A protein for improving disease resistance of plants, a coding gene and application thereof
By overexpressing the NbEAS gene in plants and utilizing Agrobacterium-mediated transient expression technology, the plant's resistance to viruses and fungi was enhanced, solving the problem of insufficient plant disease resistance in existing technologies and achieving the effects of improving disease resistance and increasing yield while reducing pesticide use in crop breeding.
Patent Information
- Application Number
- CN202411021165.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2024-07-25
- Filing Date
- 2024-07-29
- Publication Date
- 2026-02-13
- Estimated Expiration
- 2044-07-29
AI Technical Summary
In the current technology, methods to enhance plant resistance to viruses and fungi have not been fully studied. In particular, the role of terpenoids in plant pathogen invasion has not been reported, resulting in insufficient plant disease resistance and affecting agricultural production and the ecological environment.
The NbEAS gene was screened from Nicotiana benthamiana, and the NbEAS protein was overexpressed in plants via Agrobacterium-mediated transient expression. The virus-derived overexpression vector significantly improved disease resistance in plants and enhanced their defense against viruses and fungi.
It significantly improves plant resistance to viruses and fungi, reduces disease occurrence, enhances plant immune response, has broad-spectrum disease resistance, and is suitable for crop breeding to increase yield and reduce pesticide use.
Smart Images

Figure CN118702792B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of genetic engineering, and relates to a protein for improving plant disease resistance, a coding gene and application. BACKGROUND
[0002] Sugarcane mosaic disease is a worldwide important disease caused by a class of viruses. Studies have shown that the main pathogens causing sugarcane mosaic disease are sugarcane mosaic virus (SCMV), sorghum mosaic virus (SrMV) and sugarcane streak mosaic virus (SCSMV). SCSMV belongs to the family Potyviridae, genus Poacevirus, and has a molecular weight of about 10 kb. It encodes a polyprotein, which can produce 10 mature proteins after hydrolysis by enzymes (Zhou Guohui et al., 2005; Li Wenfeng et al., 2006). SCSMV can be transmitted mechanically and also through vegetative propagation of infected plants. It is not clear whether there is a transmission vector (He et al., 2014). Sugarcane and sorghum are natural hosts of SCSMV, and under artificial inoculation conditions, it can also infect corn, millet and other gramineous plants. Infected plants mainly show symptoms such as leaf chlorosis, irregular mosaic, striping, stunting and slow growth. SCSMV was first detected in sugarcane germplasm introduced from Pakistan in the United States (Hall et al., 1998). It is now widespread in India, Thailand and other Southeast Asian countries, causing serious damage to the local sugarcane industry. In China, SCSMV is prevalent in the main sugarcane producing areas of Yunnan Province, causing serious damage and posing a great threat to the Chinese sugarcane industry (He et al., 2016).
[0003] With increasing population and decreasing arable land, improving grain yield and quality has become a key focus of scientific research. The discovery and functional elucidation of plant disease resistance genes not only provide experimental evidence for revealing plant immune regulation mechanisms but also lay a theoretical foundation for more efficient crop quality improvement. For example, transferring disease resistance genes into crops such as rice through transgenic technology can enhance plant resistance without affecting yield and improve crop quality (Xu et al., 2017; Deng et al., 2017). Although significant progress has been made in plant disease resistance research over the past decade, little is known about the processes of immune signal initiation, activation, and transmission mediated by disease resistance proteins, and many problems remain to be solved. The discovery and research of the functions of plant disease resistance genes are of great significance to agricultural production. Using transgenic technology to transfer disease resistance genes into crops can rapidly and efficiently cultivate superior disease-resistant varieties, reduce pesticide use, and help improve the deteriorating agricultural ecological environment.
[0004] Terpenoids, also known as isoprene-like compounds or isoprene glycol-like substances, possess rich biological functions in plants and are frequently used as precursors for pharmaceuticals, insecticides, and fragrances. Currently, terpenoids comprise more than one-third of over 80,000 compounds. Although terpenoid compounds have complex structures, their biological composition is relatively simple. Typically, a 5-C precursor is linked end-to-end to produce an achiral, linear C5n (n=1, 2, 3...) isoprene diphosphate. Terpene synthases (TPS) catalyze several cyclization reactions to produce multiple fused rings and stereoisomers.
[0005] Nicotiana tabacum 5-epi-aristolochene synthase (NtEAS) was cloned by PJ Facchini in 1992 (Facchini et al., 1992; Back et al., 1994; Jeffery et al., 1997), and this gene has been expressed in bacteria by many people since then. In 1997, Starks et al. first detected the NtEAS complex bound with two different substrate analogs, Farnesylhydroxyphosphonate and Trifluorofarnesyl diphosphate, at a resolution of 2.2-2.8 A, which was the first reported crystal structure of a sesquiterpene synthase (Starks et al., 1998). Its relative molecular mass is 64 kDa, the full-length cDNA sequence is 1653 bp, and the isoelectric point is about 5.17 (Faraldos et al., 2007). Due to the homology of sesquiterpene synthase structure, NtEAS contains 2 Mg 2+ bound conserved motifs DDXXD and 1 Mg 2+ unconventional motif NSE / DTE, and its catalytic active center cavity is located at the C-terminus. In tobacco, NbEAS and 5-epi-aristolochene dihydroxylase (EAH) together catalyze farnesyl pyrophosphate (FPP) to obtain capsidiol (Faraldos et al., 2007). Studies have shown that in N. benthamiana, plants activate capsidiol-dependent non-host resistance to resist the invasion of Phytophthora infestans (Chen et al., 2016). In addition, capsidiol can directly inhibit the growth of Alternaria alternata hyphae (Song et al., 2019). However, so far, the disease-related role of NbEAS in plant pathogen invasion has not been reported. SUMMARY
[0006] In view of the deficiencies in the prior art, the present application provides a protein and encoding gene for improving plant disease resistance and application. The present application researches and finds that Agrobacterium-mediated transient expression of the gene NbEAS in infiltrated N. benthamiana can significantly improve its resistance to fungi and viruses, thereby enhancing the plant disease resistance function.
[0007] In order to achieve the object of the present application, the present application provides a protein NbEAS for improving plant disease resistance, which is derived from Nicotiana benthamiana, the nucleotide sequence of which is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2. The present application uses a virus-derived overexpression vector. The chimeric virus (PVX-GFP or PVX-P1 SCSMV ) is obtained by inserting the GFP or P1SCSMV open reading frame sequence into the viral vector. Agrobacterium containing PVX-GFP or PVX-P1 SCSMV combined with ssGFP is infiltrated into 16c transgenic Nicotiana benthamiana, and the upper leaves inoculated with PVX-GFP or PVX-P1 SCSMV are collected, and total protein is isolated. A broad-spectrum spectrum resistance protein NbEAS is identified by screening based on 4D label-free liquid chromatography-mass spectrometry / mass spectrometry quantitative proteomics method, and then the gene thereof is constructed into a pSuper1300 vector for Agrobacterium-mediated transient expression, followed by pathogen inoculation, and necrosis is observed and detected.
[0008] The technical solution provided by the present application is shown as follows:
[0009] The present application provides a protein for improving plant disease resistance, which is any one of the following a)-c):
[0010] a) a protein consisting of the amino acid sequence shown in SEQ ID NO.2;
[0011] b) a protein having the same function as the protein shown in SEQ ID NO.2, which is obtained by substituting, deleting or inserting one, several or tens of amino acids in the amino acid sequence shown in SEQ ID NO.2;
[0012] c) a fusion protein obtained by connecting a tag to the N terminus and / or C terminus of the protein shown in SEQ ID NO.2.
[0013] The present application provides a gene encoding the protein for improving plant disease resistance, which is any one of the following 1)-3):
[0014] 1) having the nucleotide sequence shown in SEQ ID NO.1;
[0015] 2) having a polynucleotide capable of encoding the protein sequence shown in SEQ ID NO.2;
[0016] 3) having 75% or more identity with the DNA fragment defined in 1) or 2), and the encoded protein is functionally equivalent to the protein shown in SEQ ID NO.2.
[0017] The present application provides a recombinant vector, a transgenic cell line or a recombinant bacterium containing the gene encoding the protein for improving plant disease resistance.
[0018] The present application provides a primer pair for cloning the gene encoding the protein for improving plant disease resistance, characterized in that the primer pair comprises an upstream primer NbEASF and a downstream primer NbEASR, the nucleotide sequence of the upstream primer is shown in SEQ ID No. 3, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 4.
[0019] The present application provides the use of the protein for improving plant disease resistance or the recombinant vector, the transgenic cell line or the recombinant bacterium for improving plant disease resistance.
[0020] Further, the improvement of plant disease resistance comprises: improving the immune resistance of plants to pathogenic bacteria; and / or, improving the resistance of plants to diseases caused by pathogenic bacteria and viruses.
[0021] Further, the improvement of plant disease resistance is achieved by overexpression of NbEASF.
[0022] Further, the plant is tobacco.
[0023] Beneficial effects
[0024] The present application discloses a protein for improving plant disease resistance, a coding gene and application. The protein provided by the present application is based on a potato virus X (PVX) expression system, and a significantly up-regulated protein is identified in the heterologous expression of P1SCSMV through a newly developed 4-dimensional proteomics, and is named as NbEAS and comes from Nicotiana benthamiana. After the overexpression of NbEAS in Nicotiana benthamiana through Agrobacterium-mediated expression, seven viruses and four fungi are inoculated, and it is found through detection that the virus accumulation amount of the leaf after the overexpression of NbEAS is down-regulated, the necrosis degree caused by the fungi is weakened, and the disease resistance is obviously enhanced. The present application can be applied to crop breeding and disease resistance improvement, and is expected to improve the disease resistance of plants, so as to achieve the purpose of increasing yield and reducing drugs.
[0025] The experiment of the present application proves that a gene NbEAS is screened from Nicotiana benthamiana, infiltrates Nicotiana benthamiana through Agrobacterium-mediated transient expression, and detects the disease resistance through virus and fungus inoculation and other means. The present application has important value for cultivating disease-resistant transgenic crops. BRIEF DESCRIPTION OF DRAWINGS
[0026] Figure 1 PVX-GFP or PVX-P1 SCSMVA schematic diagram illustrating the screening and identification of broad-spectrum disease-resistant proteins by Agrobacterium tumefaciens binding to ssGFP infiltrating 16c transgenic Nicotiana benthamiana. The proteins were screened and identified using a quantitative proteomics method based on 4D label-free liquid chromatography-mass spectrometry / mass spectrometry.
[0027] Figure 2 This is a schematic diagram illustrating the broad-spectrum resistance of NbEAS to plant pathogens. Detailed Implementation
[0028] The invention will now be further described with reference to the accompanying drawings.
[0029] The endpoints and any values of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of the various ranges, the endpoint values of the various ranges and individual point values, and individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.
[0030] For the purposes of this specification and the appended claims, unless otherwise stated, all expressions, percentages, or proportions, and other numerical values used in this specification and the appended claims, are to be understood to be modified by the term "about" in all cases. Furthermore, all scopes disclosed herein include their endpoints and can be combined independently.
[0031] Example 1
[0032] Experimental materials and reagents
[0033] Wild-type Nicotiana benthamiana seeds and 16c transgenic Nicotiana benthamiana seeds stably expressing GFP were both preserved and cultured in our laboratory.
[0034] Escherichia coli ( Escherichia coli DH5α and Agrobacterium ( Agrobacterium tumefaciens EHA105, GV3101 strain, PVX expression vector pND108, transient expression vector pGWB5 (Tsuyoshi Nakagawa, Shimane University, Japan), PVX-P1 SCSMVBoth the PVX-GFP Agrobacterium strain and the pSuper1300-GFP overexpression vector were preserved in our laboratory; Professor Yang Shuhua of China Agricultural University kindly provided the vector. Broiler mosaic virus (BMV), barley stripe mosaic virus (BSMV), cucumber mosaic virus (CMV), GFP-labeled potato virus X (PVX-GFP), GFP-labeled tobacco mosaic virus (TMV-GFP), GFP-labeled turnip mosaic virus (TuMV-GFP), and soybean mosaic virus (SMV-GFP), as well as *Phytophthora capsici*, *Rhizoctonia solani*, *Fusarium oxysporum*, and *Alternaria alternata* were all preserved in our laboratory.
[0035] Restriction endonucleases ( Pst I, Sal I) Reverse transcriptase M-MLV, dNTPs, 5×M-MLV Buffer, RNase inhibitor vector, T4 DNA ligase, etc., were purchased from Takara Bio Engineering (Dalian) Co., Ltd.; Trizol reagent was purchased from TaKaRa; AxyPrep DNA gel extraction kit was purchased from Corning Life Sciences (Wujiang) Co., Ltd.; Product recovery kit and high-purity plasmid mini-preparation kit were purchased from Beijing Biotech Biotechnology Co., Ltd.; PCR instrument was purchased from ProFlex; AxyPrep DNA gel extraction kit was purchased from Corning Life Sciences (Wujiang) Co., Ltd.; 2× High-FidelityMaster Mix was purchased from Qingke Biotechnology Co., Ltd.; 2× TaqMaster Mix, Marker were purchased from Nanjing Nvigan Biotech Co., Ltd. Alkaline phosphatase (AP) labeled goat anti-mouse IgG and goat anti-rabbit IgG, Tris, glycine, methanol, 30% acrylamide (29:1), ampicillin (Amp), kanamycin (Kan), rifampicin (Rif) were purchased from Shengong Bioengineering (Shanghai) Co., Ltd.; Anti-FLAG and Anti-GFP mouse antibodies were purchased from AbMART; NBT (ONitro blue tetrazolium), BCIP (5-bromo-4-chloro-3-indolyl-phosphate), Rainbow 180 broad range protein marker, Coomassie brilliant blue R250, trypan blue, water-saturated phenol were purchased from Beijing Solabio Technology Co., Ltd.; Gateway™ LR Clonase™ II Enzyme mix was purchased from Invitrogen; Anti-DIG-AP, DIG-11-dUTP were purchased from Roche; other reagents were all analytical reagent grade; nitrocellulose membrane, nylon membrane and polyvinylidene fluoride (PVDF) were purchased from GE Healthcare; primer synthesis and sequencing were completed by Beijing Qianke New Industry Biotechnology Co., Ltd.
[0036] As shown in Figure 1 Figure 1, the plasmids PVX-GFP and PVX-P1 SCSMV were transformed into Agrobacterium GV3101 by the freeze-thaw method described above. Agrobacterium was cultured in LB medium (100 mg / L Kan and 25 mg / L Rif). After being cultured at 28°C with 220 rpm shaking for 10-16 hours, the cells were collected by centrifugation at 3000 g for 10 minutes, suspended in infiltration buffer, and incubated at 28°C for more than 2 hours before infiltration. Agrobacterium was infiltrated into 16c transgenic N. benthamiana, and the upper leaves inoculated with PVX-GFP or PVX-P1 SCSMV were collected, and total protein was isolated. Based on the 4D label-free liquid chromatography-mass spectrometry / mass spectrometry quantitative proteomics method, a broad-spectrum resistance protein NbEAS was identified.
[0037] Then the experiment shown in Figure 2 was carried out:
[0038] 1、N. benthamiana total RNA extraction
[0039] Before grinding the plant tissue, the experimental materials such as grinding pestle and mortar are pre-cooled with liquid nitrogen, and then 0.3 g of Nicotiana benthamiana leaf is placed in the pre-cooled mortar and rapidly ground into powder with liquid nitrogen, and then the leaf powder is transferred to a 2 mL centrifuge tube, and 1 mL of Trizol solution is added to the de-enzyme centrifuge tube, and mixed thoroughly, and then placed on ice for 5 min; the centrifuge tube containing the sample solution is placed in a 4°C low-temperature centrifuge, 12000 rpm, centrifuged for 10 min, and then the supernatant is transferred to a 1.5 mL de-enzyme centrifuge tube with a de-enzyme gun head to remove cell debris and other impurities; at the same time, 200 μL of chloroform is added to the sample solution, and mixed with a shaking mixer for 20 s, and then placed on ice for 10 min, and then transferred to a 4°C low-temperature centrifuge, 12000 rpm, centrifuged for 10 min, and then the water phase layer solution is gently transferred to a 1.5 mL de-enzyme centrifuge tube with a de-enzyme gun head; then an equal volume of phenol: chloroform: isopropyl alcohol RNA extraction solution is added, and shaken for 20 s, and then placed on ice for 10 min, and then transferred to a 4°C low-temperature centrifuge, 12000 rpm, centrifuged for 10 min, and then the water phase layer solution is gently transferred to a 1.5 mL de-enzyme centrifuge tube; and an equal volume of isopropyl alcohol solution is added and mixed by inverting, and then placed on ice for 10 min, and then transferred to a 4°C low-temperature centrifuge, 12000 rpm, centrifuged for 10 min, and then the supernatant is discarded, and finally the obtained precipitate is placed in a vacuum pump and dried, and stored in a -80°C refrigerator for standby use.
[0040] 2. RT-PCR
[0041] Reverse transcription of total RNA of Nicotiana benthamiana to synthesize the first strand of cDNA: take 1 μg of RNA1L, and add 1 μL of specific reverse primer, and add de-enzyme water to 12 μL, and incubate in a 70°C metal bath for 10 min, and then immediately transfer to ice for 2 min; add 5×M-MLV Buffer (10 mmol / L) 4 uL, dNTPs (10 mmol / L) 1 μL, Recombinant RNase Inhibitor (40 U / μL) 0.5 μL, M-MLV (200 U / L) 0.5 μL, and DEPC-H2O to 20 μL, and incubate at 42°C for 1 h, and then incubate at 70°C for 15 min, and then quickly place on ice for 2 min. Store the cDNA solution in a -80°C ultra-low temperature refrigerator for standby use. The system is shown in Table 1.
[0042] Reverse transcription system Table 1
[0043]
[0044] 3. PCR amplification
[0045] The primers were designed as NbEAS-F: 5'-ATGGCCTCAGCAGCAGTTGGAAAC-3' (SEQ ID NO. 3) and NbEAS-R: 5'-CTAAACTTCAATAGAATCCACAAG-3' (SEQ ID NO. 4) for PCR reaction, as shown in Table 2.
[0046] Table 2 PCR reaction system
[0047]
[0048] 4. PCR product recovery
[0049] PCR product recovery: according to the operation manual of BioTeke PCR product recovery kit; gel recovery: according to the operation manual of AxyPrep DNA gel recovery kit; ethanol precipitation recovery: first, the reaction solution was supplemented with sterilized deionized water to 90 uL, and 10 uL of 3M NaAc with pH 5.2 was added to the reaction solution, and finally 2 times volume of pre-cooled anhydrous ethanol was added, and after mixing, the sample solution was placed in a refrigerator at -20℃ for more than 30 min, and after the precipitation was completed, it was placed in a low-temperature centrifuge at 4℃, 12000 rpm, and centrifuged for 20 min, and the supernatant was discarded, and the precipitate was washed with 70% and 100% pre-cooled ethanol, each time placed in a low-temperature centrifuge at 4℃, 12000 rpm, and centrifuged for 10 min, and after washing, it was placed on a clean bench to dry, and stored at -20℃ for standby.
[0050] 5. Vector and fragment digestion
[0051] According to the corresponding concentration of the plasmid and fragment recovery products, the amount was taken, the vector digestion system was usually 20 uL, the fragment digestion system was 50 uL, the restriction endonuclease was usually 1 uL, the buffer was 1 / 10 of the total system, and the restriction endonuclease was selected for the optimum reaction temperature and buffer for the digestion reaction for about 4 h.
[0052] Table 3 Digestion system
[0053]
[0054] 6. Vector and fragment ligation and transformation
[0055] In PCR reaction tube, the vector and fragment are mixed in a molar ratio of 1:3 to 1:10, 1 uL of 10x T4 Ligase buffer, 0.5 μL of T4 DNA Ligase (350 U / uL) and sterilized deionized water are added to make up to 10 μL. The reaction solution is mixed uniformly by blowing and then placed in a 16℃ metal bath for connection for 4-6 h. The positive recombinant bacteria are transformed into E. coli DH5α competent cells and identified by bacterial liquid PCR, enzyme digestion and sequencing.
[0056] 7. Agrobacterium transformation
[0057] (1) The Agrobacterium competence is taken out and placed on ice. After natural melting, 1 ug of the plasmid to be transformed is moved into the competent cells, and the bottom of the centrifuge tube is gently stirred with fingers. The mixed transformation product is placed on ice for 30-45 min;
[0058] (2) After the ice incubation is completed, the competent cells containing the recombinant plasmid are quickly frozen in liquid nitrogen for 1 min and heat shocked in a 37C water bath for 5 min;
[0059] (3) After the heat shock is completed, 800 μL of antibiotic-free LB liquid medium is added, and the mixture is incubated in a 28℃ shaker at 180 rpm for 4 h;
[0060] (4) After the incubation is completed, the transformation product is uniformly coated on an LB solid medium plate containing the corresponding antibiotic. After being blown dry on a sterile clean bench, it is incubated at 28℃ for 48 h. A sterilized bamboo stick is used to pick a single colony for streak culture. Then a small amount of bacterial cells is taken to a PCR reaction tube, and positive clone screening is performed according to the general Taq DNA polymerase reaction conditions.
[0061] 8. Agrobacterium-mediated transient expression
[0062] (1) After the Agrobacterium colony is identified as a positive clone, a sterilized gun head is used to pick the cultured positive clone, which is transferred to LB liquid medium containing the corresponding antibiotic and incubated in a 28℃ shaker at 180 rpm overnight;
[0063] (2) The Agrobacterium liquid after overnight culture is poured into a 2 mL sterilized centrifuge tube, which is centrifuged in a room temperature centrifuge at 8500 rpm for 2 min. The collected Agrobacterium cells are suspended in Agrobacterium suspension buffer, and the OD600 value is determined;
[0064] (3) The OD600 value of the suspended bacterial solution is determined by a visible spectrophotometer. If co-expression is performed, the OD600 values of different suspended bacterial solutions are determined, and the corresponding suspended bacterial solution OD600 value is adjusted according to the final concentration calculation;
[0065] (4) The mixed suspension was placed in a 28°C incubator for 2 h or left overnight;
[0066] (5) The Nicotiana benthamiana plants at the 6-7 leaf stage were infiltrated with Agrobacterium. First, the mixed suspension was taken up with a syringe, and after removing the needle, the injection hole of the syringe was pressed against the back of the leaf, and the syringe was gently pressed until the suspension slowly infiltrated from the back of the leaf. Avoiding too much pressure to cause damage to the leaf. If the leaf cannot be normally infiltrated, the plant should be replaced. Generally, 3-4 leaves were infiltrated, and subsequent observations were made according to the experimental requirements.
[0067] 9. Virus inoculation
[0068] The growth of Nicotiana benthamiana was carried out in a climate-controlled room with a 16-hour light period and an 8-hour dark period (24°C). The competent cells containing the cDNA clones of brome mosaic virus (BMV), barley stripe mosaic virus (BSMV), cucumber mosaic virus (CMV), GFP-labeled potato virus X (PVX-GFP), GFP-labeled tobacco mosaic virus (TMV-GFP), GFP-labeled turnip mosaic virus (TuMV-GFP), and soybean mosaic virus (SMV-GFP) were cultured on LB plates containing the corresponding antibiotics for 2 days, and then transferred to liquid LB medium. Agrobacterium was harvested and suspended in suspension buffer after overnight shaking culture. Western blot was performed for virus-inoculated leaves.
[0069] 10. Fungal inoculation
[0070] Four candidate fungi, Phytophthora capsici, Rhizoctonia solani, Fusarium oxysporum, and Alternaria alternata, were selected for gene function analysis. These fungi were cultured on potato dextrose agar (PDA) plates until the mycelium covered the entire plate. Then, the fungi were inoculated on the leaves of Nicotiana benthamiana, and TRV-based silencing experiments were performed for further culture. After about 2 days, the discs were removed, and the leaves were collected for trypan blue staining of the damage caused by fungal inoculation.
[0071] 11. Trypan blue staining
[0072] (1) Staining solution preparation: 0.015 g of trypan blue powder was weighed, 10 mL of water-saturated phenol was taken in a fume hood, and the same volume of sterilized deionized water, glycerol, and lactic acid was measured and dissolved in boiling water.
[0073] (2) Sample preparation: Leaf tissue with petiole was collected, washed with absolute ethanol for 2-3 min, and then the sample morphology before staining was photographed using a Canon EOS5D single-lens reflex camera, taking care not to damage the leaf.
[0074] (3) Staining: Place the leaves in the staining solution. If the leaves float on the surface, press them gently to the bottom of the beaker with a glass rod. Boil for 15 min and stand at room temperature for 6-8 h;
[0075] (4) Decolorization: Weigh 2.5 g / mL of trichloroacetaldehyde particles in warm water, dissolve thoroughly, and then place the leaves alone in the decolorizing solution. Place in a room temperature shaker at 40 rpm. Replace the decolorizing solution 3-5 times until the necrotic cells are clearly visible.
[0076] (5) Photography and analysis: Take photographs by placing the leaves alone in a culture dish containing the decolorizing solution to facilitate leaf expansion and complete morphology. Quantitatively analyze cell necrosis intensity using ImageJ software and perform significant difference analysis on the obtained data using SPSS software.
[0077] 12. Western blot detection
[0078] (1) Sample preparation: Use a disc puncher to take one disc from each side of the main vein of the plant. Place the obtained disc in a 1.5 mL sterilized centrifuge tube with tweezers and freeze quickly. Then grind using a mini handheld homogenizer until the leaves are powdered. Add 100 μL of 2×SDS loading buffer containing 5% β-mercaptoethanol. Mix the sample solution thoroughly and denature in boiling water for 10 min. To avoid lid rupture, open the centrifuge lid after about 1 min. After denaturation, centrifuge at room temperature at 12000 rpm for 10 min. Then aspirate the supernatant of the sample solution and transfer it to a 1.5 mL sterilized centrifuge tube for storage;
[0079] (2) Gel preparation and electrophoresis: Prepare 12.5% SDS-PAGE gel. After the gel is completely solidified, load 10 uL of the sample solution into the SDS-PAGE gel well. Maintain a constant voltage of 60 V before the bromophenol blue enters the separation gel. After the bromophenol blue enters the separation gel, adjust the voltage to 120 V until the bromophenol blue completely leaves the SDS-PAGE gel.
[0080] (3) Coomassie brilliant blue staining and decolorization:
[0081] (4) Membrane transfer: After SDS-PAGE electrophoresis, place the membrane transfer clamp black side down in 1×membrane transfer buffer. Place the sponge filter, Whatman filter paper, SDS-PAGE gel, PVDF membrane, Whatman filter paper, and sponge filter in order from bottom to top. Gently remove the air bubbles between the PVDF membrane and the SDS-PAGE gel with a plastic plate. Fix the membrane transfer clamp gently and place it in a 4C refrigerator at 85 V and 200 mA for 2 h.
[0082] (5) Blocking: After the transfer is completed, the membrane is removed with tweezers and the equilibrated PVDF membrane is transferred to 10 mL of blocking buffer. Block at room temperature for 1 h or at 4℃ overnight. After blocking, wash the membrane 3 times with 1×TBST buffer at 120 rpm for 10 min each time.
[0083] (6) Primary antibody incubation: Take 10 mL of blocking buffer and add the primary antibody with the corresponding potency ratio, place it on a shaker at room temperature, 120 rpm, incubate for 90 min, and then wash the membrane 3 times with 1×TBST buffer under the same washing conditions as in step 5.
[0084] (7) Secondary antibody incubation: Take 10 mL of blocking buffer and add 2 μL of secondary antibody, place it on a shaker at room temperature, 120 rpm, incubate for 1 h, then wash the membrane 3 times with 1×TBST buffer, the washing conditions are the same as in step 5;
[0085] (8) Color development: Add 66 μL of NBT stock solution and 33 μL of BCIP stock solution to 10 mL of alkaline phosphatase color development buffer, mix thoroughly, place the PVDF membrane in the color development box, and develop the color at room temperature in the dark until the target band is clearly visible, and then scan and save.
[0086] pass Figure 2 As shown in Figures A-G, Western blot analysis was used to determine the accumulation levels of Broccoli Mosaic Virus (BMV), Barley Striped Mosaic Virus (BSMV), Cucumber Mosaic Virus (CMV), GFP-labeled Potato Virus X (PVX-GFP), GFP-labeled Tobacco Mosaic Virus (TMV-GFP), GFP-labeled Turnip Mosaic Virus (TuMV-GFP), and Soybean Mosaic Virus (SMV-GFP). It was observed that virus accumulation significantly decreased under NbEAS overexpression conditions. Figure H shows the pathogenicity assays for the four candidate fungi. The green-filled patches on the left represent GFP overexpression regions, and the red-filled regions on the right represent NbEAS overexpression regions. Figure I shows images of leaves inoculated with the four candidate fungi before and after trypan blue staining. The top row shows bright leaves after fungal inoculation. The middle row shows leaves under ultraviolet (UV) light. The bottom row shows leaves inoculated with fungi after trypan blue staining. It was found that the degree of necrosis was significantly reduced in the NbEAS overexpression region compared to the GFP overexpression region after inoculation with four different fungi. These experiments demonstrate that overexpression of NbEAS, as a disease resistance gene, in *Nicotiana benthamiana* does indeed enhance its resistance to pathogens such as viruses and fungi, proving that it possesses a certain broad-spectrum disease resistance. In subsequent production practices, this can be applied to crop breeding for disease resistance improvement, potentially enhancing plant disease resistance and thus achieving the goal of increasing yield and reducing pesticide use.
[0087] The above merely describes the preferred embodiments of the present application, and it should be noted that those of ordinary skill in the art can make several improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered within the protection scope of the present application.
[0088] Gene (SEQ ID NO. 1) encoding plant disease resistance related protein NbEAS:
[0089]
[0090] Plant antibacterial associated protein (SEQ ID NO. 2):
[0091] MASAAVGNYEEEIVRPVADFSPSLWGDQFLSFSIENQAAQEYAKEIEALKEQTRSMLLATGRKTADTLNLIDIIERLGISYHFEKEIDEILEQIYNQTSNCDDLSISALQFRLLRQHDFNISPEIFSKFQDENGKFKESLSSDVLGLLNLYEASHVRTHADDILENALAFSIIHLESATPHLKSPLREQVTHALEQCLHKGVPRVETRFFISSIYEKEQSKNDVLLRFAKLDFNLLQMLHKQELAEVSRWWKDLDFVTTLPYARDRVVECYFWALGVYFEPQYSKARVMLVKTISMISIVDDTFDAYGTVKELEVYTNAIQRWDINEIDRLPDYMKLSYKAILDLYNDYEKELSSAGRSHLVCHAIERMKEVVRNYNVESTWFIEGYKPPVTEYLSNALATTTYYYLATTSYMGMKSVTERDFEWLSKNPKILEASVIICRVIDDTATYEVEKSRGQIATGIECCMRDYGISTEEAMTKFQEMAEAAWKDLNEGLLRPTPVSTEFLSRILNLARIVEVTYIHNLDGYTHPEKVLKPHIIALLVDSIEV
[0092] Primer sequences:
[0093] Upstream primer NbEAS-F: 5'- ATGGCCTCAGCAGCAGTTGGAAAC -3' (SEQ ID NO. 3)
[0094] Downstream primer NbEAS-R: 5'- CTAAACTTCAATAGAATCCACAAG -3' (SEQ ID NO. 4).
Claims
1. A protein that enhances plant disease resistance, characterized in that, The protein is any one of the following a)-b): a) A protein consisting of an amino acid sequence as shown in SEQ ID No. 2; b) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO.
2.
2. A gene encoding a protein that enhances plant disease resistance as described in claim 1, characterized in that, The encoding gene is any one of the following 1)-2): 1) The nucleotide sequence as shown in SEQ ID No. 1; 2) Polynucleotides that can encode protein sequences as shown in SEQ ID No.
2.
3. A recombinant vector or recombinant bacteria containing the gene encoding the protein that enhances plant disease resistance as described in claim 2.
4. A primer pair for cloning the encoding gene of claim 2, characterized in that, The primer pair includes an upstream primer NbEAS-F and a downstream primer NbEAS-R. The nucleotide sequence of the upstream primer is shown in SEQ ID No. 3, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.
4.
5. The application of the protein of claim 1, the encoding gene of claim 2, or the recombinant vector or recombinant bacteria of claim 3 in improving plant disease resistance, characterized in that, The plant is *Nicotiana benthamiana*; the enhancement of plant disease resistance includes: enhancing the plant's immune resistance to pathogens; and / or enhancing the plant's resistance to diseases caused by pathogens and viruses; the pathogens are *Phytophthora capsici*, *Rhizoctonia solani*, *Fusarium oxysporum*, and *Alternaria alternata*; the viruses are *Brassica napus* mosaic virus, barley stripe mosaic virus, cucumber mosaic virus, potato virus X, tobacco mosaic virus, turnip mosaic virus, and soybean mosaic virus; the enhancement of plant disease resistance is achieved by overexpressing the protein of claim 1.
Citation Information
Patent Citations
Plant disease-resistant related protein NbXTH1 as well as coding gene and application thereof
CN114891812A
Protein for improving plant disease resistance and biological material thereof
CN116082476A