Wx, which regulates the amylose content of rice e Alleles, applications, detection primers

By introducing the Wxe allele and designing specific detection primers, the problem of insufficient regulation of rice amylose content in rice breeding was solved, resulting in a significant improvement in the eating quality of rice and efficient breeding of high-quality new rice varieties.

CN118703674BActive Publication Date: 2026-03-06YANGZHOU UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410880016.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-02
Publication Date
2026-03-06
Estimated Expiration
2044-07-02

AI Technical Summary

Technical Problem

Currently, rice breeding lacks superior Wx gene allelic variants that can regulate the amylose content of rice between 6% and 8%, which affects the further improvement of rice's eating quality.

Method used

A Wxe allele that regulates the amylose content of rice and its specific detection primers are provided. The allele is introduced into rice varieties through hybridization to reduce the amylose content of rice to 6.1%–7.8%. Specific primers are designed for PCR amplification and agarose gel electrophoresis is performed to distinguish genotypes.

Benefits of technology

It significantly improves the eating quality of rice, enables precise control of the amylose content in rice, simplifies the breeding process of high-quality new rice varieties, and reduces the risk of genetic exchange.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118703674B_ABST
    Figure CN118703674B_ABST
Patent Text Reader

Abstract

This invention discloses a Wx method for regulating the amylose content of rice. e Alleles, applications, detection primers, ancestral alleles of the Wx gene. lv As shown in SEQ ID No. 4, Wx e The alleles are shown in SEQ ID No. 5, Wx e Alleles compared to the ancestral allele type Wx lv It lacks 240 bases as shown in SEQ ID No. 1. Utilizing the Wx of the present invention... e The allele can regulate the amylose content of rice to 6.1%–7.8%, significantly improving the eating quality of rice and having important breeding value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically, it relates to a Wx regulator for controlling the amylose content in rice. e Alleles, applications, and detection primers. Background Technology

[0002] High quality is a key goal of rice genetic improvement, and cultivating high-quality rice that is "delicious" (excellent taste), "appearing" (excellent appearance), and "healthy" (nutritional) is the main direction of rice quality improvement. Starch is a key factor determining rice quality. Numerous studies have shown that the ratio of amylose to amylopectin in rice endosperm is the primary factor affecting rice quality, usually expressed as amylose content (AC).

[0003] Amylose synthesis in rice endosperm is primarily regulated by the Wx gene encoding granule-bound starch synthase GBSSI. Natural allelic variations within the Wx locus have led to widespread differences in AC (acute starch content) and rice quality among modern rice varieties. Numerous studies have shown that appropriately lowering rice AC can significantly improve the palatability, firmness, and viscosity of cooked rice, thereby enhancing its eating quality. Currently, at least nine allelic variants of the Wx gene have been identified in rice, with AC values ​​ranging from highest to lowest. lv (AC~27%), Wx a (AC~26%), Wx in (AC~20%), Wx b (AC~16%), Wx mw / Wx la (AC ~ 13.5%), Wx op / Wx hp (AC~12.8%), Wx mp (AC~10.5%), Wx mq (AC ~10%) and wx (Wx gene loss of function, AC <2%). Over the past few decades, Wx with low to medium AC has been utilized. b Alleles replacing traditional high-AC Wx a Alleles were used to lower the AC (acetylcholine) of rice, leading to the breeding of a series of superior-tasting rice varieties with AC levels around 15%–18%, representing a significant breakthrough in rice quality improvement breeding. Building on this foundation, in recent years, the introduction of Wx... op / Wx hp Wx mq and Wx mp With superior Wx alleles, a series of high-quality soft rice varieties with AC of 8% to 13% and further improved rice eating quality have been bred. The rice has the advantages of being soft but not mushy, sweet and refreshing, with good puffing properties, elasticity, not easily hardening after cooling, and minimal retrogradation.

[0004] Further reducing the AC content of rice to 6%–8% based on soft rice is expected to continuously improve the eating quality of rice. However, current rice breeding lacks excellent Wx gene allelic variants with AC in this range. Summary of the Invention

[0005] To address the current lack of superior Wx gene allelic variants with AC values ​​between 6% and 8% in rice breeding, this invention provides a Wx gene for regulating rice amylose content. e The allele and its application and detection primers were studied. This allele can regulate the amylose content of rice to 6.1%–7.8%, providing genetic resources and technical approaches for high-quality rice breeding and promoting further improvement of rice quality.

[0006] To achieve the above objectives, the present invention provides a Wx method for regulating the amylose content of rice. e Alleles, ancestral allele type Wx of the Wx gene lv As shown in SEQ ID No. 4, Wx e The alleles are shown in SEQ ID No. 5, Wx e Alleles compared to the ancestral allele type of the Wx gene: Wx lv The deletion is 240 bases missing, as shown in SEQ ID No. 1, and occurs at positions 1765595-1765834 on chromosome 6 of rice.

[0007] A second aspect of the present invention provides the above-described Wx e The application of alleles in regulating the amylose content of rice: By introducing the allele into other rice varieties through hybridization and other methods, the amylose content of their rice can be reduced to 6.1% to 7.8%, significantly improving the eating quality of rice.

[0008] A third aspect of the present invention provides a method for detecting the aforementioned Wx e Allele-specific primers were used. The upstream primer Wxe-F sequence is shown in SEQ ID NO.2, and the downstream primer Wxe-R sequence is shown in SEQ ID NO.3. The target DNA fragment containing the deletion site was amplified by PCR using these specific primers and then subjected to agarose gel electrophoresis. If the PCR amplification product size was 204 bp, it indicated that the rice material carried Wxe-F. e Homozygous genotype; if 444bp is amplified, it indicates that the rice material carries a non-Wx genotype. e Homozygous genotype; if two bands of 444bp and 204bp are amplified simultaneously, it indicates that the rice material is heterozygous genotype.

[0009] This specific primer can help to accurately and efficiently detect Wx.e Alleles are beneficial for the rapid breeding of high-quality new rice varieties with low amylose content.

[0010] Through the above technical solution, the present invention achieves the following beneficial effects:

[0011] Wx using the present invention e The allele can regulate the amylose content of rice to 6.1%–7.8%, significantly improving the eating quality of rice, and has important breeding application value. It is used to detect Wx. e Allele-specific primers are developed directly targeting mutation sites. The primer-amplified fragments are significantly different, easy to distinguish, and highly accurate. The identification results can directly reflect the target genotype of the plant, without the risk of genetic exchange, and are simple and efficient. Attached Figure Description

[0012] Figure 1 Wx in Embodiment 1 of the present invention e Alleles and wild-type Wx lv A schematic diagram of the gene structure and mutation sites of alleles, where A represents Wx. e Schematic diagram of allele mutation sites, B represents Wx e Expression changes of GBSSI protein in allele rice; the box with arrow indicates the promoter; the box and thick solid line indicate the gene sequence; A / T / C / G represent adenine, thymine, cytosine and guanine respectively; ATG represents the start codon; TGA represents the stop codon; the scale bar is 400 bp.

[0013] Figure 2 Wx in Embodiment 2 of the present invention e Rice and wild-type Wx lv and three near-isogenic lines from the Nipponbare background carrying different Wx alleles. b Wx mp The appearance and amylose content of polished rice were compared with those of wx rice. A represents the appearance of polished rice of the relevant material (scale bar 5 mm); B represents the transparency of polished rice of the relevant material; C represents the apparent amylose content of rice of the relevant material grown in Yangzhou during the regular season; and D represents the apparent amylose content of rice of the relevant material grown in Hainan during the winter. Different lowercase letters indicate statistical significance when P < 0.05.

[0014] Figure 3 Wx in Embodiment 3 of the present invention e Rice and wild-type Wx lv and three near-isogenic lines from the Nipponbare background carrying different Wx alleles. b Wx mp Rapid viscosity analysis graph of WX rice.

[0015] Figure 4 This is the molecular marker-specific detection of Wx in Example 4 of the present invention. e Alleles and wild-type Wx lv Other existing results for the Wx natural allele, where M represents the DNA Marker, Wx e Hybrid indicates carrying hybrid Wx e Allele, Wx a Wx in Wx b Wx mw Wx op Wx mp "wx" and "wx" respectively represent the rice varieties carrying the corresponding Wx alleles: Teqing, Guangke Rice, Japan Sunny, Guangling Youjing, Diantun 502, Nanjing 46, and Suyunuo. Detailed Implementation

[0016] The specific embodiments of the present invention will be described in detail below with reference to examples. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.

[0017] Unless otherwise specified, the instruments, reagents, and materials involved in the following embodiments are all conventional instruments, reagents, and materials already existing in the prior art and can be obtained through conventional commercial channels. Unless otherwise specified, the experimental methods and detection methods involved in the following embodiments are all conventional experimental methods and detection methods already existing in the prior art.

[0018] Experimental materials: The ancestral allele type Wx of the Wx gene was introduced into the background of the high-yielding japonica rice line 2661. lv near-isogenic line 2661-Wx lv (hereinafter referred to as Wx) lv ), 2661-Wx lv In this context, the Wx gene mutates into Wx. e New germplasm 2661-Wx e Hereinafter referred to as Wx e In addition, in order to compare Wx e The differences in quality traits between existing representative Wx alleles were also included when Wx was introduced into Nipponbare japonica rice. b Wx mp The three near-isogenic lines created by the wx allele (hereinafter referred to as Wx) b Wx mp Compare with wx).

[0019] Example 1: Wx allele sequence analysis and its sequence comparison with other Wx alleles

[0020] The team used two primer pairs, 2661-Wx, designed in the early stages to amplify the full-length genome sequence of the Wx gene. e The Wx gene sequence was amplified by PCR, and the amplification product was sent to a biotechnology company for sequencing. The sequencing results were compared with the original Wx gene sequence using biological software such as SnapGene. lv The sequences were compared with other existing Wx allele sequences. The relevant primers and specific references for different Wx alleles are: Zhang et al., Molecular Plant, 12(8):1157-1166. The specific primer sequences are as follows:

[0021] LamH-F: TAAGCTTGGACGAGTTGGGTGAACCTGGGA

[0022] QWx-2: CGCCTGCAAAGAACACAAGAACACAACATT

[0023] QWx-3: AACAATTCAATTCAGTGCAGAGATCTTCCA

[0024] QWx-4: CTCCACAGCCATAAGCCACACCAACT

[0025] Sequencing alignment results showed that, compared to the pre-mutation Wx lv Allele, Wx e The allele contains a deletion of 240 base pairs (-26 to +214), and the other sequences are similar to Wx. lv Same (e.g.) Figure 1 (As shown in Figure A). Sequence analysis revealed that this large deletion resulted in the complete deletion of exon 1 (+1 to +124) and the complete disruption of the transcription initiator (-2 to +4) of the original Wx gene transcript, suggesting that Wx... e Significant changes were observed in the transcripts of the alleles. The expression of the GBSSI protein encoded by the Wx gene was detected using a specific protein antibody. The results showed that Wx... e The allele still encodes the original GBSSI protein, but its expression level is lower than that of the wild-type Wx. lv The significant reduction indicates that the deletion of 240 bases did not affect its encoded protein sequence (e.g., Figure 1 (As shown in B).

[0026] Example 2: Determination of Rice Appearance and Amylose Content

[0027] After grinding mature rice into polished rice, Wx was discovered. e Rice grains have poor transparency and are semi-transparent, similar to those carrying Wx. mp Alleles of soft rice (e.g.) Figure 2(As shown in Figure A). The transparency calculation results show that Wx e Rice grain transparency is significantly reduced to approximately 15%, far lower than Wx. lv Rice and Wx b 35% of rice and Wx mp The percentage of rice is approximately 21%, but significantly higher than the 1% of glutinous rice (e.g., ...). Figure 2 (As shown in Figure B). Rice from varieties grown in Yangzhou during the summer and Hainan during the winter were ground into rice flour. The apparent amylose content (AAC) content was measured, and the results showed that Wx e The AAC of rice is derived from wild-type Wx lv The percentage of high-quality soft rice (Wx) decreased significantly from 24.6%–25.8% to 6.1%–7.8%, falling within the range of high-quality soft rice (Wx). mp The difference between (AAC = 10.9%–12.0%) and glutinous rice wx (AAC = 2.6%–2.7%) (e.g.) Figure 2 (As shown in C and D).

[0028] Example 3: Physicochemical Quality Analysis of Rice

[0029] Rice flour from rice grown in Yangzhou during the summer was analyzed using rapid viscosity analysis (RVA) to assess its physicochemical properties. The results are as follows: Figure 3 As shown in Table 1.

[0030] Table 1 Wx e With wild-type Wx lv and respectively carrying Wx b Wx mp Rapid viscosity characteristics of rice lines with wx alleles and Nipponbare Isogenesis

[0031]

[0032]

[0033] The results showed that, compared to wild-type Wx lv Wx e The RVA profile of rice showed highly significant changes, with a significant increase in peak viscosity, hot pulp viscosity, and disintegration value, and a significant decrease in digestion value, peak time, and pulping temperature. Compared to rice carrying other Wx allele types, Wx... e The overall morphology of the RVA spectrum of rice is closer to that of Wx. b Rice and Wx mp Rice, but Wx e Rice showed significant differences from both in peak viscosity, hot paste viscosity, disintegration value, cold gel viscosity, dissolution value, and peak time. Of particular note is Wx. eThe rice RVA spectrum showed the highest disintegration value and the lowest disintegration value, consistent with the RVA spectrum characteristics of high-quality rice, indicating a significant improvement in its rice's eating quality. Furthermore, this improvement surpasses that of existing high-quality soft rice varieties like Wx. mp Further increases on the basis of.

[0034] Example 4 Molecular Marker Development

[0035] Based on Wx e Given the significant potential of alleles in improving the eating quality of rice, and to facilitate their use in breeding, we designed a pair of alleles that can specifically distinguish Wx. e The molecular markers of the alleles Wxe-F and Wxe-R have the following specific sequences:

[0036] Wxe-F(SEQ ID NO.2):TGCTTTTGGTTTTTTGGTTC

[0037] Wxe-R(SEQ ID NO.3):TTCCAGCCCACACCTTACA

[0038] Rice leaf DNA carrying different Wx alleles was collected and PCR amplified using the primers. The amplification products were separated by agarose gel electrophoresis. The results showed that the homozygous Wx alleles were... e The allele's DNA can only amplify into a single DNA fragment of about 204 bp, carrying the heterozygous Wx. e The allele's DNA can amplify into two DNA fragments with sizes of 444bp and 204bp, respectively, without carrying Wx. e Allele DNA can only amplify into DNA fragments of 444 bp in size (e.g.) Figure 4 (As shown). This result indicates that the molecular markers Wxe-F and Wxe-R can effectively distinguish Wx e and its wild type Wx lv Moreover, it can distinguish between Wx e It is naturally allelic to all other existing Wx genes.

[0039] In summary, this invention reports a method for using the Wx gene ancestral allele type Wx. lv New alleles of the Wx gene derived from mutations on the basis of the original Wx gene e Compared to the original Wx lv The absence of 240 bases in the allele led to a significant reduction in the expression of the GBSSI protein it encodes, a significant decrease in the amylose content of rice to 6.1%–7.8%, and a significant increase in the eating quality of the rice. (Regarding Wx) e A set of specific detection primers was designed for the mutation site, which can effectively distinguish Wx e and including Wxlv All other Wx genes, including the one mentioned above, are naturally allelic.

[0040] The preferred embodiments of the present invention have been described in detail above with reference to the examples. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0041] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0042] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049]

[0050]

[0051]

Claims

1. A method of modulating amylose content in rice comprising Wx e alleles characterized by, Wx Genetic ancestral allelic type Wx lv The nucleotide sequence of the allele is shown as SEQ ID No. 4, Wx e The nucleotide sequence of the allele is shown as SEQ ID No. 5, Wx e The nucleotide sequence of the allele is shown as SEQ ID No. 6, Wx Genetic ancestral allelic type Wx lv Lacks the 240 bases shown as SEQ ID No.

1.

2. The method of claim 1 Wx e Use of alleles to reduce amylose content in rice.

3. Use according to claim 2, characterized in that, The Wx e The allele reduces the content of amylose in rice to 6.1%~7.8%.

Citation Information

Patent Citations

  • Molecular marker of rice amylose content micro-control gene SSIIIb and application thereof

    AU2020103461A4

  • Rice Wx allele for regulating and controlling extremely low amylose content and application of rice Wx allele

    CN116042667A