resistance to fungal infection, demonstrating the effectiveness of overexpression. LrCYP1 The genetically modified tobacco plants exhibit high levels of resistance to Alternaria alternata and Pseudomonas spp.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and genetic engineering, specifically to a cyclophilin gene from the Minjiang lily with antifungal resistance. LrCYP1 and its applications. Background Technology

[0002] Plants are susceptible to various diseases during their growth, among which fungal diseases caused by pathogenic fungi are the most serious. Currently, agriculture still relies on chemical fungicides to control plant fungal diseases. However, chemical control not only negatively impacts ecosystems, human and animal health, but also leads to pathogen resistance to chemical pesticides, making fungal diseases increasingly difficult to control. Therefore, developing an eco-friendly, green control method is imperative for controlling plant fungi. With the rapid development of biotechnology, using genetic engineering to cultivate disease-resistant new varieties can not only overcome many drawbacks of chemical control methods but also minimize damage to beneficial microorganisms in the soil, achieving sustainable agricultural development. For example, using transgenic technology, the novel antibacterial cyclodextrin glycosyltransferase gene CGTase from Bacillus cereus can be introduced into cotton (…). Gossypium hirsutum It can inhibit Verticillium dahliae ( ) Verticillium dahliae Mycelial growth, spore germination, transgenic Arabidopsis thaliana overexpressing CGTase ( Arabidopsis thaliana It exhibits higher resistance to Verticillium wilt (Zhou J, Feng Z, Liu S, et al. CGTase, a novel antimicrobial protein from Bacillus Cereus YUPP-10, suppresses Verticillium dahliae and mediates plant defense responses. Molecular Plant Pathology, 2021, 22(1):130-144.).

[0003] Antimicrobial proteins (AFPs) are a class of defensive proteins with antimicrobial activity developed by plants during long-term evolution, and are an important component of the body's innate immune system. Many antimicrobial proteins have been shown to participate in the plant's defense response against pathogens (Bártová V, Bárta J, Jarošová M. Antifungal and antimicrobial proteins and peptides of potato). Solanum tuberosumL.)tubers and their applications. Applied Microbiology and Biotechnology, 2019, 103(14): 5533-5547.). Cyclophilins (CyPs) are antimicrobial proteins with peptidyl-prolyl cis-trans isomerase activity (PPIase) (Takahashi N, Hayano T, Suzuki M. Peptidyl-prolyl cis-trans isomerase is the cyclosporin A-binding protein cyclophilin. Nature, 1989, 337(6206): 473-475.). In Arabidopsis, CyPs and CyPs-like proteins are distributed in all subcellular compartments and participate in a variety of physiological processes, including transcriptional regulation, photosynthesis and hormone signaling pathways, stress adaptation and defense responses (Barbosa Dos Santos I, ParkSW. Versatility of Cyclophilins in Plant Growth and Survival: A Case Study in Arabidopsis. Biomolecules, 2019, 9(1): 20.).

[0004] chili( Capsicum annuum Cyclic proteins CACYP1 mRNA is expressed in various tissues and parts of pepper plants. To determine the expression of mRNA in pepper leaves... CACYP1 Does it respond to Colletotrichum anthrax ( Colletotrichum gloeosporioides The infection was analyzed within 24 hours after inoculation with *Colletotrichum gloeosporioides*. CACYP1 The expression levels of [the substance] showed that as the inoculation time progressed, [the expression level] increased. CACYP1The expression level gradually increased (Kong, HY, SC Lee et al. Expression of peppercyclophilin gene is differentially regulated during the pathogen infection and abiotic stress conditions. Physiological and Molecular Plant Pathology, 2001, 59(4): 189-199.). Lee et al. isolated and cloned a cyclophilin gene from Chinese cabbage. C-CyP Its recombinant protein C-CyP is effective against Rhizoctonia solani ( ). Rhizoctonia solani It has an inhibitory effect on the growth of Botrytis cinerea (Lee JR, Park SC, Kim JY, et al. Molecular and functional characterization of acyclophilin with antifungal activity from Chinese cabbage. Biochemical and Biophysical Research Communications, 2007, 353(3): 672-678.).

[0005] Lilies belong to the genus Lilium ( Lilium Perennial ornamental bulbous plants have significant commercial value in the floriculture industry. However, diseases affecting lily bulb and cut flower production severely reduce lily yield and quality. Among these, diseases caused by the genus *Falcae* are the most damaging. Fusarium Wilt disease caused by fungi (Rao J, Liu D, Zhang N, He H, et al. Differential gene expression in incompatible interaction between Lilium regale Wilson and Fusarium oxysporum f.sp. liliiRevealed by combined SSH and microarray analysis. Molecular Biology, 2014, 48(6): 915-926.). Lily wilt symptoms usually involve one or more independent infection sites, initially presenting as irregularly edged lesions with slight depressions in the leaf epidermis. As the disease progresses, the lesions change from circular to elliptical, initially yellow but rapidly turning light brown, ultimately accelerating the wilting and death of the lily (Ingram, RJ, Levy, F. Identity and symptomatology of a newly described lily leaf spot disease). Pseudocercosporella inconspicua ) of Gray's lily ( Lilium grayi (Canadian Journal of Plant Pathology, 2019, 42(4), 499–507.). Some wild lily species, such as the Minjiang lily ( Lilium regale ), against Fusarium oxysporum ( Fusarium oxysporum It exhibits high levels of resistance. Cyclophilin is an antimicrobial protein that participates in plant-pathogen interactions, transmitting cyclophilic protein genes... GhCYP-3 Overexpression in Arabidopsis thaliana can enhance resistance to pathogens. Furthermore, extracted transgenic positive Arabidopsis plant proteins also exhibit strong inhibitory effects on mycelial growth and spore germination of the pathogen (Yang J, Wang G, Ke H, et al. Genome-wide identification of cyclophilingenes in...). Gossypium hirsutum and functional characterization of a CYP with antifungal activity against Verticillium dahliae BMC Plant Biology, 2019, 19(1): 272.). Cyclophilin plays an important role in plant defense, so the discovery and functional analysis of cyclophilin genes in *Lilium minjiangense* has important research and application value. Summary of the Invention

[0006] This invention provides a Cyclophilin antimicrobial protein gene from Minjiang lily. LrCYP1 Its application, namely, improving the resistance of tobacco to Alternaria alternifolia (Alternaria solani). Alternaria solani ) and Phytophthora stroma (Phoma herbarum Applications in resistance.

[0007] This invention clones a cyclophilin antimicrobial peptide gene with antifungal activity from *Lilium minjiangense*. LrCYP1 , LrCYP1 The nucleotide sequence is shown in SEQ ID NO:1. The full-length cDNA sequence of this gene is 734 bp, containing a 522 bp open reading frame, a 45 bp 5' untranslated region, and a 167 bp 3' untranslated region, encoding a protein with the amino acid sequence shown in SEQ ID NO:2.

[0008] In this invention LrCYP1 The coding region of the gene is the nucleotide sequence shown in positions 46-567 of SEQ ID NO:1.

[0009] This invention isolates an antimicrobial protein gene from the roots of *Lilium minjiangense* inoculated with *Fusarium oxysporum*. LrCYP1 cDNA fragments, using Agrobacterium tumefaciens ( Agrobacterium tumefaciens The target gene was transferred into wild-type tobacco and overexpressed using a gene-mediated method. Gene function correlation techniques were then used to verify whether the gene possessed antifungal activity, laying the foundation for future applications of this gene in plant resistance to fungal diseases. The inventors named this gene... LrCYP1 .

[0010] The above LrCYP1 Genes can be used to enhance the antifungal properties of tobacco, and the specific operation is as follows:

[0011] (1) Total RNA was extracted from the roots of *Lilium minjiangense* inoculated with *Fusarium oxysporum*, and amplified by reverse transcription-polymerase chain reaction (RT-PCR). LrCYP1 The full-length coding region was extracted and then ligated into the pGEM-T vector. Sequencing was then performed to obtain clones containing the target gene. The pGEM-T vector was then heated using a heat shock method. LrCYP1 Plasmids were extracted from Escherichia coli DH5α and stored at -20℃.

[0012] (2) Using restriction endonucleases Sma I and Hin dⅢ enzyme digestion of pGEM-T- LrCYP1 The target gene fragment and expression vector fragment were obtained by gel extraction using the plant expression vector pCAMBIA2300s and the enzyme digested gene fragment. The obtained fragments were then... LrCYP1The gene fragment was ligated with the pCAMBIA2300s fragment using T4 DNA Ligase to construct a plant overexpression vector. Finally, the constructed recombinant vector was transformed into wild-type tobacco using Agrobacterium tumefaciens-mediated transformation.

[0013] (3) Transformants were screened using the resistance markers on the recombinant vector T-DNA, and transgenic positive tobacco was obtained by PCR and RT-PCR. The ability of transgenic plants to resist fungal infection was analyzed, and finally transgenic plants with significantly enhanced resistance to fungi were screened.

[0014] This invention provides a novel method for plant defense against fungal diseases by cultivating resistant plants through genetic engineering, utilizing a cyclic protein gene derived from the Minjiang lily. LrCYP1 This invention can enhance plants' defense against fungi. Transferring this gene into tobacco can produce new varieties and materials with fungal resistance. This invention utilizes genetic engineering and molecular biology techniques to produce plants with enhanced disease resistance, providing a greener method for disease control, reducing the damage of chemical substances to the natural environment, and saving agricultural production costs. Therefore, this invention has broad market application prospects. Attached Figure Description

[0015] Figure 1 This is the present invention. LrCYP1 The image shows the PCR detection results of genomic DNA from transgenic tobacco. In the image: the marker is the DL2501 DNA marker (Takara Bio Engineering Dalian Co., Ltd., China); it consists of five DNA fragments of 2,000 bp, 1,000 bp, 750 bp, 500 bp, and 250 bp; WT: total DNA from non-transgenic tobacco (wild-type) as the template PCR product; positive control: plasmid pGEM-T- LrCYP1 The template is PCR product; negative control: sterile water is PCR product with template; the remaining lanes contain partial... LrCYP1 PCR products using transgenic tobacco DNA as a template;

[0016] Figure 2 This invention is positive. LrCYP1 In genetically modified tobacco LrCYP1 The figure shows the expression analysis results at the transcriptional level. In the figure: the marker is the DL2501 DNA marker (Takara Bio Engineering Dalian Co., Ltd., China); it consists of five DNA fragments of 2,000 bp, 1,000 bp, 750 bp, 500 bp, and 250 bp; WT: PCR product using non-transgenic tobacco total RNA reverse transcribed into cDNA as a template; positive control: plasmid pGEM-T- LrCYP1 The PCR product with sterile water as template was used as the negative control; the remaining lanes contained partially positive PCR products.LrCYP1 PCR product using transgenic tobacco RNA reverse transcription cDNA as template;

[0017] Figure 3 This is the present invention. LrCYP1 The antibacterial effect of proteins extracted from positive transgenic tobacco against two pathogens is shown in Figures a and b, where the fungi are Alternaria solanacearum and Piper cylindrica, respectively. WT: Total protein extracted from non-transgenic tobacco; P2 / P13 / P20: LrCYP1 Total protein extracted from transgenic tobacco plants; Buffer: PBS buffer;

[0018] Figure 4 yes LrCYP1 Graphs showing the resistance of transgenic positive tobacco to Alternaria alternata and Aegilops styracifolius. WT: non-transgenic tobacco. Figures a and b show different positive strains. LrCYP1 Resistance identification results of transgenic tobacco (P2 / P13 / P20) and non-transgenic tobacco (WT) inoculated with Alternaria alternata and Pseudomonas spp. Detailed Implementation

[0019] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. However, the scope of protection of the present invention is not limited to the contents described. Unless otherwise specified, the methods in the embodiments are conventional methods, and the reagents used are conventional commercial reagents or reagents prepared according to conventional methods unless otherwise specified.

[0020] Example 1: LrCYP1 Full-length cDNA cloning and sequence analysis

[0021] Total RNA was extracted from the roots of *Lilium minjiangense* inoculated with *Fusarium oxysporum* for 96 h. The roots were thoroughly ground in liquid nitrogen and transferred to 2 mL tubes. Total RNA was extracted using the Trizol method. After extraction, the first strand of cDNA was synthesized using reverse transcriptase M-MLV (Promega, USA) as a template. The reaction system and procedure were as follows: 5 μg of total RNA was added, followed by 50 ng oligo(dT), 2 μL dNTP (2.5 mM), and DEPC water, until the reaction volume reached 14.5 μL. After mixing, the mixture was denatured at 70 °C for 5 min, rapidly cooled on ice for 5 min, and then 4 μL of 5× First-stand buffer, 0.5 μL of RNasin (200 U), and 1 μL of M-MLV (200 U) were added sequentially. The mixture was then briefly centrifuged and incubated at 42 °C for 1.5 h. After removal, the mixture was heated at 70 °C for 10 h. The reaction was terminated at min; the synthesized first strand of cDNA was stored at -20℃ for later use.

[0022] Using the synthesized first-strand cDNA as a template, the target gene is amplified. LrCYP1The upstream and downstream primer sequences used were 5' ACCGATCTCAAATCCCTAGC 3' and 5' CCACAACCCTTACAGAGGTCAAC 3', respectively. Advantage was employed. TM 2. The target gene was amplified using PCREnzyme (Clontech, USA); PCR reaction conditions: 94℃ for 5 min; 94℃ for 30 s; 59℃; 72℃ for 45 s; 32 cycles; 72℃ for 10 min; the following reagents were added sequentially in 50 μL reaction volumes: 2.5 μL cDNA, 0.5 μL 10×Ex Taq Buffer (containing Mg). 2+ The following PCR products were prepared: 20 mM dNTP Mix (2.5 mM each), 4.5 μL upstream primer (5 μM), 0.5 μL downstream primer (5 μM), 0.5 μL TaKaRa Ex Taq (5 U / μL), and 36.75 μL ddH2O. After mixing, PCR amplification was performed using the above PCR program. After completion, 5 μL of the amplified product was used for agarose gel electrophoresis to detect its specificity and size.

[0023] The PCR product contained only one band. The PCR amplification product was recovered by gel excision using the SanPrep column-based PCR product purification kit (Sangon Biotech Shanghai Co., Ltd., China). TA cloning was then performed using the pGEM-T Vector System (TaKaRa, Japan). The reaction system and procedure were as follows: 3.4 μL of PCR product was added sequentially to 0.7 μL of pGEM-T vector, 0.9 μL of T4 DNA Ligase, and 5 μL of 2×Rapid Ligation Buffer. After mixing, the mixture was incubated overnight at 4°C. The ligation product was then transformed into *E. coli* DH5α competent cells using a heat shock transformation method. The transformed *E. coli* DH5α cells were plated on LB solid medium containing ampicillin (Amp) to screen for positive transformants. The cells were incubated in the dark at 37°C for 12-16 h. Several single clones were picked and transferred to LB liquid medium containing Amp, shaken, and incubated for 4 h before amplification. LrCYP1 Specific primers for detecting multiple cloning site insertion LrCYP1 The clones were then sequenced to obtain the final product. LrCYP1 The full-length cDNA is 734 bp. Analysis using the NCBI ORF finder (http: / / www.ncbi.nlm.nih.gov / gorf / gorf.html) revealed that it contains a 522 bp open reading frame. LrCYP1The protein encodes a protein containing 173 amino acids with a molecular weight of approximately 18.1 kDa and an isoelectric point of approximately 8.71. Analysis was performed using the bioinformatics software SignalP 5.0. LrCYP1 The encoded protein sequence was analyzed to determine if it possessed an N-terminal signal peptide. Results showed... LrCYP1 The absence of a signal peptide at the N-terminus suggests that this protein is a non-secretory protein.

[0024] Example 2: Construction of plant overexpression vectors

[0025] The plasmid pGEM-T- was extracted from Escherichia coli using the SanPrep column-based plasmid DNA mini-extraction kit (Sangon Biotech Shanghai Co., Ltd., China). LrCYP1 The plant expression vector pCAMBIA2300s was used, and 2 μL was used for agarose gel electrophoresis to detect the integrity and concentration of the extracted plasmids; restriction endonucleases were used. Sma Ⅰ (TaKaRa, Japan) and Hin dⅢ (TaKaRa, Japan) for plasmid pGEM-T- LrCYP1 Double digestion of pCAMBIA2300s and pGEM-T- was performed (50 μL). The following reaction was used to digest pCAMBIA2300s and plasmid pGEM-T-. LrCYP1 Double digestion: 30 μL of plasmid, add 5 μL of [unclear text - possibly a specific enzyme] to each digestion. Sma Ⅰ, 5μL Hin dⅢ, 10μL ddH2O, 5μL 10×T, 10μL BSA was mixed, centrifuged briefly, and then placed in a 37°C water bath for 3 hours. All enzyme digestion products were spotted onto an agarose gel for electrophoresis, and then... LrCYP1 The fragments and the large fragment of the pCAMBIA2300s vector were recovered by gel electrophoresis. The entire process was carried out using the SanPrep column DNA gel recovery kit (Sangon Biotech Shanghai Co., Ltd., China). 2 μL of the recovered product was taken and the size and concentration of the recovered fragments were detected by agarose gel electrophoresis and stored at -20℃ for later use.

[0026] Using T4 DNA Ligase (TaKaRa, Japan), the recovered DNA was... LrCYP1 The DNA fragment and the pCAMBIA2300s vector fragment were ligated. The reaction system (20 μL) and the operation procedure were as follows: Take 10 μL... LrCYP1The DNA fragment was added sequentially with 2 μL pCAMBIA2300s vector DNA, 2 μL 10×T4 DNA Ligase Buffer, 1 μL T4 DNA Ligase, and 5 μL ddH2O. After mixing, the mixture was briefly centrifuged and then incubated overnight at 16°C. The ligation product was then transformed into *E. coli* DH5α using a heat shock transformation method. Positive clones were screened using solid medium containing 50 mg / L kanamycin (Kana). Single colonies were selected and cultured, and the bacterial culture was used as a template for amplification. LrCYP1 PCR was performed using specific primers to select... LrCYP1 Clones that have been successfully ligated to pCAMBIA2300s, if the tested strain is positive, add glycerol and store at -80℃ for later use.

[0027] The above pCAMBIA2300s- was extracted and purified using the SanPrep column plasmid extraction kit (Sangon Biotech Shanghai Co., Ltd., China). LrCYP1 Plasmid. The constructed plant expression vector was then transformed into Agrobacterium tumefaciens LBA4404 competent cells using a liquid nitrogen freeze-thaw method. The procedure was as follows: 10 μL of pCAMBIA2300s- LrCYP1 The plasmid was added to a centrifuge tube containing 50 μL of competent cells, gently mixed, and incubated on ice for 30 min. It was then rapidly transferred to liquid nitrogen for 5 min, followed by immediate incubation at 37°C for 5 min, then immediately incubated on ice for 2 min. 500 μL of LB broth was added, and the cells were incubated at 28°C with shaking for 4 h. The activated Agrobacterium was plated on LB agar containing 50 mg / L Kana and incubated statically at 28°C. Single colonies were selected and cultured by shaking, followed by amplification. LrCYP1 PCR was performed using specific primers to detect pCAMBIA2300s- LrCYP1 To determine whether to transfer the clone into Agrobacterium, for positive clones, add glycerol and store at -80°C for later use.

[0028] Example 3: Agrobacterium-mediated plant genetic transformation and screening of transgenic plants

[0029] The transgenic recipient in this experiment was tobacco. Tobacco seeds were soaked in 75% alcohol for 30 seconds, washed with sterile water, soaked in 0.1% HgCl2 for 8 minutes, washed several times with sterile water, sown on 1 / 2 MS medium, and cultured in the dark at 28℃ for 6 days. After germination, they were transferred to a light incubator (25℃, 16 h / d light). Subcultured monthly with 1 / 2 MS medium thereafter.

[0030] The plasmid pCAMBIA2300s- was removed from the -80℃ freezer and stored. LrCYP1Agrobacterium LBA4404 was inoculated into 50 mL of LB liquid medium containing 50 mg / L Kana and 20 mg / L rifampin, and incubated at 28°C until the medium became turbid. 1 mL of the turbid bacterial culture was transferred to LB solid medium containing 50 mg / L Kana and incubated at 28°C for 48 h. Subsequently, the Agrobacterium was scraped off the LB solid medium and inoculated into MGL liquid medium containing 20 mg / L acetosyringone (AS), and incubated at 28°C with shaking for 2-3 h to activate the Agrobacterium.

[0031] Take leaves from sterile tobacco seedlings and cut them into 1 cm pieces. 2 The leaf discs were completely immersed in the MGL liquid medium containing activated Agrobacterium, and incubated in a shaker at 28°C for 15 minutes. The bacterial solution on the leaf surface was then blotted dry with sterile filter paper. The leaf discs were then placed on a co-culture medium for room temperature incubation. The co-culture medium for tobacco transformation was MS medium containing 0.02 mg / L 6-BA, 2.1 mg / L NAA, 30 g / L sucrose, and 6 g / L agar, and incubated in the dark at 22°C for 2 days. All the above operations were performed in a sterile operating table.

[0032] After co-culture, the leaf discs were transferred to MS selection medium supplemented with antibiotics for differentiation into seedlings, and transgenic plants were screened simultaneously. The tobacco selection medium was MS medium containing 0.5 mg / L 6-BA, 0.1 mg / L NAA, 30 g / L sucrose, 6 g / L agar, 50 mg / L Kana, and 200 mg / L cefotaxime sodium salt (Cef). During selection culture, the culture flasks were transferred to a light incubator (25℃, 16 h / d light, 8 h / d dark). After the tobacco plants sprouted, they were subcultured on MS medium containing 50 mg / L Kana and 200 mg / L Cef. The regenerated tobacco seedlings were then transferred to MS medium containing 50 mg / L Kana to allow rooting. Finally, the best-rooted regenerated seedlings were selected for further testing.

[0033] Genomic DNA was extracted from the leaves of transgenic tobacco plants using the CTAB method. 1 μL of the extracted genomic DNA was analyzed for integrity and concentration by agarose gel electrophoresis. The genomic DNA from the transgenic plants was then used as a template for amplification. LrCYP1 PCR was performed using specific primers. After PCR, 8 μL of the product was used for agarose gel electrophoresis to detect positive transgenic plants. The amplification results of some tobacco transgenic plants are shown below. Figure 1 As shown, LrCYP1 A total of 31 positive transgenic tobacco plants were screened.

[0034] Example 4: LrCYP1Genes in genetically modified tobacco LrCYP1 Transcriptional expression level detection

[0035] Total RNA was extracted from young leaves of positive transgenic plants and non-transgenic tobacco (wild type), reverse transcribed to generate the first strand of cDNA, and then amplified using this cDNA as a template. LrCYP1 PCR was performed using specific primers, and the results were analyzed in each transgenic plantlet. LrCYP1 Expression at the transcriptional level. Total RNA extraction and RT-PCR were performed using the same methods as in Example 1. After PCR, 8 μL of the PCR product was used for agarose gel electrophoresis. Results for some individual strains are shown below. Figure 2 As shown, a total of 25 transgenic single plants were detected. LrCYP1 It is expressed at a high level of transcription.

[0036] Several pathogenic fungi preserved in the laboratory were inoculated onto PDA solid medium (200 g / L potato, 15 g / L agar, 20 g / L glucose) and incubated in the dark at 28°C. When the colonies grew to a diameter of approximately 2-3 cm, plant protein was added, and the in vitro antifungal activity of the transgenic plants was analyzed. Two fungal species were tested: *Alternaria solanacearum* and *Pseudomonas aeruginosa*. Aseptic techniques were used throughout the plant protein extraction process to prevent contamination by other microorganisms. Total protein from transgenic tobacco was extracted using the plant protein extraction kit from Sangon Biotech (Shanghai) Co., Ltd. The total protein concentration of transgenic tobacco (P2, P13, P20) and wild-type tobacco was adjusted to 0.2 μg / μL, and 30 μL of each was dropped onto sterile filter paper of each fungal culture medium. Total protein from different transgenic tobacco plants was added to sterile filter paper discs on each fungal plate, while total protein from wild-type tobacco and buffer (PBS buffer) were added in parallel. The fungal growth was observed after several days of incubation at 28°C, and the results were evaluated. LPCKP1 The in vitro antifungal activity of genetically modified tobacco was as follows: Figure 3 As shown, LrCYP1 Total protein in transgenic tobacco significantly inhibits the growth of Alternaria alternata and Pseudomonas aeruginosa.

[0037] Example 5: LrCYP1 Analysis of resistance of genetically modified tobacco to pathogenic fungi

[0038] The pathogenic fungi preserved in the laboratory were inoculated onto PDA solid medium (200 g / L potato, 15 g / L agar, 20 g / L glucose) and incubated in the dark at 28°C for 7 days to prepare 10 5 Spores / mL spore suspension. In wild-type tobacco and LrCYP1Genetically modified tobacco leaves (P2, P13, P20) developed uniformly sized wounds on the upper left side. 30 μL of spore suspension was applied to the wounds on the tobacco leaves. The leaves were then placed on sterile filter paper moistened with water for 5-7 days under light at 28°C. The leaves were then removed and the disease development was observed. Results were as follows: Figure 4 As shown, the diseased area on transgenic tobacco leaves is much smaller than that on wild-type tobacco, indicating that... LrCYP1 Genetically modified tobacco is more resistant to stalk mold and Alternaria alternata.

Claims

1. A cyclophilin gene from the Minjiang lily LrCYP1 Its nucleotide sequence is shown in SEQ ID NO:

1.

2. The cyclophilin gene of Lilium regale as claimed in claim 1 LrCYP1 application in improving tobacco resistance to Alternaria solani ( Alternaria solani ), Phoma herbarica ( Phoma herbarum ).

Images